Til*- Amiul-, |Hl|l|lsfM'l| l|l|LI!H'lk miHilllls |lLI|kMS, |ll IIII..H i ll in «V*1v||MtK' Imlriih,

Hiiimihiilfil I'm in Mi- Mi- -ii 111 I! .|,mii\.il <,jnh-n,Si. I.imk PaptMNrM^irutiiriuuiilKirii'
\\w UmHi will alwi IviH-njitoL \H rriitrin^ri|itsiHi<' |wvr-n". irvml In ijipli I iiii-iL in-

■I -.-| .'■■'■ '■ '" f^'wr*. lilstmrlirMlsln \lllll.H* Llir ji| inl^l in |L- l^luflfu- IeL-I k*U('
•il i L .:-rh •.-. -. 1 1 1 ■■ - jiiI :•!■' .il--i :n :. I:'.l. ■ ■ ■ >ri iih- :il *v.Vi.rril>i£nn'^.<.r^.

IVIlUirfel C. l\w v

Srirrttifii tutitor,
\fiwmri Botanical Garden
I trih Par* la
\t«tMf(iit# Editor,
l,'. .-,..■■■■ Botanical Garden
Mlhwn VI. Hiwk
.Usw-Mh- Kditor,
Missouri Botanical Garden

I. ii;- 'Mi. -mi

Kii'xittVuxi I ■■■■:■,.' ■.■!■'

I .' . -.-.....■■-. fiuhminti i'Jttrtfi'ti

ii . ? i , i ;. iimii
£o* r'ft Editor,

[Hwntft Httfnt\irul C/fulrn

1 1. san A. AL-Shi-hW
Mhsnnri Bnfanu'fii Garden
l>rril Ddviilsr

ivii-h;..i«ii.l.ii

IW.iW/^.Jf.rnWr.W™
1 : 4 . r ^ 1 1 ■ 1 1 \(r| h |nT<Hin
■WfjtfrNJtt BofUfiirui f .'■',■■ J. -ft

Missouri Bomnirai Garden
Iknk wiimVi \W1
l/r.*wnJJ'i HtUiitiirvi tlmdrtx

■ -uLi M -ii|iii.,ii "lh

■■ ■•«! i-.l.-.-li. '-; ■l-:-:.l \ ■■,!-.:. \ i ,. <\<^. i. \|! \l k-

v.ln.^.i.i^MiU. lM:>.:-,I..LiLi^s.J.SlaH. li^vinh .UtIW. ,m.l S i v.m hW.

MK1MK MlK* IfejnM^l.i; KN I- .1 V:l i 1.. I ■ !■■ ,,ll I ||hH..*I, lii, J )l I, ■ ' * 1 1 . 1 1 1 ■- ."/

!■-■'•■ . - I « - --- ii I .-211 ii
, -Mr" r | , . Mi-^.iiM IM;ini.:iJ ■: I :i r.:l-'i i i* UnVwn
1.1. m lurwsijsi- iiikI i iiii.h I ilr.

h^Imxi' kn.^l-.l",. ;

■■;■:■■■■

IUCN Red List

rare endemic tie. i Tiber for making

angetal.,1991;

i i

' < ii i i « i ;-;sU 1 1 ii i I In i I i, l!i

i!'H.i; •■;■ .■■!

the conservation

52; Chen & Wang,

lli ' ■ i I -

During the course of preparing the treatment of

.■■■ i'i ii'ij .-I;', ,11

polygamous species by local taxonomists

1985; Liao, 1988, 1996). However, Rot.

hi ii i i i

taxonomic htei, li.it the inflores-

i II -

76; Li et al., 1982; Lu et al.,

Kamikoti (1933) sacs of the third-

Chang, 1976; Ying, 1985; Liao, 1988, 1996; Rohwer,

surrounding the in (van der Werff,

1997). The Mai:

i ' . . ■ / ■ i ill

a typical laurel flower may be

.; ! .'.!.. ■■■■ . •:■
h ^ ' , I I I i

eastern North America (Rehder, 1920).

In 1891, Hemsley described two species. Lit sea

nil I I I I "I

;.
n China, were

I VV ;■,.,!■,.

i l mi 'l I II i i II rcf i n n I ill"::

:■■■ lie: i; i, in ■■■). ...

i '■ -. !■ I: ^ :■ ■:

I, i i , i I I , i
I, 'I II I".

'.'

m China was
V.mble, 1916). In

ill ,li II ■: ■, : „ ■, :■: ■■ : ■ .

'*; i ■ ■:;■■■ I

Hie i:'!'".w ■

I '.Ml i.. T..- i. . • ■ ■

(1911). In the '

ill . III i ill ii

^ ^ I ill II ill

whose taxonomy ( tortance of anther

ased on Wilson's

.:.■;,■

II II II

...
to Sassafras and was described as an and)

I that flowers of 5. tzumu were
unisexual. Despite

as a separate gem \sia was followed

1931; Liou, I''

I »[,j, ■■■;!■!.!! •

■■.hi!.: i ,.■;,!
: the sexi.alitv of
ria as dioecious.

.

var. rajidaiensis 1 1

In December 1920, Kanehira published an article

■ ■ ■ , ; ..: T:miv:.: I,

•■■,■;,;. .■;■•'.■■■

:.:■•.. ill.. .::..|, Mil..-

described the morphology

ii i i 'i n

mixed with the Interesting!}, in

the illustration,

I . 1 1 1 1 1 1 1 " ! I i

I I

' . '.' .. ' ..■
In 1953, Keng published a taxonomic revision of

concept of Rehder (1920) except for furii
Keng. Keng's (1953) interpretation on the s;

.. . . : :< •■■:.■ Hill ■ in:':.

Asiatic species are apparently

mi !;. ! ; : .

' ■ ■ . ■ . ■ ii: :■■■ ■ '

(K>n. >■.. I 'a,'.; '

■ f:' 1 i ■' : ■ .

Ill ii ' i

eng, 1953).
In a monumental deniii

.

• .-.. . ■;;: . ■ .

description of the male flowers was basicall

respectively, thai

in Kanehira I

( !'• ■■/■'). Hi:.:'"

Lauraceae in Taiwan described S. randaiense as a
polygamous spec. l». 1976; Liu &

Liau, 19oU; \ .i

.ii of the male
In their article titled "Studies on the propagation of

ei-s of Taiwan
Ai et al. (1982) also commen-

.: |.i ,!:.. :.i

. ■ ■■■ : :■ ii .. i i ■■■ '■..■ ■:. •: :
To facilitate the understanding of the complicated

i ■■ "ii

■ : ■ hi:' II i

' ' ' . ' ' . ' . ' ..

■\ ■■■■:* -.V:\.-\. '. ■

i&S JS&Ct!:

a^^e ^a

. ' • ■ : . . : ■• . . : : : . ■' '. ■ :■

r i

V

lliil i 1 1 I

- ■. : - - - - ;

u' »ii I ■,!■■:..

daiensis Hayata, J. Coll. Sci. Imp. Univ. Tokyo
30: 257. 1911. Yushunia randuiensis (Ilasata)
Kamik., Annual Rep. Taihoku Bot. Gard. 3: 78.
1933 [1934]. P.seudosassafras laxiflorum var.

, I: . : .«.i |!:«:

126. 1940. TYPE: Taiwan. Mt. Randaizan, 1908,
5. Kuwwio .s-.n. (holotype, TI!).

■

' ■:<■>■■ : i in ..'I'l i ■: ■

in June and Jui

icences of Sassafras randaiense are

in- II i, , I ii I - i in
1989) by four to six derm,

is described by

!■■'. Ill' I'M". '

inflorescence of S. randaiense is determina

(7-23 [12.68 ± 3.19, N = 147]; Table 1)

. . ■ :
(Fig. 2A). The determinate race

II . , 'i I I

2.5-8 cm [4.18 ± 1.22, N =

10 (3-10 [5.54 ± 1.56], N = 28) pan

'.'.^ "i :

,::■.■.:■::!: :

appearance of an umbel of panicles and/or botryoid

■ \ ■,!■■■:■ .

gate (van der Werff, 2001), as

Mi in

ii ■ ■■■; : ■■■::■■■:■ :

Werff & Richter, 1996).

All observed flowers of Sassafras randaiense

'■;' I .!!TI II ' '

possess a pair of globose glan

■,-ik.l ;■■-.. ■ ■

: < I : I! ,-.

, ol 2-ccllod

I (1 II

. 1 mm.

,-d in Kanehira
Liu (1960).

anthers of the third-whorl star

ff, 1991; Rohwer, 1993). In the

i in I

1996; Liu et al., 1994; Yang el

:
s for the Lauraceae.

r ,nl*.lilol if ■■;

i II II 1 II I I I • I I II . i II

l.i :■... ('■; : ■

.). In Figure 2F and H, the
,■ ; ■ . i;. i, ■, :
longer in close co whorl stamens. In

I II !

whorl anthers of
S. randaiense were introrse as described b\

' il:"l I ■ '■■'<■■

would not be dispersed away from the flower.

The protogyny and sexual phase synchrony in a

ubitzki & Kurz, 1984) dichog-

!'

II , , 111 Ml, II

!:■ ■' "I i ' ■

;i.»; I ii ill ■■ i'-

i '.r <•' I .

existence of sync). in S. randaiense, it

would be necessary to tag and

|| '!../:>.} I:

Utteridge & Saunders, 2001). Although we .

i [he reproductive biology of S.
randaiense in the next i

The protogynous and possibly synchronous dicho-

androdioecy, Rehder, 1920;

V

phase (e.g., Fig. 2E, K), (he flowers are usually

I - I i i

gynoecia are likely to be interpreted as noi

1 I I'l. ill

(Fig. 2M, N) did not allow us to closely examine its

QUESTIONS OF MALE FLOWERS

randaiense led us In qui

936) and Liu (1960). Similar

in ii. ■ Ii

in Liu (1960). Although Hayata (1911) probably

■

■■■; : >'''■ «■!''■■ :

present in the type specimen and precisely

flower materials >er 1918, the line

' ■:■(-,"> ■.>.<■:■■■

•, "I ■ !■:(;■,:.

■ f .;-!-.::.|.:...... ■::■

Ml |!

II I II I I i : I i II II

ml no flowering
material among Wilson's collections (E. H. Wilson

saki on the same
trip with E. H. '
10682-10688 at TAIF; Sasaki, 1930). Without a

■::■:..■■,.■:■,■.■.■.■;■ iM i

Denk. T.. K. Gun

North Atlantic biogeography. Bot. J. Linn. Soc. 149:
369-417.

- I

.-T. Lir

.. im;i;.,.;
2: 55-56.

2833.

on Sassafras randaien e

clarify its inflow , (||| ( hmesfJ _ ul|h

• li summary).

■' ■ ■<"■■■!' I' !- ' ■>"

economic' interest of S. randaiensv in Taiuan. il is " T ^ ai1 Forest. 5: 30-31 (In

M ' IUcSl. IUCN Red List Categories and Criteria, Version

. ,;,,.,:.-:. ,:, .

there is no demanding

II i , , . , ' , i I I II ! I I I

! town. Government Research

■ ■■ ■ . ....■•..'

i I

dichogamy, in the

i •

(I

i v ,.ino seed _. 1913 . p^dosas.ajuis H. Lee. Nouv. Arch. Mus.

production in popn Hist. Nat. ser. 5, 5: 108.

Livingston Publish-

- — ' ..

n t? ■ r- i\ t>

' " ' " " '. "•' ., ' i-i. .;

^ '^- • ' ^ ■■ i Hi i.

.ii.im, . ,i

Chinese),
r \i

: ii

in ll

i I leal' cuticle data.
Austral. Syst. Bot. 13: 1-13.
, :, t fit d Li, X. W., J. Li & H. van der Werff. 2008. .V

a\ en & D. Y. Hung
nispermaceae through

Flora of Taiwan, Vol. 2. >., Taipei. Botanical Garden, St. Louis.

. 1988. The Taxonomic

;ae in Tail

, Taipei.

i .! ,1,

s Flora of T

/ol. 2. Editorial Committe

B. T. Guar

i, S.-T. Lin & C.-F. Yu. 2C

'1! , , II

Trends Eeol. Evol. 15: 595-597.

.1. G. Rohuei c\ \. liiltiuh (edilois). I lie kundies and

. Taiwan Univ. 17:

isli abstract).

Sussa/m, Ninddirnsc (H.iv.l Kelid. seed. Pp. 365-368 in
S.-C. Huang', S.-C. Hsieh & I). -J. Liu (editors), The Impael

Proceedings

Lire Societ) for die Advancement of
miri and Oceania, Changhua.

:

& Cie, Paris.

'.'iHnru:;/. 1,1 ,;!" , , , \ :i\ . Vr: I ■ < ,i ulin,

& C.-i I, . \»1 1 lh<

368-374.

II, I < Ml

S. Bajdj (e
Weberling, F.

•" . . .

propagation of Tare an I . Chin. Forest.

15: 73-86 (In Chinese, with English summary).

Yuan, Taipei (In'chinese).

disjunct pattern in I

16: 121-138.
vie, Z.-L, J. Wen & H. Su
biogeography of Sassafras (Lauraceae) disjunct between

i North America. PI. Sysl. Kvol.

Rev. Ecol. Syst. 30: 421-455.

' !

Tertiary. Ann. Missouri Bot. Card. 62: 264-279.

■.iH'.Hn- - .!;■ :

shoot tip and nodal culture of Taiwan Sassafras (Sassafras

31 39.

Vascular Plants, Vol 2. Couik

„, Lane, (In Chines,.).

ESTUDIOS EN EL GENERO
PASPALUM (POACEAE,
PANICOIDEAE, PANICEAE):
PASPALUM DENTICULATUM Y
ESPECIES AFINES 1

: : I'm

: ■.■...!.!■■ i.;.': •■■■ni.ii, ' ,.:■:•

,lil- ,: ■;.■ ,■:.-:..■ .

'. . . ■ . ■ . . ..

I . ■■ .>.,:■>■ ' .:.■:': ' . ,' .',,;,,, ; m; ........

•.'•.'.■ ".''.''"' , ' '■ '. !: -'"l '

' ' .' ' , ,, . . ' '

' . . ' ■■.■■.

:- I- ■;•:■ •

Dallwitz, 1992; Zr , la autora reconoce

1 1 ;

i '. ■ ■■.,'!', •' '■■■.. ' , ;' M'Ui: : : !" '.

iiii! mi

' ' ' I

..■i/, 1 .' '/■, ;

. . i .-! ,M I,-.

-' Instiliilo de I'.olni, : n„s Aires, Argentina. Autor para la

(17/2008092

souri Bot. Gard. 97: 11-33. Published on 31 March 2010.

I\v:'.! ' ; .. ' '

■.■■-•v;/;-';/.';:J..

que incluye las restantes espec

por Zuloaga et al. (2004) y Zuloaga y Mom
Tabla 1).

Entre los grupos informales del subgenera Paspa-

i I

P. arsenei, P. crinitum, P. denticulatum Trin., P.

mutabile, P.

proliferum Areehav., P

, P. remain,

i J. Remy, P.

trich ophyllu m Henrard;

grupo por i

1" ' PI i !'

o relativamente delgado, raquis de 0.5-

2 mm de anc

de largo y fru

to palido, papiloso a liso.

Morrone (2005) recono

•

bentes. de v;

por el antecio superior paj

zo y papdoso;

Chase (ined.) In. I,
grupo informal Line;
-r:

inearia). Reconoce
presentar plantas !•

I Genero Paspalum

; ; ri : ■. /. .■■■,■

solitarias. Zuloaga y Morrone (2005) tra
planum en el grupo Livida y las especies \

informales NoLata y Ovalia.

como parle de l

grupo Livida y analizar, desde un punto de vi
especies que tra < lit

especimenes de It
herbarios: B, BAA, BM, COL, CTES, F, FCQ, G,
i, K, LIL, LPB, MA, MBM, MEXU, MO,

. ; . ' '

:

un microscopio electron i co i

!.', s (!■■■■■;'■■!
Lmrwiir.M'o Taxonomico

especies de Paspalum, por ejemplo

■ !,■.■ ■■■■■! !! ;'■■ ; : ::■

rone et al., en prep.) sefialan que el grupo es claramei

obovoides, no orbiculares, plantas (30-)40-150 cm

..'"'• .i"! ■■ I '< '■■-■ ■!!!■■■■

hasla 1.5 veces mas largas que anchas, con pelos
Mexico 8.

:•(.. , ■.!■:-■, M I.,:'''

■ ■■ 8

ah, [ i ,i '

iii i' 1 ;. . ■•■■■ ■

'-)ii. I II iii i I I 1 i i i! 1 II i

de bases no flabeladas 10

is, oscuros 2

1, L 1; sin-|csr[iiim 5.il.r:5.iliiuxiFj'j "Ac:/... l'ic\:v.:. ,

Regni Veg. 15: 75. 1917, nom. cons. prop. 1803,
Taxon 57(1): 304. 2008. TIPO: Mexico. San Luis

(holotipo. B no visto; isotipos, F 105515!, foto
SI!, M! MA!, MEXL 3419!, MO 2354872!, foto
SI!, P!, US-2941970!, W!). Figuras 1, 2, 3B, C.

;'w-';- /.■

167. 1886. TIPO: EE. ILL

:

Plantas perennes, cespitosas, con rizomas cortos.
hojosos, cubierto: is; cailas erectas o

! in ,

I' . I .

i si a dorsal n

I Genero Paspalum

• i

' 'J:', I ■ ; i" «]■'
. ; ■ 1 ■ I ■: , II I! - n:i ',.

II Hi. .11 III ic.il ■

glabros, las superiores de men

le 50 cm, cilindricos,

argos pelos papilosos

.2 mm, triquetros,

,

1 1 1; . i l ' i I i i

'! ,;:!;■ ■: : .. ' .. .

:M) am: C = 10 hit

nor ausente; gluma superior tan larga como

do central los

!]'■: , ,,i,ni.

el riivel del mar hasta los 200 m.s.m.

- I- \ ■ i ' ;<i:n:r

Numero cromosomico. 2n = 40 (Dandin & Chen-

L977, 1983).

'

Observaciones. Paspalum buckleyanum ha sido

tricelulares junto al apice, con abundantes <

' ' ' '.':,.<, || ;•■::■ roll

:.

papilas en toda su supeificie

onimo de P. alcalmum.

margenes apicales; Iodic ul as 2.

■■' |. ': --I.';! ! ,...

sobre P. alcalinum, Debido a que el ..ombre P.

'

Pasjxtlum alca-

. ■■:-V-i',)

Pohl y Davids;

i ' , i I..

■ ' ' n. "■ ;!,■ *

' ■ , ■ ■ , .

'': ■ 1 ■''■<■: ;!!.■■■■ ^ .■:■ 1. , .1 ; i

I Genero Paspalum

Kojus 5597) o
erectas (Rosengurtt 5863, Rojas 2778).

alcalinum se distingue por sus espiguilla:

: . :■ .. ; ! ... ' : ; . :

San Luis del Palma.

Bella Vista camino a Empedrado,

...'■;.■ I .. II ■■:

Toledo 1235 (SI). S Los Amores, Bissio

■ I I i.i

antes del desvio Kill

.: :

Villarrica, Morrone et al. 3639 (SI).

Rosengurtt 5863 (BAA, K, MA, P

T ■.<■!.!;.. '

■!■■.!■ ■■:;;, :-.
1049 (CTES).

U.S. Natl. Herb. 17: 237. 1913. TIPO: Mexico.

.",.-/ mi . i ;::".'" . i
G. Pringle 3755 (holotipo, US 824361!; isotipos,
B no visto, F 105506!, foto SI!, MA no visto,
MEXU!, MO 2977056!, MO 5114653!, P!, W no

Plantas perennes, cespitosas, cairns erectas, de 50-

l< i, , I! I

iHidos 2 a 3, glabros. Vainas de 3

I; if I

:■■■■;

■. in.rr- :' . ■'.

fnulos glabros o

: l> ■". ;i :■■■:.■■

7 :

^- . . ■. ■

)tusas a subagudas, glabras, menos
»rta y esparcidamente

fit at. Esta especie es

1 <<*■ ;!.,!■

Potosi y Puebla 999), en suelos

in- V la lenui inf
pajizas o con tint:

•i ente afin a P. dei

. = 40 (Gould, 1966).

;uillas elipsoides sobre
glabras, ocasionalmente
de la gluma superior; la

, MEXU-213533; i

stambres. A-B de Hno. <

I Genero Paspalum

in I 'I- ' i ■

Material examinado. MEXICO. Coahuila: Chojo

[Trinius]: 111. 1826. TIPO: "Amer. equinoxial",
s.d., /. Lindleys.n. (holotipo, LE-TRIN 0441.01a!;
isotipo, US 2854656! [fragm. ex LE]). Figuras
3D, 7.

?'..,■.. ,■'."■/; •''," '

TIPO: Mexico. Hac. La Laguna, Julio, C. J. W. Schiede
s.n. (lectotipo, designado por Chase, 1929: 57, LE-
TRIN 0441.03!; duplicados, B no visto, BM!, foto SI!.
G!, P!, US 928992! [fragm. ex LE]).

deo 1: 63. 1894. TIPO: Uruguay, s. loc., feb., /.
\1 no vislo: isolipo,

CTES!).

• h •>;;. ■■•*)

I IPO \rgentina I u< unian s. loc., 7 ene. 1873, P. G.

Lorenlz & H. E. IS.

isotipos. 8! : "Ui. ex \\ |).

1074. riPO: \rgenlina. Juju>: Dplo. Dr. Manuel

Belgrano: Sierra
i'eb. 1971, A. L Coin.

canas erectas, deeumbentes a estoloniferas

I I '' I'

cuello glabra a ligulas de 0.6-

X 0.1-0.8 cm,

udo, los margenes escabrosos,

I

■■; . ■•; : i :■!■.>■'. u.

:

i I II ■ I i I

;;r'.- -in i; :; ■ ! ■ ■

de 1.9-2.8 X 1.2-1.8 mm, a^udas a
tintes purpureos y lema inferior

larga como la espi un nervio central,

junto al apice a II

iguilla, 3-nervia;/xz/ea

' . ■■■■ : -■■'.■■■

aente elipsoide, de 1.8-2.2 X 1-1.5 mm, crus-

i nil 1 1
cie. los margenes enrol lados sobre la palea, 5-
palea de textura sin

1.6-2 mm. Cariopsis elipsoide, de 1.4-1.8 X ca. 0.8 mm;

III III I ill III <ll II ! II J:- :j;v' ;::: l>l i,i

liurkail. I0()0: : , ,<)7 (I)

/ •

■ ■.. :.^0U -I.-, in..

= 20, 2n --

II ! ,i I

Quarin et al., 1982; Quarin & Burson, 1991;

et al., 2006).

Observaciones. Chase (ined.) cons

I 'I

'.'Hi; : I ' ■

I'" a ■ a;.

especie, restringiendo a P. dt

Uruguay y norte de Argentina,

a P. lividum desde i
Brasil a Uruguay y Argentina.

:

Ramallo, isla Las Hermanas, Burkart 12809 (SI).

: mi

: ' "• ■: ••'

'■ . ■." ' : :;■

. • • ' ' ; "
. ,/, , ,' 1 1 M i j|,i -

SI). Tucuman: Zapia. Rodrigue

:-,■»::■ ;/:<■').) \ ' '

■ .'ii"l I'll li-. !l ( ■::

'.,, I ',i

. ',,' I,!, i

;■ . . -

!|:i< ,:i: l;\;', !•

. ." . , :.■ • .' ;

ca. del puente la Medina, Won

:" ' .

\l); Monterrey, La
T.-!.i. ii.i. | .

. . • ' ■' ' ' . ■ ■:■■

a. 10 mi. SE of

?0 (SI).

.■',', ,.'

: ' ■:- .■■■■■ '.h.io

■'■ ■■,■,■;.■,- /.■■■/.■- : •

ca. del Rio Hueque, Wingfield 6223 (MO, VEJN).
4. Paspalum hartwegianum E. Foum.

fossas prope Leon, s.d., K. T. Hartweg 245
(lcc-Lolipo, designado por Chase;. 1929: 58, P!;
(lupin-ados, B no visto, LE!, US 928960! [fragm.
ex P], W!). Figuras 2, 5.

.'• I,.-.... ; - :', ,, :

;■;■■ .■■

i euros. Vainas de

<V.|o I !'.:':'. ;i:'.

■fl.i..; -l-'llli.;';i:'.

hacia los margenes apicales; cuello glabra o piloso;

■■ "■'!''

i\\:-\fv. r-rhicro, jdiln;-.;'. '• co'i .nnbi:'. ■• ; '• ' .

' " ' ''I'M l: ! .':■■.'.

terminando en una espiguilla d

i'.:-.ii< "'II.,'.

elipsoides a ohm 3.1 X (1.4-)1.6-

1.9 mm, aplanad;

edicelos. — I ). Espiguilla, visla del lado de la gluma su . \ isla del lado de la lema inferior. — F. i

ausentes. Antecio superior anchamente e]

■. i .- It. 'Ml ■; ■ 1 !■ If ■

"7a/. Especie eride-

' ii Li I ili " II I i i , i "ii,'i|i -'I

i "

A ':■"■!, ,K I h .

w. n = 30, 2n = 40, 60
2000; Morrone et al, 2006).

Obserracioiics. Esta especie se caraeteriza por sus

bajo esta ultima especie.

Chase (1929) utiliza caracteres del color de las

grupo Livida. A su vez, Pohl y Davidse (¥K

i I.

:■ i:,i n,

I 1 1

3.1 mm de largo y 1.4-1.9 mm de

l II i, i

„,■!! I ,:, <'

' ' ' I II

W.3 (US). Morelos: Tepozllan

' I'.). 'I <;,■.•,<■:>;

;

■•

104, fig. 9. 1969. TIPO: Brasil. Rio Grande do
Sul: Porto Alegre, 11 feb. 1953, A. Araujo 179
(holotipo, BAA!). Figura 2.

tivoize, Kew Bull. 42: 922.
1987. TIPO: Bra

H.lolipo, MBM!; isotip

nnes, estolonfferas,

■ i.

: ill' !!'■

, '

. . .

I ' ! 1 'I I

s, base redondeada y apice
amente escabriusculos. Ped-

,'■'.■■."■.■'•': ■'■:■;■■.

'' ■ I'll I "

; ill'

''I i; I :'. .■;;■. '

piano, verdoso, glabra; pedicelos en pares, breves,
hasta de 1

.::. ; ■..:;.■■ i i

mente elipsoides,

-■ ■■ h :■ i - ■- m a. . ■.

5-nervia, con un neni

I Genero Paspalum

convexo, papzo, papilos
di t 1 1 s_ J i

micropelos bicelulares
margenes 111 :^ob

;a, 5-nervia; palea de
1 micropelos bicelu-

■■h/,1.1; ■'. !M.

Iconogrqfia. Parodi, 1969: 105.

Distribution geogrdfica y habitat. IlabiLa en

(Parodi, 1969), Parana, San

ta Catarina y Rio Grande

1" i

Numero cromosomico. n

= 30 (Morales Fernandes

et al., 1974).

Observaciones. Se carac

teriza por el habito ras-

i i , II ,

itravaginales, las \ ainas

ntrenudos y comprimidas,

aquilladas y pilosas.

Zuloaga y Morrone (2005)

i ubican a esta especie en

informal Livida

y la relacionan por su

kalinum y P. denticula-

istinguen de ambas por el

[■ii'.j.l ■:■ ,

pulvinulos pilose j

6 cm X 1-1.5 mm, aplanado, verdoso, glabra;

I: -V.t> .": Mi:'

2-2.3 X 1.6-1.8 mm, plano-

' ' ' ' :■. ' . ■■( i i <i : V.

gluma superior tan larga como

:

I I Hi

:

Guaratuba, Rio da Divisa, Hatschb

Herb. 28: 61, fig. 29. 1929. TIPO: Mexico. San
Luis Potosi: near Cardenas, 20 July 1910, A. S.
Hitchcock 5773 (holotipo, US 928949!; isotipo,
US 928947!). Figuras 2, 6.
Plantas perennes, cespitosas, cahas de 20-50(-65)
; de 4-15 cm,

' ' ' r.- '.:!!.■ '•

'I —

pilosas a glabrescentes; cuello piloso; Iil

• J l i i ■

lanceoladas, de i, planas, ascen-

■.■■.'. .::<■ h: '■■■

I I I 1 1 'I

Distribution geogrdfica y habitat. Paspalum mu-
eretaro; Beetle et al. (1999)
Crece en campos abieitos, aibustivos o pastizales,
entre 1000 y 1900 m.s.m. (Beetle et al, 1999).

Observaciones. Esta especie ha sido poco colec-

Los fragmentos observados del holotipo (US
examinado de Pasp

urn Hack., Bull. II
ser. 2, 7: 448. 1907. TIPO: Paraguay. "In campis
in regione fluminis Ihu", nov., E. Hassler 9647
(holotipo. W!; isotipos, BAA!, BM!, G!, K!, P!, US
2855825!. W!). Figuras 3A, 7.

Figura 6. Paspah
edicelos. — D. Espiguilla, v

I Genero Paspalum

guay. Caaguazu: Caaguazu, 9 nov.
a 70 (lectotipo, designado por Zuloaga

) Morrone, 2003: 101. B!; duplieados, I!!. BAA!,G!, K!,
L no visto, P!, SI!, US 2942532!).

,„, 2-4(-5) mm

. . . ... . . . .

.. . ■ .

,1 ".V.!*: I'V'iui"
III I II i i

n en 1 i e l

|. Ml 'Ml'

' ' ^ . ■■■;■;): |-..:, ■■].■-!■ i\s, ' I

> ''II;:: I ,1

I I I , .

Ill: si;!', : <|< I. '. . ',. • :
'^ ^ I'l I t''l "

inpureos, de apice

como la espiguilL lelicada, de dorso

i ;ini-.- ih:- !■■• ■ ■

I

Distribution geogrdfica y habitat. Hasta el ino-

(1 ',11" i :■ M < ■ <:-:;

, II

arenas blancas; llega hasta los 1600 m.s.m.

Observaciones. Ksta

i;i 5 cm. con
Chase (iried.) Lrata a esta especie bajo el grupo

de Nees ex Steud.

y espiguillas en pares -

Paspalum ovale I grupo Ovalia

i ul ■

/■■■;!!■ :•>■:.;, ,■:■.■

material de la coleccion tipo de P. planum.

: Pico do Iti

1 ■ : i i ■ i ■: = ■■'

■! (CTKS).

IV.;,,

tipo, designado por Chase, 1929: 28, P!;

duplicado. US 201252(1! |hagm. c\ P|).

■ii.'i ,,:.■•!■
florum var. glaucum Scribn., Contr. I .S. Natl. Herb.
3(1): 19. 1892. TIPO: EE. UU. Te^as sep 1883 \

S 2855997!).

Agric. Exp. Sta. Univ. Tennessee 7: 32.

1894. TIPO: EE. IIJ. Tennessee: Davidson Co.. Belle

Meade. Jul. 1892. /'. L Scribner s.n. (lectotipo.

r 11 238!).

.'..;.■.■■'.-.■-,■ .■■■■./

Club 13: 166

,. ■'.. ■■<■■ ! '• '•

I'M < I

Langlois 26 (lectotipo, designado por C
US 2855999!).

irk Bot. Card. 1(5):

1-15 May 1894, G. V. Nash 680 (holoti

31. 1929, syn. nov. TIPO: Mexico. Puebla: Mayorazgo
sur l'Aloyac, vie. Puebla. 2120 m, 18 Jul. 1907, B. G

MO 841747!).

los blanquecinos a
entrenudos, glabras a esparch

ii'ihr ; ■=■.■..

(0.6-)0.8-1.2 cm, planas, glabras, menos frecuente-
agudo a setaceo, los margenes escabrosos. /

!.■■:■ 4-1- -ly.f- ■ ■

uperior. — H. Cariopsis, vista escutelar. —I. Cariopsi Lr 2611, MEXU.

: l-fli', ,;■...

:■,■,■■

■ '■'■ .' ; . ■■.■;..,■;:;'., ;■, ;■ ■

•■ .. ■;■■ ■;-■■< ■ '" -'■:

pubescente, raro glabrescente

'.■■■■

'■ i -'I h." III.;'

2n = 60, 64 (Gould,

-,,.. :■,:■!,• r.

1 ■'!

1

)!,=; m,-.:'l

utilizan McVaugh (1983) y Beetle et a

J. (1999). Sin

poco preciso par entidades y no s

Calmer 515 (MEXU). Durango: Tlahualilo, La
nejillo, Rodriguez Castaneda 37 (MEXU). Gua-

■■.

Aragon 377 (MEXU). Zacatecas:

1316 (MEXU).

Paspalum rcmotum J. Remy, Ann. Sci. Nat.,
Bot., ser. 3, 6: 349. 1846. TIPO: Bolivia. La Paz:

Cotaiia, "in valle calida sub monte Illimani",
1839, J. B. Pentland s.n. (holotipo, P!; isotipos,
OXF no visto, US 2855998! [fragm. ex OXF]).

is castafios, glabros. Vainas
estriadas, con los margenes membranaceos, glabros;

-,. de 8-20 X 0.8-1.4 cm, plana
redondeada \ a irgenes glabros,

14(-20) X 4-10 cm; eje principal <lr 2-10 cm,

' .■ .P. LI'.: I,'

:.. \erdoso o con

■■■; I ': ■;■; I " : :

I Genero Paspalum

■■■ ' !.!■■■ ill.:" ;■!!■»-

Cariopsis no vista.

Icoiiografia. Zuloaga y Morrone, 2005: 229.

■■■v./:://;-';'-.-..

400-500 m, 14-17 feb. 1930, 4. C/wwe 70926

(111! L 1500550!; isotipo, SI!). Figura 7.

Plan las pcronrics, largamente rizomatosas, de base

■■■' ... :'..«■ I Uit

mayores que los entrenudos, de 9-25 cm, coi

•'. -■■.:■•> 1- :..-•.■

de 15-50 X 0.4-
os margenes,

cos, estriados, glabros;

. I -

8, ascendentes, ;

"• i, HI. I n ill I i i |"ii <■;. II i iini I

. m: 'I:! ■!<
' ' :'i i !• ' '.

elipsoides, de 2.4-3 X 1-1.2

gluma superior y lema inferior
subigualei-

Observaciones. Ksla especie *e ivconocc por >u

frecuente observar espiguillas con prolongaci
ejemplo en el ejemplar Zuloaga 5826.

. ; 'in \ .

no de Jujuy a Salta,

:;-:il ::i : hi;;.

.'■',' !

i ' li mi '

, I! 1
■■...r..i::. ■■'■■/■■

2.4 X 1-1.3 in

Iconografia. Zuloaga 5

de Brasil, en Mais 1 Paraguay, en los

de lagunas y rios, sobre suelos hiimedos y arenosos.
Observaciones. Zuloaga \ Morrone (2005: 243)

e el antecio superior, 3-nervias". Filgueiras (1993)
:valua las especies descritas por Swallen (1967) y

s.Oliveiray Vails (2008) n

I I

t. 123A. 1829. TIPO. Brasil. s. loc, s. coll. s.n. (holotipo,
LE!; isolipo, SI!).

TIPO: Brasil. Ceara: Cralheus. 9 1() Max 1934, ,/. R.

■:. !'■<.,■ ,-.,

nov. TIPO: Brasil. Pi,

[--, . ! :.• ■ >,,-.
I : • ;; :■ ', .'
■■■ ...■,■..,■■;,-/./ ,. ■

» Island, June 1918,

. . I . 96!, ioto SI!).

TIPO: Brasil. Bahia: near river inside of Typha &

m.s.m., 15 Dec. 1924

1 cm, terminal i

pc(lic(4o> (Mi pares, de 0.4-1.2 mm, glahros

(1.4-)2-2.3(-2.6) X 1-1.4(-1.7) mm, plano-convexas,

■

'" ' ' ■. I, ll;.h: . ., ,. ■■■].:> ;: ; . '

III 'II II II ' Ml) HI! Mill I I II , ' I DliM

III ,111 < Mill

-iitc (Mi sabanas inun-
dables, desde el nivel del mar hasta 500 m.s.m.

cimos, pedicelos.

.?.■■ ■:: r ■>■

juices marcadamente escabro-

um var. ciliatum.
Chase (ined.) incluyo ■

■ -.
P. pisinnum y a P. irirai. Asi, en Chase (ined.) aparecen

J, „

Batalla, A. Chimal Hernandez, M. M. Castillo Badillo, 0.
M. Galvan Garcia. J. L. Villalpando Prielo. M. Lizama
Manrique. J. V aides Rewia. K. Manrique de Skendzic &
A. M. Rodriguez Rodriguez. 1999. Las Gramfneas de
Mexico, Vol. 5. Secretaria de Agricullura \ Recursos

'■: : i

1-551.

grasses of Ecuador, Peru, and Bolivia. Contr. U.S. Natl.
Herb. 24: 434^55.

Conlr. U.S. Natl. Herb. 28: 1-310.

publicado [annot. 1939]. Hitchcock and Chase Library,

D.C.

CI < I.

Her Majesty's Stationery Office, London.

Indian Sci. Congr. Assoc. 64: 146.

:. ■ ■ : : ■■■■■■

considera un caracter diagnostico para la especie.

•inado. BOL

!,...■!.■ .^ .

. . .

2135 (US), Black 8982 (US), Swollen

!',. I: C :

: :

..-, :-.,.■.■ ..::...■

:

H Hi n' I ,■■,,■„„

. . P.!-',: ,:::

Spec. Nov. Regni Veg. 15: 60-76.

M > II. I

I Genero Paspalum

J :

■:■:>:■.

& . 2001. Po5/)a/i

Ulloa Ulloa, A. Pool & 0. VI. Vlontiel (editors), Klora dc
Nicaragua. Monogr. Sysl. Bot. Missouri Bol. Gard. 85:
2099-2114.

de Argentina subtropical. Hickenia 1: 73-78.

■" I!
apomictic Paspalum species. Cytologia 56: 223-228.

Club 94: 1-17.
Renvoize, S. A. 1998. Gramfneas de Boliv

Stipa, Poa, Andropogon \ Phalaris. Inst. Genel. Fac
i. Buenos Aires 2: 65-74.

(Poaceae: Bambusoideae: Ohreae). Smilhsonian Conli.
Bot. 69: 1-79.

Su alien. J. K. I"

3C,T. S. Filgueiras, P. VI. Peterson, K.J.

REVISION OF THE CARIBBEAN Shirley A.
GENUS GINORIA (LYTHRACEAE),
INCLUDING HAITIA FROM
HISPANIOLA 1

■:'■!' 'li " I. ■ M I ! ' i M ■. ..

' - ."(i.ii: '■ ■ : i".

' ■.'■.■;*, ; ,-■;,„■ : I:., \:<. : i

! r

: ' ' ' . ' ' '

i. nearly all are

■■■■■■ < ■ ' ■■

1 1 >i ions, are poorly

:■ . , ■ ■■■<■> Hi: .•■<' ;

ose- or white- (Koehne, 188;
" ■' ^, ■ ■ ' ■ ■ ■

; (dally dehiscent, 3- to 6- h«

! , ■ I ! I

■ ■ , «ii •:.,;■, !■:>;■:, i.

floral and seed morp le An initial morphologically based phylogenetic

.,.,■■.■,,■■;. ui>i,<nr : .
Hispaniola; the mi -:0()2) included in a

Dgeography of Car-

Lorence, 1978); air

i , ,

■■■'■■ i i ii ! I,i,l

■.:;.,. ■!!:: So-'.,,,'

7/2007028

iouri Bot. Card. 97: 34-90. Published on 31 March 2010.

from the nut-lea i

ii ■ study found a s

Croix by J. P. B.

ii- !.■■'.-■■: II

seb.) Britton). In 1880, William Hems

:

remained unchai »h of the Lythra-

<■) M,'i ;.-r ,

From 1912 to 1927, the explorations of Erik Ekman
Britton and Wilson at The New York Bolanii

In 1919, Urban erected the genus Haitia, based on

possession of a double calyx, in re
the prominent epicalyx that encircles the ext
floral cup at the base of the sep;

considered typicj cond species, H.

■'-■■■ :■ ■.'<■* I I''

C. Schmidt with a 3- to 5-loc

F Ginoria (Lythraceae)

ils inception i

1986). Koehne (J ia and Tetrataxis

■y *

1 1 1 1

-grown specimens obtained i:

'■ <• ■!■ '.■■/■■;

CHAPA, CM, ENCB, G, GH, GOET, F, FF, FTG,

HAC, HACC, HAJB, HCZ, HIPC, HJS

IPTH, JBSI). .11 \C. MO. NY.S,

online at Oill. ; >;/ih/>. The fol-

.' Ill'',:

Flora and Fauna, ICZ, Herbario de

■ ... Ml ..I, I l: 111 I

■ 'in i:

de Las Tunas; and MNHNC, Herbario

ns examined, collectors' names ;
ii ii ■ i in i "I

Flower buds from field and greenhouse-grown

-d 10-15 min. in
IN HC1 at 60 C .carmine. Counts

I i 0< .1

■ : ■

section on phylogeny.

(Miranda, 1952), and

as 12-15 m in height (Liogier, 1968),

.. .

terminal vegetati ubsequent devel-

rininal axillary buds.
; slightly 4-angled to

I

" . ' ' ''I II ". ill'-.

(I or 4-angled stems; both have normally
developed terminal buds.

lericana, G. arborea Britton, G. gin

,V,.V;Wi, ■■••!..,>.■? .

Lorence, 19711: ig, 1979) and for

;enera possess the
two major wood anatomical features that
the order Myrtales Lo which Lythraceae belong,

Vliet & Baas, 1984). They also display numei

• ood anato:

1 'i 1

N. E. Br., Lawso.

!<ii i i ill II ii i

-' . - ■■-in, ■' i i.

Hi, mill- ■;■ ■■!■ . "

Iini: C-K 2 mm;F = 1 mm.

Mice overlapping anatomical

(.: J!'! I,

I I 'Il 'M. I i lldl

ng, 1979; Baas,

characters are ui genetic relation-

ships in this study.

F Ginoria (Lythraceae)

:

All species of Ginoria, Ilaitia, Tetrataxis, anc
exception of G. americana, the stems of wh

; ■ ii." -.-. iii'V'"'.i

, : "I III:"

,-iM-b.) S. A. Graham (Fig. 3C), G. arborea,

Crenea terminate- d (polytelic sensu

Weberling, 1988 Sriggs & Johnson,

MMN , * CI-' ■: . .

acropetal. The formation of flowering shoots among

. : K ..."

II" <:■ i :

-II li li III - i | III I s ;J\ Ill lull u,

I'll II i '■ ,

. • ■
Tetrataxis, and Crenea are spineless.

Leaves in Ginoria and its relatives are decussate.

. ..... ;lij ■,

...;'., '.; '..'"i; li-- |]i;i( III- ■

zone that bears si . of its most basal

...mi i<- i;ii i
:-.'-::i! . :

-■•■,.
(main stem) growth of the new season also begins and

:

: ^ I 1 1

•-/I Ml, :.■, <■;;■.

■■■■:■.>.'.

!•■■ ■ -" ■- -- "=. ■■;

, ' :

to June. Old fruits and pedit

.lull"'. ;irs "

.■.■■'i.l.:- ,.,■■ :!' :

November.

', ; !,.|-In

represents an evolutionary stage leading

■ . '.H : illir; ,

.■■ ■ :•!■■; !■■■;;! i
Exceptions may be G. callosa, G. glabra, G. jimenezii,

■ : >' :n, C

ill

Cienfuegos Botanical Gardi

■■ ' " ■ '. !■:'.'!

h: ,!■■.■■ :■;■■.

Flowers of all perennial genera of the Lythraceae

.. . ,-! Vi.v;

& Johnson, 197')]. ulm-li U inlcrpiclcd as the

at a pair of

flower. In Ginoria, the epipodium varies in shape with

. i- !h l: ..!■<>■ ii

1 mm), and absent in G. callosa. In most s]

' i SIT ■'111,1 ,'

.■:■!, !■::■ t>. II I ;
■ ill i i i I i

G. callosa they are coriaceous and well developed.
Flowers of all the Lythraceae are globose Lo
or obovoid in bud, with four to

■' ■ .r ; .■■inn : I, ■■

F Ginoria (Lythraceae)

. ■ I ■. II I : I •'■'ll'l.' ::

node below I he [lower. —13. Length oi lloral eomj

I ii 1 ill,

epipodium and

i ill ii

II i I i i i I! i i i

>i I. i

I ' ' I I i ' " i i I'

idjacent epicalyx segments (G. glabra.

- ,,. ■;,',•..•;<,,■. v..

The total length of the flower cited in the species

l;ii,.i /l!i ill
e floral cup and is

" ■ , ,,-,,■■:,-■■■•:

ill

(11-18 mm) in /
(20-25 mm).

Species in Ginoria vary considerably in the ratio of

. ii ill |i

■■:i ; ; ; r\ i ■

■ - 1 . : ] i . ■ , ■ , .

: ii.. ■! :n ■■. .'='; rr

up is shorter than
are also among tin i the genus. In G.

!'• ■ >''r

I

are the largest flowers. In the

I i i I ill
lengths of the cup and sepals overlap. I

I | i

than the lobes. The evolutionan course of this
character is addresse
(see Character Evolution).

The color of the mature floral cup, sepals, and/or

irious degrees fron

, ■■■■ i:: ; I.''!;'. ■■ ! J
' I , I Mi ill

Lythraceae (DahJy

and petals prevalent in the species, w
Occasional 5-merous flowers «

:

hrii. Flowers are typically 6-mei

,-,■;,'(■■•),■.■'»■■,■;(,.■. :.

: .ii'M.-i '■ <t *,..
:

1 ' '

■■. i 1 <l", '-I:

of Tetrataxis and Crenea are consisi

Petals in the majority of Ginoria are large (to 20 X

. Ill in, I II

genus (2-1 X 0.5-2 mm), searceb exceeding the
sepals. Clawed pe 2 mm long occur

.://f,M/7... l, ;. ; ::
. " .■■■;;:/■■■;!:!, i.. •',',

■■■ (■■■■,:! :

x - 1 1 i II II ,1

the larger-petaled species of Ginoria.

■: i. .Mi. ■ •■

lanceolata to 30 (Fig. 5). Stamen

■ ■ i i ■ ■ i . i ■ . ■

as a result of chorisis appear in
f sepals (— 10 X in

M.r ,:' , •■■■'
II ' I I ' . ' | i i i I

iv basal, surrounding the ovary,

further from the I the level of stamen

Flowers emergence

stamens emerge along the f:u

the bud, and long-exserted •
scarcely surpass the sepals, suggesting

■.:■■ •■;.. ; (I ;;

ill ' " I Mi

1978). Flowers of Ginoria attract great qi

;

■ ' Mi .Hi ; .III

Seeds of Ginoria are inimite. averaging 1.2 X

:

described as com, ra and G. rohrii).

.. . ■ :

(Fig. 7D). The whitish seed color m G.

: : i -: I ■■ '

' ,■■];■; .»,
:■! ■■ -;:ii ■.■■:■■■

slightly undulating walls.

(Fig. 8) and Tetrataxis possess the
da seed (Fig. 7C,

■is are ca. 1 X 0.3 mm and

! II i i i I 1

ii;.|.;': ir ii -.li 1

I I" i '

: ■ i 'i !■ ■ : * '■• ; >' i

I II II

en). The innermost testal layer

'.<■ iiinu ; !■::■

(Fig. 8A, B). The anatoim of Ginoria

The seeds of the Lythraceae produce oil in the

'(' i."

;

\ fatty acid and
Jary component

'

:■■.■■ r n: i hi

ihc seed oil is 65% C18:2 and 19%
C16:0. The same pattern occuis in T,

. ' ■ '■

taint functional col .r genera of the

.'i. ;.[ ■,.■■! !,- 1- ; I. ■■ ■. (!.:• i M ;'

■;..v; ; v,< ;im, - )7

; ■-..

F Ginoria (Lythraceae)

i:.'M; • I ,:i

J of the gene'
Fern. & Diniz, Lqfoensia Vand.,

from the other members of If
by its verruca 1 1

(.: <■■: :;,;■■ ■■,»
Til,': f ■, i J. II II ■; ■ li '

■ ■'! ■ HH--ll.il"-

' : ■ -M '

!> i/er !>.■

. vil,, HI,-

this study sugger

I ili.ii

speciation was not accomplish*

I). Speciation in

events. A similar constancy in
the family is seen in the

;■■...■■• •- ■■ irh ■ ■

Ammannia, Cuphea
Rotala, where a will
and polyploid levels c

fluenced by local conditions,

Hied :.-n : ;'(.•; :
l; he :■, ;"in .,■■ .

flowering time.

■„■. m ..:-•■■■■.:; ;

I '

uindanl pollen produced duriii'

bees have been observed on iho flow .- is <.l G.
lowers of Ginoria

'■■:i :'■ :

■■■. ;■'('■.•■. ■■■

. .: i ■■■.: I, '.-,; u-ii

mens of suspecte e been noted in

■•oil i

meter of one another in Villa Clara, and G.

: I,'. 1 ■ /,,,,■■■.',•:

in coastal Las Tunas Province

i i I < I

I n i

; - ; ,-n-:'. a irr

ing in Kebruary or March, but flowering

early as January
depending on loca

Habitat \nd Dtstrtbi tion

June, Greater Ant part of the extensive

ill - u i mi i II I

ests of Puerto Rico eastward to

' ■-.■-ill., f U

<»li !■!■■, ■.l.l!!:

■ i 1 1 ;■'■=■■■; ■:

extensive karst habitats similar to those in
Haiti occupied by these genera.

members of the; g or on limestone.

occurrences in tl also grows along

rivers bill toon

■ ■■:)■«■■;■, II ■:,■.■:■.

area „i SanLa Clara. Villa Clara in the Central

... .

■ ■■:„■■ i -Vi ■; . ■ . .

V;.M'. .11.1111-; ! ■ .

ll i

i alive serpentine

; !:■<■< ■■■-. n ,;
I', :.v:i l.. I ■.■!■. ■

near Puerto Padre

and inland on slopes in dry forest.

i | i |,
north of the Cordillera Central in the Dominican

■:■■;■■ I ■!! Iflllr ir . ■

•eolata.

cliffs and t<

1 I 1 1 -

range of Ginoria id islands to the

:■,■■■!!■: ■: ■■:'! ■

■.:■■■■

southern Mexici i coastal beach

■!.Mv:i.'; .■!:.■■.

I ll 1 1 1 1 ill

a (Fig. 33).

PIIVI.0CI-N1

The phylogenctic position of Ginoria within the
Lythraceae and the phylogeny of the genus

. . . ■ '.. '

. :.n; J ,1 '
" ' I 1

■ ■ . .■ ■..■■,■'!.■■[!;■,:;

i ;■■:■.!!■,! :■<
ill I"i

F Ginoria (Lythraceae)

Graham 1137 (HAC)

FG-1753C (FTG)

AY078420

Gra/iam ii39 (HAC)

Graham 1142 (HAC)

EF407951

Proctor 48846 (MO)

AY078419

rarity and/or unavailability of DNA for fr\

■■:■■! : ! i! ■■■■;- Ml. ^ •

with Sequencher (Gene Codes Corporation, Inc., ,
Arbor, Michigan, U.S.A.), aligned in Clustal X,
manually adjusted in MacClade 4.07 (Maddisoi

ham, 2002).

rRNA, ITS-1, 5.8S gene, ai

^. ' ^ i I , I i
I •■ ■ i I

ion numbers and

' :l I'U ,-- \\ i II
I I II II

■■■■': I

urn in size, shape, and number of vegetative

,ucher~

3 detailed in Graham et al.

Extraction procedures on 1 g of material per sample

" • , ! ,.i u |,|, , II, ,11,

use of 6X CTAB to reduce pr

i.

Model 377 sequencei
exceplions were G. koe
sequences were prodn

separated b\ mime
matrix. The floral cl
previously known

Ml i

discovery of a flo^

rf the rare G. lanceolata,
i sterile material, were
the f t t n tl jj

/ ;

of the ITS and the morphologic

(Swofford, 2002). For ITS analyses
L. in the Combretac

I | 1 1 two families are

phyly of Ginoria in

da, Decodon J. F. Gmel,
"(I and equall)

held at each si

swapping and MULTREES option in effect, and

bootstrap analysis with '.

The family-level ITS parsimony analysis including
index (RI) = 0.6

' :■■' <.:'. :.<■!■<■

ir.i ■.

Nesaea sister to Ginoria. The clade is one o

I i i • II ■!
Duabanga Buch, .. f. (95% BS); in

; of the family phylogeny (Fig. 10). With the

1 l,n ii

I'T I 'I l

■):■■ :•:( i

branches of the

> ii i i. .,;;." .!■ ;

length 33 (CI = 0.67, RI = 0.7<",).

, „ 1 ii

;rc:-; ■::■ I ■■,*■!■

this morphologically I

Ginoria is well supported (96% BS) in the ITS

ally Lawsonia or Ammannia +

i I ■ I I ill'

S similarity of G.

:

and close geograpli

.■ .-'ill II IN

'

supported by shared derived 6-merous I m

Ill i i d in

Character Evolution

iige is limited by the

illlK): ,■;■!( ,'li '..

Mi ill

! 'I . ■ M' 1 :.■•■.■■ '

were spineless shru 12 and 18 and were inserted above the base

.'■.;■(■; ;i:' f ; ■ ■ , ■ <■■■>:. :.!f . >

■

1 1 I

F Ginoria (Lythraceae)

The ITS results now

lineage of the; genus. \t successive guid<

■ ■"■ -■■ ■■ ;■

■ ■'. V=!i <•(">.- II ! ■

fu ' ■

1 I i !i i i in 1 i I i ii

ii i I II ii :'< r vS ■; V.^v/:- : >^i) Ik\

■■■■■::■ ■.';■■■:■.■■

Pi I

In Ginoria, Mexican-Greater

. . ■ ■

-I I.. I iij

co/e astern North

:

Current, both of

r.n: : ■■ :.ni|

Antilles and Jan,

:

: young at ca. 10 million

' ■■ ;■ !>;iri; t>\

i '■ : (!;■. ii ill ■.

II •.'" .'.-,). ii„ '

and these are adventive herbs from South

0: i ) . \ similar

I i ii I - 1 1 1 II i i i i i

i G. nudifloi

t coast of Cuba, and G. rohrii
ands. Judd (2001)

The phylogeny generated from clad

is within the
laitia and Crenea

" :V ::,:;, I II

Previous acceptance of Haitia depended on recogni-
tion of several oh ique to the genus.

r rather than 2- to

■'■.■'

;■■■ :!'■■.; ' >'■: i

:■( !:, ; /^.v;u.. ,!!!

the two genera, and the common occurrence of in G. curvispina in

■:i""". :■■: M ■ '■!.■■('■■ ■■■■■. .■.■■■- ; .■■■'. ■ .■'■'■'ii.-.. ■ ■■

_

' II ll

:

1 g er " Threats to Extinction

■:'.;. ;.; v; mi. . . ■ • : .uK, : ;■..

^. : i ■i.nlir. i li".";

•■;■.: ,•/■>'»;."'.;., !,■.

i I serpentine, and

!i ' I . " I! ' , ili

been unsuccessful. (Borhidi, 1996). On the beautiful northeastern coast at

sively define Haitia and separate il from

Haitia is subsumed within Ginoria and treate na. More extensive development of the Cuban

s likely and threatens these

i if the\ are not

■:.:■■..:::■.■::■■'..:■ ,-i l ■ I!" ),

■
and float tissue .. G. lanceolata.

synonymization of Tetrataxis and Crenea with Ginoria and G. pulchra (Ekman & 0. C. Schmidt) S. A.

in, « e its disemen
i Ginoria.

"• i i i ii I I ' . -
, < I . i ii
' <■ •■ i

distinction between subgenus ( where it is now

times the ancesi
merous form or
in combination wi Imvhii (Urb.) S. A.

I i.' liMI I ' Mi' I "]

subgenus Ginoria I,

additional collections, 1
sterile tree (R. G. Garc

F Ginoria (Lythraceae)

jbach (GOET) for new species collected by

I M i i ii i

rang< an 1 j a ty
Ginoria might be ex

ia (IUCN, 2001).

more fragmented with fewer populations.
as Vulnerable (VU). Endemic

i L 1 1

rborea, G. glabra,

■ ■ hi,""- ■ ,1

i " I ! ' I !

(! for tourism without regai

Ginoria has an unfortunate history regarding the

in* In i

the West Indies have survived
(D'Arcy, 1970; Stafleu, 197

Mi '1 I' ,

..ii. In the first

nalz Urban, 0. C.

i, III i .in

i i II . 1 1! i i i ' ii'

' II:" I II "

' ^' ill: I!

ii ill >v ii

collections were i vard (1988), who

selected lectotyp isebach's species.

rofiche form, they

\

i- !:■ :i n'i

, i i i . . .

' ' -^.

to sending it to Grisebach. I have treated all
isolectotypes, although, strict!

year, or even in the; same place a:
Taxonomic Treatment

Euginoria Koehne [= subg. Ginoria] sect.
1 ■' I

Pflanzenr. (Engler) IV. 216: 248. 1903. TYPE:
Ginoria americana Jacq.

lab. 8. 1792. Ginoria subgen. Antherylium (Rohr)

K.m-Iiii.-. Hot. I.iIhI.. n vM . >,; :m. 1882. \\ PE:

inllh-nlium mhrit \ ahi | Ginoria rohrii (\ahl)
Koehne).

■ ■ ■ . ■ n !■■:.■<-■■ .,■■.■■ I

:■, !■■!■■; 'I'! -:■!■■■

stems terete or 4-winged when young, terete

Leaves subsessile or | I 1 le opposite (rarely 1
thickly membra-

: ■■■■.»■ ■. '.ir./

secondary veins typ:
less so and sparsely

bearing bracteoles at the apes; braeteoll
campanulate to shi

'"■'■ ■ ;:i i ; " •" '

<i"'l': ■■■:'|taiill,ir

Allmeas

e key and species descrip

II .rill

spreading or slighl

> m\ed, spreading or

0-25 X 5-20 mm);
i. . conca\e-eon\e\; '

ale. 10-40 X 3-1C
5(to

<■ ahaxially; floral

fl tt \ II

inserted individually or

I 1 ' | ' ' !

'.' ' I >'■■[■■

.atly depressed and 6-sulcate,

!■.:■> :;■<■; I > " •
:: i I.',—. '"I

11 II. Ii; III ,||
pairs, tertian \ein

rzr™

12-17 mm;

. 8. G. jime
lowers 1 lo

Inflorescences loosely i
20 per axil, 3-8 mm; j

10-25 X 5-20 mm, n
flowers 1 lo 9 per axil;

Plants armed at the nodes by 4 (less ofter

17) mm. aci

culate, rigidly erect ....

Spines 0.5-3 mm, robu

corniform growths at the sinus betwe

sepals; spines strongly recurved, 1-2.,

.Leaf margin membranous; epical

, ,,' „i

-

11a. Epicalyx absent the sinus between .he

slender, 2-7.5 mm

la. G. amen:

lib. Epicalyx a continuous flange encircling ihe exterior nl 1 7.5 mm, 5-15 mm

iptlv contracted to

ie SlrlUS 1 J -J- 0-7C ill oc

present and stout or slender, 1-6 mm 12 g" "'■' >sely red-purple to

of the floral cup at the base of the sepals 13 deltate to n,.

',"' ■ ilihl

n.l.dbya 7-15 X ca. 9 iv,

narrow 1\ winged or thickened rib 15 rose ounding the base

I ! = -! :li .,:. ..I'lf,:- ,.. .

i scarcely developed inner tissue

13b 'S P 2°mm m abS6nt OT St ° Ut t0 2 mm; ' lm i '' ,als OT P artiall y

■tents 4-7.5 mm,

■■■.■■:■■■■■: ■■■.<■.■■ ■>.,[[■ .11,,! :!.; j i.,::,l,:i..;l ; ::

l.i.n 111 .: ii

12 ' ' seeds 0.9-1.2 X 0.4-0.6 mm,

i i i i i i
ii i in ,i I

in-., „ ' I '' " '

(Tube et al., 1986;
sinus between ad jac s:4ly 5 lo reported as Ginu

12 per axil, loosely umbelliform; leaf margin often

undulate; Cuba 6. G. gino is the only 6-

mls) that has no
" ' '" ' " " ;

l.i

Plan! and shape and

!iL 6 r!m T r7e E stre C s U &' kfeoslt m'cuba" ueo" ^^ ^ ^ """ ^^ ° f ^ ^

■nated [as lectotype] by Graham, ^

2005: 301, plate 91 of the prorogue). along rocky or sandy nverbanks . plants in these
Figures 1, 12.

1 1 venation. Young
wine-red when v<;

• . - , '

■ I ' i ■ ,' i i

If . " n;'i ■. ..■.;■:■-■ '•■ . , !<■ 'i i.„ ; ■■.l.l'il.',,:-,. .

5-9(-17) mm. Lean ' m. Variety amer-

oblong, 10-70 X ■ develop unequally

Vi : r ",',■'■:■■! ..

■ '■ • ■'■•. vi'.;'). :

I. in the generic key.

Matanzas, Camagiu

l •: ; i." ,:,.: ,;;

bearing four notakh

.!!.:! .■:■:<;■;■ i i ■: r .

'•''.■■■ '' liiuh : , '' : ' , ' ".. ■ ' ^ ' . ,,'

; if:- K'; i Hi II ;

forms the thickened margin of tli

.

\. !-:■<■ ..::.

i alab, W

1909, Ponce 229 ['> )0\. , an Henna nn

V)5. van Hermann

. . . r.r !. vi :.i

?I2 (GH, NY, US); Rio Buey, Mar. II

..
I . ,

ie 1997, Axelrod 10318A (US); Vega i

,,.!:■•:.- ..

■'■. ,:,„:,. ■!.'::■
■'■!■; :.■..;■.-.■■■

:

(HAJB); margenes del Rio Piloto arriba, Finca

:
1979, Berazain 23150 (HAJB); Madruga, Apr. 1903, Shafer

shady brook near asphalt mines, Sep. 1904, van Hermann 44

Hermann 1839 (HAC). Las Tunas: Guayabal, A. Rodriguez

Brull 4030 (IPTH). Matanzas:

: -v.,;: . .'

■ : ■

: .iin

S, US); Cienega de

! I! ,!

: .
24167 (HAC); Rio Taco-Taco, Rangel, Acuna 24168 (HAC);
Rio de los Puercos, W de la Cajalbana, La Pal ma

barranco del Rio San Diego, Apr. 1976, Alvarez

■II ,1, I < I , I ,

'.... V ..';.:■■•.■:

i ->>■. -■;,..

lies de los rocas del

:■>■:,. !■' ! ! : !■> . ' '

al. 9766 (NY); Rio

:.. ' . ' ' •

al. 3804 (HIPPO: " "'illas del rio sobre

carso. Mar. M>:;'

Portal,^ Lm- ■

■■:

I- i I

.-A-..- -.'. - . .

Acevedo-Rodnguez el al. 7-V

II! mi ! I. II ,i( IK (]|l( Id

.

■ ■ .

al en la carretera de

1 ■„ II ■ II .„ I

[';■ • .I'll ■.■!..,■

I.. ■,..!'. ':■ ; '

VI V v., I.

Britton et al. 4809 ( de Zayas, detras del

Campismo Manacal, Dec. 1996, Calzada el al. 61

:<:*:<. .■'■'::■

::■...

I. ,1. II.

' 1 M I ' '

. ' . . . ". ' . ' '

:

! 'It II , .,!:■

iep. 1914, Ekman 2790 (S); Bayate
ad marginem fluminis Jagua, Mar. 1917, Ekman 8579 (S);
cercanias de la represa La Firmesa, May 1952, Figueiras 521

i);Sevilla Estate, near

. 1 ■'■..': //.■.■;...■

. .1 '

'Ilil'll

lC); Placetas, Cerro

F Ginoria (Lythraceae)

spinosa Griseb., Cat. PL Cub. 106. 1866. TYPE:
Cuba. "Cuba or.," C. Wright 2545 p.p. (=1200)
(holotype, GOET!; isotypes [restricted Lo the
branches so annotated in this mixed collection],
GH!, HAC!, MO!, NY!, S [2]!). Figure 14.
J n / t n reddish brown, glabrous or sparsely
'' ^ . ' • ■' ■■'( ■,; h- ,.

Ill il I ill J I, i O I !'I'Y,, I | |

sites from 50-500 m (Fig. 15).

Phenology. Plants have been collected in flower
and fruit from March through June.

Common name. Clavellina espinosa (Leon &
3; Roigy Mesa, 1963).

; i Hi ni

I ! . I | i i ii I i ■ . I

Hi; :;t ,.-'■(; '. i

number include I

(GH, HAC, MO, S [2]), only G

.

ied in: Villa Clara: Sancti Spiritus/Villa
Clara at Rio Agabama on 18 January: along rivulets

.i 7 and 17 April; and in sa

■:■;■' :■ ■: ; i ; i i
\v in Pinar del Rio are G.

'|l

. i,i ,11 :: I

entrada oeste de Sa Bisse 5006 (HAJB,

'•|,;i I! hi I I

2003, Graham V . horn Sanla Clara

(GH, JNY); 6 km

In in
1998, Mendez el al. Clara, alrededores

' l-M i " I . .

■•:;. ". ; ■::,.-,■: i

Smith & Hodgdon 3204 (GH, NY, S, US).

2. Ginoria ai-lx

.-v.*:- r;.

Bay, Cuba, March 1909," N. L. Britton 2217
(lectotype, designated by Graham, 2005: 301, NY
/!, US!). Figure 16.
Tall shrubs or small trees to 8 m, ca. 2.5 dm DBH;

■'■ ■■,.(' i ■ ■

ill

monly ca. 20 X

: ■ •

" ' , I! :\V.i

' . I mi..'! Ik ;

'' . I '1- inn I

obovate-oblong-elliptic .

r.. ■',. '..■.:; id: c,

■' . : ■ If ii ;■ .::.-i II ■■

I li II II I! ' II l I ■ I

rescences 1- to 3(to 6)-flowered highly

; ■■:,! !.■■>:: ,!

... coriaceous, 14-18 mm,

:-..■■ i ' i ' I i i <

cup 4.5-6 mm, green, turning

! ■ (i: '

0.5 mm between sinuses; petals 6, obovate

:

: ,- '. . U :': ,i ,<-,:■

cular, slightly depressed, 6-
ed; style 10-14 mm, exserted.

2.7-4 mm, narrow l\ deltaic scmierect to erect at Dislrihatior.

anthesis, spreading in fruit: cpicalw a thickened is known onl\ i

Phenology. Flowering probabl) begins in June;
flowering spec collected in August,

it in September.

ea. 2 mm below the

e margin of the

ia callosa is a well-defined

iments ca. 7 mm. anthers 1-1.5 mm: >,,«.

6-locuhu. tinning wine-red; style 10- leave at the tips of the sten

srted. Capsule globose, depressed, in- unique epicalyx consisting of a large pocketed

ca. 0.9 X 0.2 mm, compressed, obovate. each s as a thickened rib or

Clara, and Pin;.

-:--l^;.';i:

' : ' Mi ;,

' Hi ll|. .' I i ■ I

times larger than

1 1 ' i ' II

ill

he leaves, the presence of four

. IM : «■'.- ■'

spinosa on the same Wright number, but the

F Ginoria (Lythraceae)

l in having ovate-oblong or ob

1 il i i.i i i i" .

Additional specimens examined. CUBA. s. loc. "Cuba

• ,:■■:,!. .1 <: :.

" . ;!.!!, •■. !:'.|

981, Alvarez de Zayas et al. 43778

. I! I.

1981, Alvarez de Za 1 AJ B); Maniguas al

/ al. 31478 (HAJB);

(S); Santayana in palm

Oct. 1922, Ekman 15524
of Camagiiey c

ill l il <!:■ In "in , I < i ' ii i ' ill i< ill Oi.
[ 1 1 " [

(7-)ll-14(-20) X (4-)8.5-ll mm including a claw 1-

1.5 mm, light rose. 3 to 24 (to ca. 55),

muses along the

hi- ;!;'■( i ■: :

ling the apex of the sepals; seeds ca.

X 0.3 mm, compressed, obovate to oblong-elliptic

II: !. < I (■■/ h.

Habana, Ciudad de la Habana (cultivated), Mat an

■ . ■ . ' ..' ;'i: ■! M

'■ .1

de la Juventud (Fig. 24). Habitats are dry re

F Ginoria (Lythraceae)

M . , ■

(NY, US); Rio San Ji ». Brltton et al. 5858

I II

Hoa el al. ll.Tl
Potrerillo, Max 1990, Voa et a I

• in II

Escambray, May 1986, Martine

la Blanca, Mar. 1931, Bucher 5223
: ■■ . . . ..

< i

VI ■

brook, Apr. 1922. /■

:!

„,

'■HI:,: '..,'-
, I

' I M. |ll I

:
:

..I i, >:,■.!.■-.■■.

July 1990, Noa & Castaiieda 393,

June 1987. t. Perez 1

Ginoria glabra Griseb., Cat. PI. Cub. 106. 1866.
TYPE: Cuba. "Cuba or.," C. Wright 2544 (= 91)
(lectotype, designated by Echevarrfa & Graham,
2008, GOET!; isotypes, A!, GH [2]!, GOET!,
IIAC!, MO!, NY!). Figure 25.

' ■ I'l! Ml

Ihe axils (.1 ll.

-

arrowly deltate, spreading to

In I ■ ill

■ ■'.>■;, 'I;

form a small lobe

11 mm includi

stamens 28, inserted 1-1.5 mm below the

margin of the inner tissue layer, exserted, 11 1

• • ■

obovate to oblonj

/ is endemic to south-

' ■ , a : ■■ i ri - 1 ■ I Ml -M

e Cuba, and Gu

ym\x : ir .»;; n II II e i y "in-::;;v;, >:;irkri; r;\' nihil ci.iM aim.!
rocks slopes in coastal matorrral between 10 ;
1500 m.

n July and August. Flowering

"Sierra Maeslra. Orienle," larall.

;s, petiolate ovate-oblong or

Maeslra. 21 J uU 1022. Lea,, 11009 |eo-e hYele<l with

HAC!).

." 'l'i'"' 1 :

Small shrubs 1-2 in; sLems with ascending

: ' . !!■■;■■ :.■:■

, ■■■ Hi <M: !<■-

Ihe pebblj bed of the [Yateras] River, July 2,"

:

localities ca. 20-30 km north and

ininate-obtuse or

in. According to Howard, who cited

1 'l'i

', 1 1 i ,i

' ■■;■ .. ::ii ■■(■■
nam,) whnv tl.

farallon La Perla, at Monteven
is probably in the

leaves on Seifriz 1046 from the so
Turquino in the g<

■:■-. , ;\<.\>\.u-

'. :'. ' ,.„!■-. h;

1992, Garcia & Jimenez 3614 (JB:

r ., n, „ .•„

ma, m. \ug. fruct.,"
5 Aug. 1915, E. L. Ekman 6356 (lecloUpe,
designated by Graham, 2005: 301, NY!; isotypes,
S!, US!). Figure 28.

>na thomasiana Akin, Revisla Soc. Cub. Bot. 10: 30.

r "" I

spines of 1-2 mm, the i

much reduced 01

I i " II i I
10-25 X 5-20 mm, curia, lasts, loosely

■:■■■.!..:!*,..:;. '

l.uiali, matorral xeromorfo
'5, Verdecia 6938, 7660 (IP'l'H). Pinar del
ui. Dec. 1949, Acufm & Alain 8997 (HAC);

[onda, Mar. 1987,
bscano, Bahia Honda, Aug.

10. Ginoria lanceolata 0. C. Schmidt, Ark. Bot.
21A(5): 16. 1927. TYPE: Haiti. "Peninsula
septenr.-occid. prope Port-de-Paix ad Saline
Michel ad occid. versus, mense Aug. 1925," E.

:i:,".' i- : . ■:-■■■

ham, 2005: 301, NY!; isotypes, EHH not seen,
GH!, S [2]!, US [2]!). Figure 30.
Small trees with deeply furrowed hark, height
>v (2 to)4 spines,

■■■.■',•?.'■■.■■■■■ ,.

lanceolate. 10-25 X 4-10(-15) mm, coriaceous.

" :; la, -.ic

I i

Distribution. A rare endemic of Haiti in Depart-
ment N 10 it (Fig. 31), Ginoria Ian

■ ik;ui n .

i". si III- i
as made in August.
Discussion, The collections made in 1925 and

are described hei from the sparsely

nodal spines, lanceolate leaves 25 mm oi
sharply ascending secondary

ovate-laneeolale es and 12 to 14

'. ;' ■ :'■ ! i<>

.■ ■

Ill' ' '

' i I '

ce Kkman found them in the 1920s.

There is hope that inaccessibility to the steq

1 for G. pulchrc

HAITI. Nord-Ouest:

Syst. 3: 351. 1882. Basionym: Antherylium

,■<(•,. :VI«-w.. I;,

13. 1878. TYPE: Mexico. Oaxaca: "Sierra San
Pedro Nolasco. Talea. eLc," C. Jurgensen 956

'III! I '

()f CIlMrllilhl.W 2') Mnr. IT,.",.

KinmkL Jr. 55-8 (liolohpc. Tl
MEXl !. SMI !).

mcrous. ()l)o\oi(l in liud. -

Hie floral cup margin, green or occasionally wine-red

to spreading at

to 13 pairs, ne;

12 to 16 c

0.5-1 mm below the sinu
collar ca. 0.5 mm wid

e to oblong, exse

Mpio. Soyaltepec, I le la Hidroelectrica

' ' ■.:;,-.■! :

lM I. .

Matias Romero, 7.4 km al de Esmeralda sobre terraceria a
Wendt el al. 3203 (MKXL, MO, NY). Verar

.' - .
I : : );

, ( .:N- ,-..:,!.

Mar. 1956, Miranda 8278 (US); or

3092, 3094 (MO);

„ rl '

a al NW de La Boca,

Additional specimens examine/I. HAITI. Nord-Ouest:

TYPE: Virgin Islands [U.S. Virgin Islands]. St.

v;,-;. : !.

Croix: "HB Vahlii ex Insula St. Crucis, mis. Dr.

:

I , , i , , |

2005: 298, C digital image!; isotype, C digital

33439 (GH, MO, S).

ge!). Fig es 1, 35.

F Ginoria (Lythraceae)

i

"-" ' i , , ili

,>.■■■! 1 '" '

. I- i.'l'll I" i

0.3 mm, narrowly
fusiform, fragile. Chromosome number: 2/i = 56
(Graham & Cavah

....

! "'. ■■:■•>).. Mi

'I 1

. )!: :■■.:: ■::"!

■ ' iiiM,,.: i -:') I.-.

Common names. Rosa do cienega, ucarillo, cer-

I Ml ' ! , I I, i

il, 1974).

, « i ( In I "i

: :•;

,,': >. li'i '. i;

not been able to is. A specimen of

■■■■ ii' i ■»■'■■ .-.<-

I:' I ill! ilil II

similar to Eggers 307 (GOET)

recorded from the Dominica

a I, s.n.. US) of the rare G.

!,iii'i::.|;

I'll {TO RICO. Fa-

, ill ii i

• II I 1

-■ ii,;.-.i-.
near lighthouse, Oct. 1964, Howard & Taylor /

i :ih"..:i .!■■ : i; :

,-■::■/■:■:,: V .;
.

K.-i.--,i<, Ii. . ^ '•

3836 (GH, US); prope Naguah

I 1

'.

. M ■■ViiiMii : :i:

nl !■■■.-■

• i II I.

from Moravian cli

■ ■ . ■: '

:

Kcl., Km 12. al:

.■:■■■' ' : ' '•

1886-87, Eggers 52 (GH); Bolorigo, Eggers 1 70

■: ■ ■ .. ■ .

Soldier Bay strand Iromboy, July 1881,

Northeast Bay, coastal sands. M

:■■

■ ' ,: >'.:■,:■■

s.n. (MO). Exact

W:;ilii v ', ..,;.;.

(B-W digital image Hb. Vahlii] digital

2: 475. 1825. = Adenaria floribunda Kunth.

! , ...

2: 475. 1825. = Adenaria floribunda Kunth.

PL cd. 2. 642. 1762 [and numeious

3ae). Syst. Bot. Monogr. 37: 1-87.

i II |i. <| 1

Liogier, A. H

me. HI. Brittonia 20:

. 196'

3. Flora de Cuba SuplemenLo. Editorial Sucre,

■ Suppl.): 132.
Haitia (Lythraceae). Caribbean J. Sci. 38: 195-204.'

.2005.1A. ■

Bot. 9: 297-304.

■■■ I
in the Lythraceae and a review of chromosome numbers in
Lhe family. Sysl. Bot. 26: 445-458.

, .). Hall. IK

analysis of the Lythraceae based on four gene regions and
.'>: W5-1017.

& B. Klein

Biochem. Sysl. Ecol. 15: 433-439.

& I). II. I ,<<!:.

Little, E. L. Jr., B. 0. Woodbury & F. H. Wadsvvorlh. 1
Lives of Puerto Rico and [lie \ irgin Islands, Vol. 2.

82.

■■■■■.■.

Press, Boca Raton, Florida.

R, N. H. Holmgren & L. C. Bai

ii , -

, I ' I 1 1 > i

1800 in Lhe Lesser Antilles. Ann. Missouri Bot. Card. 62:
368-379.

. 1988. «

Chadwyck-Healey, Arnold Arboretum, Harvard Univer-
sity, Jamaica Plain Massachusetts

:

3.1. Prepared by the IUCN Species Survival Comi
IUCN, Gland, Switzerland, and Cambridge, United Kingdom.

:

E. Sergile (editors), Biogeography of the West Indies, 2nd

■ ■i-l.-i.

•■ : ' ii in

Morphologie de Vegetationsorgane. Botanical Jahrbiicher

ik, Pflanzengeschichle u
phieL Heiblall 2, Hell L 95-132.

MUllhl II

Hawksworth, K. Marhold, 1). H. Nicolson, J. Prado, P. C.
Silva, J. E. Skog, J. H. Wiersema & N. J. Turland (editors).
2006. International Code of Botanical Nomenclature
,-numVeg. 146.

;. Seccion Autografica, Departamen

ie/. Mexico.

410-413.

Cuba.
1990. Santiago-Valei

G. Olmslead. 200

l...||c. ■ I '

Woods & F. E. Sergile (editors), Biogeography of the West

■ ■ ■ ■ ■:..■:

> Kaesimile of lhe 1763

■■■ h-ilr.

lliods). Sinauer Associ-
ates. Sunderland, Massachusetts.

: !:.:: ;•.;:

Pp. 329-311 in S. J. Ouens & P. J. Rudall (editors),
Beproductive Biology. Royal Botanic Gardens. Kew.

F Ginoria (Lythraceae)

■.■<■■■■ ■!■■!

:

783-800.
Weberling, F. 1988. The architect!

• '110..
White-. T. J.. T. Kin >(>. Amplification

phylogenetics. Pp. 315 .'!

Sninsky & T. J. White (editors), PCR Protocols: A Guide to

Subgenus

subgenus Ginoria]: Flowers

Section

Koehne [section Ginoria]:

imens (10)12 to 16; G.

•.mericana var. spinosa]

mens 18

na, G. diplusodon [= G.

lerous; G. nudiflora,

G. rohrii

Numbered collect

ions studied. Numbers in

correspond to the m

slow. Collection numbers in

.eolala 0. (

,isl.) Koehne

13. Ginoria rohrii (Vahl) Koehne

■,, .•■,./,.

17144 (5), 19038 (la), 24165 (la)

/..-'■;■,,■■,■'.■■...■■■.

Safer 2797 (la); Safer & Donovan 4i43 (la); tfarreto, A.

. . . . .

• : :M ,;..■■:■;.■

:

39305 (2), 394 7i (2), 39689 (la), 4ii40 (la), 44904 (la);
Bonet, W. 7454 (la); Borhidi, A. et al. 114/3 (la); Breedlove,

. ... ....

. :. ' . " • " ' . ' '

. .'■ ■'■."' !■■■)
'. ".' ■::,!.

: '

' . .'..■ r"; <■<:■

(9), 24166 (9).

.

8363 (2), 8579 (la), a), 10871 (6), 11549

. ' . ■ ' ■ . ■ • ' ' . ■ " :

; '■). i r.;'.--: ;...

' . ' •■ •' ■■■:!.■:!.

Fernando, Bro. 114 (la), 3^ (i a ) ; Vigueirm. M. L 52]

400(13); ^/s. I. ,/.4367 (la).

-• ; , . ■ .. .■ ■.■,..'..■.■-■

', ii39 (5), i

. • nil! : ■-■•:
(11). 3094 (11). 3/0/ (11). 3/02 (11), 3103 (11).

Hanard Course in Tropical Bolan) 121 (lb), 077 (11)):

■:■ :
./«< A. ./• 0'.
■ "'/■:/ i ;.i. "• ' ; . :

: . .

(11).

:■.. <:-: ,r.-

::■:■■;■. < s .".' • •

(5); Mendez, E. & Elenevsky, A. G. 8036 (lb); Mendez, E. &

I , . , II II

' . .-.■:.

.■ .■ i I ■ ! !

r ,-:■>. : r ' • ; ■ • ' ' '

(6), 6409 (la); Novelo, A. 403 (11), 430 (11).
?9 (9), 42322 (5).

: . ■ '. .

: , :■■■ :' ■;

; //.■-■.■ i

», R. & Mendez, E.

.'.'■■.■,■: ! -). :■■:.., .

727 (la).

" ■ ■ .

W. 1046 (7); 5e«». / ); Singleton, L. J. R.

:- Mi;:, ■:.,,.

■■■>::.-..! (■'. ;■■■■:

00002 aaOOl 3100
00001 00001 1100
00020 11000 bOll
00111 OaOOl aOll
00101 00001 2111
00001 02000 2000

:

.■,■■/; ,■■;■!.■■

. .,i : ' l
(la), 4351 (la).

-/u(13).
Za/io/w, T. el al. 33439 (12).

Appendix 3. Distribution of Ginoria species b\ counlry.

Ginoria amerkana OaOllOlOllOOOO

G.arborea 01000 000110000

G.buchii 00011211210000

G.callosa 10012 11121 0000

G. curvispina 01011 11011 0000

G. ginorioides 00011 11011 0000

G. glabra 10011211210000

Gjimenezii 00001010110000

G koehneana 01000 00011 0000

G. lanceolata 01000 07001 0000

Gnudiflora 00001002110000

Gpulchm 10012 21121 0000

Grohnl 01000 000110000
a = and 1; b = and 2.

CHROMOSOMES OF Michael Kiehn

NEOTROPICAL RUBIACEAE.
I: RUBIOIDEAE 1

studies on Rubiac. -some staining was

data for Neotropii

compiled and numerous new counts were made. Up to carmine- (see Kiehn et al., 1991; Kiehn, 1995, for

< .-a.' ii;ii:: i".; ; i ■ ■ ! i-tr '.■■,..-■

, i I in ' il' I I!' i

il in the personal

:' ■ II r: i:'. hi:":':

i". 'I: i

prep.) will explore tl!

!■■.!■(■ Mi ■:::• I: ( '■ ., II U lilt,

noideae) by Robbrecht and Manen (2006). Results and Discussion

Materials and Methods nnM>me data and.

Il,: (■■ <; >'.<>, r: II

* : ' - ' . ': :. : I They include

|,i!i: i <■•! >■ ,'|, •■;■ ' ' .,; | , h i ;

• ' ' . ' ' .■■'■■■

ii Her reports; five

• I: :T ..Mi i'h

ill, II !i - lull ill il

I I II in II

■.,■!■:;. :tii. .I J

2 University of Vienna, Departing
7/2007115

i rt Bot. Card. 97: 91-105. Published on 31 March 2010.

il

- IN tl

1 || |l

11 1 ^ " - 1 I

1 i 3
5S138I11I I

iliiiiiii 1

=0 S

Ml

i

11! I i! lit fl 1-1 J lllti tj

I 1

I 1 :, :- ~111=1t1;t

I r „ j iiiiiiiiii 2^

II J 1

i H ii Hi *t t t£ 35 2i4S 1

i 1 Ii lljfeltj I i?i Is lUtkh

i I liillliiliii! ttssri jIijSsi

ig« § g g «a S ga! *

I I I I bbb I I I I ^ I 1^1 I 2 k i k i i

-2 12 ^ I ^

3, o ^=* ;

I J Jj ss !J t hiilii f fl 1 ^

I ! |||ii II 1 ill ill* | lij 1!

I I |3|j| 11 1 illJItS Ijipl 13

tjaaSS CS «^

5 eg 3 3 <S <S 3

S 3 +l 3 3 % '! 3 I Si 3 3

| ^S| |p

coll, 5 3 3 J g Hill lit* 2 *||l

, . , . , ; .

iirillll fjfil Mil Ji II I illl

i i i

i

i - Hi lil!

I % a , *■=

1 s > *

llsl 11 1 J

II i !i ll I lalf

111 ^ Is i| i f«„ g

111 j jl ft j! fill

1 1 3 ll -3 |

s I § 1 a

=5 ^ =§££

1 1 i 1

I? 1 s 4 1 I

1 1 1 3 * d J 3 " | s . I

|* i JIJJ I l^fl^ 3

ll iili , 1 j ll J 3 1 |l 12 I

» 15! IlJ i I

^ °-i^r in* irr irr i M

■3^-g* | I

1 f f III il? f|i» i »;I

| " " T 111 2. If g il

!il II ttMll llll !! s|?

11= II "J^::^!! I? 1 1! III!

l! J je II I !, III! .i

ii Haiti j- pn Is

HI i!
IS *

iitni

(Bremekamp, 1952: footnote on pp. 13-14). The :
karyological investigations on members of the ge
Perama Aubl. reveal

the genus. The two counted populations of P. hin
Aubl. show different ploidy Levels (2* and
Because this species comprises several varic

first count for a

I ■ I

■ I

Neotropical member

li ' .-■■-.■;. '■ ni: ■■ .

phylogeny. The

;

- to the lack of

i Vl, ' i

; as one of two
clades in a grade Coussareeae. Do

the cytological

for Ronabea indie
■x = 12 on the tet

Additional da

Old World species (L. acuminatus Wight from India, n

I! i i .li n, i i

■ i , ■ ■ i li ii . I

Sal dinia material from Mad;

lished data) exhibited the same effects

■ . :• >:•', i.:;. '. un-.>

liferent in conden:
Kiehn, 1995: all Sp

^ , . i in mi

' >, u '

Perama in the Rubioideae supertree of Rob

' ~ i:w i«t ■-., Hi I, I, ■; ■.

(Kiehn, 1995). However, the

i
otype (Kiehn, 1985, 1995), a

,< \'nn:hs : i :,■:■. .

seleae. and Cri

and. m the mij i I Manen (2006),

details for the reports of Kiehn (1989) and an
additional count for C. hirsutum Bartl. ex DC. are
included m Tahl

; ..;■■.

■■. ■ nv-::ri ...■■:]

ee species (four

: I Civ.;'. .1 !;■•■,■■ '

■■i' • ! ■;!:■'.■■

F. suerren

i for two accessions

s with n = 10 as well

'i ■ ■ ■ '

ragona Mull. Arg.), the basic number could not be

can be assumed to be the "regular" basic number
Faramea. The only counted Deciles
Ulcosa (Willd. ex Roem. & Schult.) Kuntze, is
raploid on either x = 9 or x = 10 as die basic
mber. This result concurs with die proposed
euxia from the Psychotrieae (Bremer

Manen. 2000), where x = 11 is by far ihe
edominant basic number (Kiehn, 1995; see also
scussion below). Il ah
idings presented by Piesschaert et al. (1999) stating

M| I || I 'I 'Il

■clleuxla, and Hindsia Benth. (the latter not known
tologically yet), and with the molecular data
iclear DNA [nDNA] and chloroplast DNA [cpDNA];
idersson & Rova, 1999: Bremer & Manen, 2000;

■ i.|HV* III ' Vl<!!ill. ]. ■

in ! !', ,i
(1999) are correct. The tribe then has x = 11 as the

' : ,. ' I I. Th-
lil n I

aloid (n = 11: Lewis, 1962; 2n = 22: Fritsch,
'70). For the pantropical M. citrifolia L., all counts

... i ii, ' <>■; li-

' I M , .

subgenus Psychotria.

(Psychotrieae s.
2006, and Palic

lor, 1996). The 1
region are Psychotri

1996).

■ huge number

only eight members of
the tribe from tin txa of Psychotria

I '

" . . : '

/ nil il III In. I II II

Roem. & Schull

/■'■ !■-.:.■:

and l>. nervosa :

iirarll. Pinto

type) chromosomes.

■. !..!■. ir<-.-i IP.
II in i i i

,h- :i-.T
' , . . I ' i I i

& Hook. f. w

i (Benth. & Hook, f.) Bremek.) by Taylor

trla and placed il ;ae of Bremer and

Manen (2000). Andersson (2002) siiImI

!:.■.. i.'U'Im,

Rudgea, and an expanded Palicourea

•:! \1- i

iudy, 10 taxa (12

I I I I! I ' I I J M II | ■ II I I

■■ Hi'. I I tr.V

tria (see Table 2).

Palicoureeae. Counts fc

l| :il '. ill- li: '. ■

I I

.11 -i.. .■ I |: . ■

■-■■■:•.■.■■',:

•■■■•■■■','■■ '■'■■■■■:■
111 iil. V

Pinto-Maglio et al., 1997) could be found.

lie same species.

i . ' ,. I i I ' J ! , I

.;'li..|i| ■ ;il ',!!.. u ■ ■

fferences in ploidy levels also could be the

. i ■ :■; ,■

:..:■..■.■,,'.-. ,■■■■■. rn:^:- Mil

ie geographic region). More

'I II I Hi il -Ill

. '■'■! I.'.'i: "<

. , . ■■■;■ t :■ l : ■ i l ( : ■: ■::■ -'■In

As already assumed for Psychotria subg. Psychotria

1 ■ "i. I

i i ! '. II i i II

. '. :'.;r ; ;i:'ir i:ii;',

: Vl,', > f

."/",: ■■:,:;. ,

i ■Av-a-nn-:. ,■ i ■

I i I

I pi ii I I
than 60% (Kiehn,

Anthospermeae. The only count from this tribe reft
to a member of the genus Nertera Banks & Sol.
Gaertn. The proposed inclusion of this genus ir
Coprosma J. R. Forst. & G. Forst. (Heads, 1996) is i

Kiehn et al., 2005).

"■" mi ■ ! .t
ealed 2n = 22. By far the
ii.i number in this tribe is x = n = 11,
thus the result is ith regard to the

(Natali et al., 1996).

il il

Hook. f. (Dempster, 1990). Three species of this

. ., V::,! -

2005) from soul Loidy (2n = 44)

;omparing the morphology of the investigated

in

Manettieae). In ral papers based

: ■

ii

■'• .VI;, ,, I,'.

tribe is Spermacoceae (Bremer, 1996; Andersson &
Rova, 1999; Bremer & Manen, 2000). This

(Robbrecht & Manen, 2006).

s number reports J
rhiza Pohl ex Endl. and Hemidiodia K.
genus included in Borreria G. Mey.

I- 1 ;. ' i ii

In
the traditional] ^Kotideae, new

<■ ' '

and Manettia Mutis ex L. In Arcytophyllw

both for A. thymifolium (Ruiz & I'm. I

s (1961) reported 2n = ca. 30
(1963: 17) 2n = 36. In Bouv

■ ■■ ;

1,1:. :■:■..!■■ ,;.:■
I 1 I I I 1 I

x = 11 has been

: .:;■-:■ i- '.. '! II ; ■ -. I .

ted now (for M. barbata Oerst.).

Kiehn (1986, 1995) presented and discussed

i - 32 and 2n = 30, see Davifia

ission. They suggest a position

i ill

The reported data clearly show the

; III' ' i.li ill-'

i i. ;

, ■ ' " : .v. hi^-r;! I.

such as Bouvardi ng data indicate

. : nil (\mlii: i i ■: > i ■ .

tions in the Psychotria complex (Rubiaceae, Psychotrieae).

S\sl. &Geogr. PL 72: 167-202.

214: 161-186.

[he basis oJ Wucdn species. Opera Bot. Belg. 7:
297-308.

LOPH chromosome number reports LXXXII. Taxon 33:
128-129.

Mean species of
Oldenlandia L. sensu lliern el K. Schumann. Verb. Kon.

I • II .'

Ill H

Bremer, B. 1996. Phylog

Opera Bot. Belg. 7: 33-50.

& J. F. Manen. 2000. Phj I

the subfamily Rubioideae (Rubiaceae). PL Sysl. Evol. 225:
43-72.

Pflanzen 68: 51-71.

ogames du Perou. Denkschr. Schweiz. Naturf. Ges. 89:
108-110.
anaki- Animal, E. K

he llnlersLichungen ;

und Mauritius. PL Sysl. Evol. 149: 89-118.
. 1986. Karyologische I n

Systematik dieser Familie. Ph.D. Dissertation. University

. 1989. 1- ulersuchungen an

cocypselum. 5. Oslerr. Bol.-Treffen. Kurzf. Referale u.
Poster. Bot. Inst. Univ. Innsbruck.

•■'■■.!.■.

notes on Paederia L. (Rubiaceae-Paederieae). Opera Bot.
Belg. 3: 125-132.

sich. 128: 19-

.:■',' I ■■ V-. . i i-v. ;

Rubiaceae. Bi-illoma
. 1963. In Documented chromosome number

17: 116-117.

53: 100-103.

pdf>. accessed 15J.ni

ubiaceae) based on sequence data of a

Rico. Opera Bot. Belg. 7: 403-412.

& R. J. Hickev, II

(Rubiaceae) in ihe Caribbean Basin. II. Morphological

,,,,

data. Syst. BoL. 24:

systematics of the family. Glimpses PL Res. 8: 177-244.
..S. Iluj sman. E. Liobbreehl & k.

:•' . ,,■! j •.,:;.: i:

147.

I.
Soares-Scott. 1997. IOPB chromosome data. 11. IN*

Poucques. M. L. de. 1949. Becherches caryologiques
Buhiales. Rev. Gen. Bol. 56: 5 -27. 74-13JL 172-

■n.l.i :■.'., -,

Belg. 1: 1-271.

. 1993. Supplem

enl to Ihe 1980

Bot. Belg. 6: 173-196.

& J. F. Maner

cpDNA) to infra

teyermark, J. A. 1972.

Rubiaceae. Pp. 227-832 i

n B.

Maguire et al. (editors). The Bolanv of ihe On;

'art IX. Mer

n. New York Bot. Card. 23.

. 1974. Bubiacea

•a de

: ,

• " . ■-' .■■!■■..■:. !■

biaceae: I > h I e e) ih ll e le pi n f

,I'I>KM)I\ 1. Collection data for ihe investigated plants.

ARGENTINA, s. loc. seeds received from HB Carl
iralio R. Ruiz. Buenos Aires (Kal. 1987-126), cult, in HI

• r i.

alion received from
fegron-Ortiz, Negron-Ortiz s.n. (1) (MU), Negron-Ortiz s.
>) (MU); Great Abaco, South Side Dock trail, Negron-Ortiz

, : i,.-,, :■.,■]■,■.' ii<

'. Negron-Ortiz, Negwn-Orli: s.n. (3) (ML').

HBV sub RR 87-70, Under,

I I i

' • • . ■ • . : '. ■ .

Gottsberger 16-2267 (WU). Guan

andeira, Ehrendorfer 7300-4003
a: Campinarafia do

Ehrendorfer & Gottsberger 73821

6 (WU), Gottsberger

& Gottsberger 73822-602 (WU),
Ehrt d Je 6c G tlsberger 73825-1312 (WU), Eh,
Gottsberger 73825-1319 (WU),
73825-1324 (WU).

CARIBBEAN REGION, s. loc.. seeds from HB Bonn

;. .: :

IK: .I.-,;':,- : I; ■

WU).

:

& Kiehn MK 270,. elande des CATIE,

ii i i I i<

300786-1/3 (WU), 300786-1/5 (WU);

"Interamericana"), near Cerro Zacarales, Kiehn & Kiehn MK
(SJ, WU); StraBe Turrialba-La Suiza

i ucias \gricolas)

ili ,. i.l i

:

!■

■.'■..■

1 ' I l! I ',' . nil I 'I

:■■::,, ■.;..:<■ ; | '

,:,,..:,,, ,-, ,
.'■•<.'.■.■■■■■•■':

880316-1/4 (MO,
>( Jamba (Esquinas),

■ ' .,■■■.■/;.- ■■•■■>.■ /

■ ■ ! :, ".::■::'

& Greger HG2607086 (WU), fiek MK 961 1 1

-II . ' I
.

:n, Crex 99i5-2 (MO);

(SJ, WU), ffiefcn & Kiehn MK 880331-1/1 (SJ).

". . . . : . :■■:! -■:!■

•:

87-21 (W U).
DOMINICAN RE novo Las Cabirmas,

FRENCH GUIANA. Rte. N2, Km 50, cull, in HB Meise
Billiet 1860 (BR).

Cilx. cull, in mi

"Pedregal" close to the University Campus,

1984-2-12/2 (DUKE, WU); Tuxtepec, seeds from
Kiehn 1986-1602

■ i ■.■!,! ,,;'■■.

; l • v, I )..

•km ! oJ

Nacional, Ehrendorfer 7900-46-1 (WU).

PANAMA. Cana do Island: Barbour-

■onian Laboratory.
Ehrendorfer 6400-2502 (DUKE.

j So Hi- Trees.
Ehrendorfer 6400-290

PUERTO RICO. Ponce: NE of Ponce on rte. 139 at Km
:

Taylor 6938 (DUKE).

RR 87-74, Eckhardt s.n. (WU).

' I''" I ' I Ml .',

Portachuelo Pass, Ehrendorfer <

I Ml ' , i ' '

(WU), Till 16059 (\ hrendorfer 74104-1-

■<■■■, ! )■ <-,ih

■■' i ' I ! ■■■:;..■

Elena de Uairen to 1 ( \\ U); Santa Elena

." .■/;.■ . /■■.'■■'.
i

5005 (DUKE. WU), Ehrendorfer 6400-5009 (WU).

■ Ml I

'.' 95-04 (WU).

RECONCILING TAXONOMY AND Michael S. Mayer 2 and Lindsay Beseda 2

PHYLOGENY IN THE
STREPTANTHUS GLANDULOSUS
COMPLEX (BRASSICACEAE) 1

-...:,:..:■..::

■ '■■. : - ■ ■ ; .:.->■■ mi:,, ; , ■ . i .■ < ; . i ■ i

Mill

(Greene, 1904).
serpentine substrati

' ' ' : . ' '

'•■- I <-r M. ;■ ., MUM Mi •

MM';. Ml!', m ; , M"

i - -I! Ill

.: ■ i ■, .: I !i V II I'M ' " . .

M'M 1MIN MIUMillM':

tid ITS of 18S-26S
and crisped, wli

it taxonomic system

■ .

Jmmm I.. !' m Mi : " ■

;■ ■ . i ii>

■ ' MM, ..;,.... . ■ |.;,i ■ I,'"., -;: Mi,

San Diego.

Volume 97, Number

2010

Table 1. Comparison

of tax

o^c—^.

; om P le:

iduli ,

distributed among three

Figure 1.

Kruckeberg. 1958;

Buck el al.. 1993:

Rollins, 1993

Present cl< f al >n

S. glandulosus

5. glandulosus

Northwestern clade

ill !

subsp. arkii

subsp. pulchellus

Mayer & Beseda

Taxonomy and Phytogeny in Streptanthus

glandulosus

synthesize the available data, report the results of
j sequence and morphological analyses, and make
momic revisions lhaL recognize the dynamic
logy as well as the strong phylogenetic patterns

3 rtility data (Kruckeberg, 1957), cpDNA restric-

ite data (Mayer el al.. 1994), and ITS sequences
r & Soltis, 1999) arc reviewed and. in some

:i .:;- :] : '.in ,-i

l.'il' ! ill

\\ ;■ ,;■, ''I..:. !;■

' I I

\

within even the same
i ibspecies was estimated to be lower than is

genetic drift and local selection

I Iii " I "i

i ..■ :■ '■ !■ ■ .. i.- 1. ji I: ■■ n

I I i

' "■ ■■■ 'Iii':

riM'li.'. ■;. ;

'■' I' ■■■■'!■"/ ''

DNA of three tc population was

pooled for the molecular work (Mayer & Soltis, 1994).

, , . , " ... :.:.■

provide a good

regions in the range ul the complex (Fig. 1). We used

' ' !."/,Mi:> '.'•!'

specimens ot wild and
» look for morphological
molecular phylogcnelic
lecause flower color is not preset

ay. We examined

Mayer & Beseda

Taxonomy and Phylogeny in Streptanthus

glandulosus

:

Sequences were aligned visually and were sub-
model option of MrBayes 3.0 (Huels

.'..■■

■ . :■. f.'S i-;,

Rksui.ts and Discission

Thee

"i ■ i i

ogenetic pattern,

■■■:;■;!.■ ; i

patterns show greater congruen

I

■lysis of Kruckeberg's taxa and
lepicts populations of Strep-

lations of Krucke-
berg's 5. albidus bidus and subsp.

o, i-

%ss\

Vll

3o5oI

phylogeny ol ihe group.

Syntho-,1- of the patterns of topology, geography, and

. ,,, .,..;. . ...

subsp. Mendoci

in I illi |'l! II

albidus and 11 ll | [ 1 I 1 1 [

: (Fig. 1). The molecular

^S and cpDNA data. Examina-
those of the Southern clade (n = 82 and 87,

■.'Mi !■:■■ '

'■

. >, 42: >'NK
2. SD = 11.62, n = 40). Tin

subspecies glandulosus and northern subspecies

i I i. I In i

ill ■ II i II i ''

: . I ' I

The NW and NE clades of Streptanthus glandulosus

congruent cpDNA and ITS

i null) recognized similar geo_
Coast group with rose-colored flowers in S:

: •. '■ i : "■■!:■■!

identified (Fig. 1).

Although the nuances of perianth color can be lost

'

plex. Populations of the NW <

II, I :, i II i:
■.■■■'..; -Nii:

' ,!-■; '■ HK'lr

:' ■!■. !■; !■■! :' . . .

■ ■■■:■■,..; !■'. : l ■■■

Mayer & Beseda

Taxonomy and Phylogeny in Streptanthus

glandulosus

. :.h- im'i: I! '•

basally; the keel and tip of the sepals r<

:'■ M : ■■ I I ? ' f<t

col,,,- differences between the NW and
NK eludes is difficult on dried specimens, which tend

exhibit just sh; i

Finalb tli( leaves of the NW cladc tend to be
erage than those
of the NE cladc: means of midci i
length:width are 4.40 (SD = 2.51, n = 42) and 8.32
(SD - 11.62, n - 40), respectively.

'I',, vn
(1958) recognized as two varieties of .

■ ■■ ,■ '

i; II .i i in
solation on genetic

■':'M, I fll/' '

ithus glandulosus

ii l)ii Lion of variety

■ . .

;■ ii' ii. i <i i' ' .

The Bay Area cladc

■
. II ii II I

'. I , i- llni

PC, :.!■:■.■: !'..':;' " ■

II

glabrous surface

[he complex. Tin

this taxon in Kruckeberg's revision (1958).

and genetic divergence greate

■•■f II • .'VI ■ :,r ,.-'.;■. |lii;ll I

:. • ' -'II ■.(.: ■!.:■:

Of the current sul)S|>

: ' . .'•''.' '

-iorji:|l'ipli(»;'i'alllv m h\ ;>:<-o»t;)|>I 'ic-iill II , ■. -
:

i ' !

tehbaz & Mayer,

M , , , , | I

■

.■,. ■.!!■■■, !■:■■

(Table 1).

■ ■.:'.■■ . i ,:</v,.,<<
■ ■ ■

.1

' I I ' ' - In

IC'H! I ■:».<' '■■')

I I ,1

....... ,.,..,,,.. :

. > : i''<il.' or

n | II I

82. 1904, a

ia." TYPE: U.S.A.

Co., IV

lonterey, 1833, D.

Dougla

seen; isotypes, GH

Annual; s

ems erect, 1

-12 dm

, simple or divari-

led just abov

? the ba

al rosette, glabrous

;

s m some) t

•1 in 1 i

inflorescence, plants

densely rosulate at

I to a short,.

nnatifid, the teeth

essile, auriculate,

nght £p id & to the

late, lanceolate-acuminate to linear and conduplk

."."■(' ■': Mill ;

' ./ . • :.

i, I i I I i | . <

several open erect racemes, some rachises flexuose
anthesis flowers on pedicels 1-2 cm, spaced

5 or sparing!

i !,■■;.■: ,■;[■■.■■.■
;ii i..- II; ■ ■■:( .

i--,,! ;: : til'.

. ' .'.I ; II <»li I • i, '■

eflexed; seeds oblong-oval,

) TIIK SUSSPKCIKS OF STRKPT.W

i ,i mi i, i i i > .

Marin Co

■■' ::■ ■.,.■■■ ' < ::■.■,■:■ .': ! \\ . '!'.

Mayer & Beseda

Taxonomy and Phylogeny in Streptanthus

glandulosus

■f glabrous; perianth crea with purple tinge at base

1c. S. glandulosus Hook, subsp. glandulosus

/ ' -■' '■■. / III I,' ,!,:,,!,,,

-

,.':, I '•;■«,'! , : ' :■■;'

. II. ; ::lil ■: '■'.

1925. TYPE: U.S.A. California: Santa Clara Co.,

lull I l! in

s.n. (holotype, NDG not seen).

Discussion. Plants of Streptanthus glandulosus

(5-12 dm) and are glaucous and nearly glal

i 1 1
tinge at the sepal base.

Mayer, subsp. nov. TYPE: U.S
Napa Co., SE slope of Mt. St. Helena, 1946, L.
Constance, J. F. Davidson, H. W. Wagner & R. H.
Shan 3049 (holotype, UC!).

■•■■■■, ■'■,■■..-■■,; ■':•'

I ■ )'■ II I I I II II III II *
serpentine substrate (Appendix 1).

IUCN Red List criteria (IUCN, 2001). In our
dosus subsp. arkii

mall to large lobelike teeth

ark maroon to blackish (rarely dork \

;ill1l.: C I l;i (

ubspecies raichei are i

;ubspeci

Etymology. The subspecific epithet honors Arthur

generous benefactor of the present project.

Paralypes. Us \ California Colusa Co., ridge belw.

., II ,!.. II ■,;,.•'
I / I,

, t ,-, t t , T n . j Po ! i.R. F.Hoover 4912

(UC); Solano Co., Vaca Mtns., Walker Cyri., 1\

aid & L. Ahart 4498 (UC).

Streptanthus glandulosus Hook, subsp. glan-
dulosus, Icon. PL 1, pi. 40. 1836. Streptanthus
peramoenus Given.*. Bull. Torrey Bot. Club 13:
142. 1886, as "peramaenus" syn. nov. Strep-

(Greene) Kruckeb., Madrono 14: 225. 1958.
TYPE: U.S.A. California: Contra Costa Co.,
Oakland Hills, 25 Ma> 1886. E. L. Greene s.n.

M i ml '...■-• i
duplicates, CAS not seen, GH not seen).

Hstribution and habitat. Streptanthus glandulo-

», GH not seen,

MO!).

on and habitat

. Plants of Streptanthi

subsp. hqffinan

ii are rare, known from

itine and non-serpentin

i the Russian '

i River in Sonoma Counts

California (Appendix

/;]- -.■-.-/ ; -

» failed to locate the spec

If, II. -■, I,:.: :r;

tologue (1886: '.

■

ill ill ai

» as t) pc on NDG 01877.

II! ;■; I ■•:.!■■; ■fi:

the Greene s.n. collection and the NDG sheet to

. I '.■!'■- :-•'

types seen by him at CAS and GH. Here, we

liu* glandulosus su

(Kruckeb.) M. S. Mayer & D. W. Taylor, Novon
18: 280. 2008. Basionym: Streptanthus glandu-

v , . ;.■■...■..:.

1958. TYPE: U.S.A. California: Sonoma Co.,

steep, rocky, nonserpentinized bank. 400 ft., 24

serpentine soil (
line on Happy (

mes on serpentine

County, Oregon.

■ . ;'/ .

ncusis :'Jia;c:- : ,',iiil.i ::l : ;i:.r;!;'ic:;: : .- ;''(!.■■:.,:.,. :;■■■■ ::<:<i;.'s
i i in, II i I,

vers of subspecies josephinensis produce petals 7-

►sus subsp. niger
(Greene) Al-Shehbaz, M. S. Mayer & D. W.
Taylor, Novon 18: 280. 2008. Basionym: Strep-
tanthus niger Greene, Bull. Torrey Bot. Club 13:
141. 1886. Euklisia nigra (Greene) Greene,
Leafl. Bot. Observ. Crit. 1: 83. 1904, as
losus var. nigei
(Greene) Munz, Aliso 4: 91. 1958. TYPE: U.S.A.

E. L. Greene s.n. (lectotype, NDG not seen).

Distribution and habitat. A rare taxon, Strep-

'■ . 'i I ii I Ii

Tiburon Peninsula, in Marin County,
(Appendix 1).

Mayer & Beseda

Taxonomy and Phylogeny in Streptanthus

glandulosus

Vulnerable (VU C2a[i]) by IUCN Red

lg. Streptanlliii

(Greene) Kruckeb., Madrono 14: 222. 1958.
Basionym: Streptanthus pulchellus Greene, Pitto-
nia 2: 225. 1892. Euklisia fmlrliella (Greene)
Greene, Lean. Bot. Observ. Crit. 1: 83. 1904,

pulchellus (Greene) Jeps., Man. Fl. PI. Calif.
420. 1925. TYPE: I S\ Ccl.lo.ma Marin

7 May 1892, M. A. Howe s.n. (holotype, NDG not

: " : :..:■;■■.■;;•■.. ,■;: ,■■".■..

Marin County,
California (Appendix 1).

Discussion. Planls

:

1 County, but has
;reenish yellow flowers.

Mayer, subsp. nov. TYPE: U.S.A. California:
Mendocino Co., Ukiah, 27 May 1905, W. L.
Jepson 2508A (holotype, JEPS!).

... . . ' .. . : .

Plants 2-10 dm, sparsely hairy Lo hispid. Length of
: leaves less than 5X the width. Inflores-

,n the flowers. Perianth color ranges from

I i.il Iii

II ' l . II II I'M

are recurved to reflexed.

:. : . ■. in I .:!! • :"..

' <■■■ '•■ III

California on outcrops of broken and decomposed

■'.'■...' ■ ...

>;-.i ,!!■-. -.T<-,ll

Discuss ion, Streptanthus glandulosus subsp. rai-

' t r|;i i ii, i: i

■ ■■ ■ ■:

I. nn i I I i

Sonoma County. The fruits ar<

1'aralYpes. U.S.A. California: Lake Co.

Ukiah, head of S Mi Jepson 9223 (JEPS);

>
128, 1991, M. Mayer 57

keb., Madrono 14: 223. 1958.

Fran. 261. 1891. Euklisia secunda (Greene)
Greene, Leafl. Bot. Observ. Crit. 1: 83. 1904,
as "Euclisia" TYPE: U.S.A. California: Marin
Co., N base, Mt. Tamalpais, 18 May 1886, E. L.

Greene s.n. (holotype, XDG not seen).

:

. '. - ■■..;■: ,.r- ; id i i

Discussion. Inflorescences of Streptanthus glan-

"II

'I !i i i, i | ii i in I in ii __h Si nil ii i Ii 1 1 i ii luti in ii

(Kruckeb.) M. S. Mayer & D. W. Tayl

'■ i
;■■:■:■■■ ..'.;.

223. 1958. TYPE: U.S.A. California: Sonoma
Co., near Guerneville, Great Easte
Mine, serpentine, 8 June 1948, F. W. Hoffman
2323 (holotype, UC!; isotypes, GH not seen,
MO!).

■■■■■•■■,■;. ■■.7;;\...

:

itine soils in Sonoma County,
California (Appendix 1).

Discussion. Inflorescences of Strep
losus subsp. sonomensis are typ]

Brassioaoeae. Pp. 139-448 in J. C. Hickman (editor), The

i' i I 1 !

California Press, Berkeley.
Greene. E. L. I

\' ■■.<,:>
754-755.
IUCN, Gland, Switzerland, and Cambridge, United King-

. 1958. T

Streptanthus glandulosus Hook. Madrono 14: 217-227.

endemics: A cpDNA phylogem oi the Streptanlhus
nhmduiosus complex (( iuc ilc lac ) S\st. Bot. 19: 557-574.
& . 1999. Inlras

• ■ : .

.,,' . ' s ,.:,.■■. 1

Rollins. R. C. 199.

': <ll!

i Soltis, 1999).

DQ829790J.

Raiche 105 [105.4. ... Pope Valley Rd.,

M. Mayer 563 [563.4, DQ829799]; Lake Henries
roadside SE of dam, M. Mayer 573

J
2.4, DQ829800].

.I:,,:,".- I:! >■ >. ,

' ' • ". ' . • '. '

: . : ' : ■:■ • .

\\ of Lick Observatory, M. Mayer

.,':v |:;: : .::..l. :■

,.. ,.

Mayer 548 [548.4, DQ829802J.

r. !■'.:,.■. .''■•'

AE1 1 1393*. 1TS-2: API 11394* |.

Mtn. Trail, M. Mayer 539 [539.4, DQ829788].

,1 Hw>. 101. I/.

I! , i I i, I >L I , | M,)&9 ', ,

"•.! .■.'■•/:. .I'll' ■:

, i II I . , ,!o : vr..y?9\r< i >)A, ■{/..: : .

M. Mayer 542 1 5 ' , I . -2: A Fll ] 382* |:

Jnlosus subsp. sonomensis. U.S.A. Cali-

k. M. Mayer 545 [545 .4, DQ829803
Cedars, 1 km K of cms
546 [546, EF208036]; Guerneville,

Slreplanlhns pohgaioules. outgroup. [AF111419,
AF1 11420] (Mayer & Soltis, 1999).

EPIPHYTIC GROWTH HABITS OF M. Fernanda Salinas, 2 ' 3 Mary T. K. Arroyo,' and

CHILEAN GESNERIACEAE AND J uan J- Armest0% *
THE EVOLUTION OF EPIPHYTES
WITHIN THE TRIBE
CORONANTHEREAE 1

:.■!,. :!■.[,■.■: i: ■ ' ; ' ...

: ' . '

Gesneriaceae.

I . !: .■ II .- S ;'

their life cycle
■ • ,.
'^' ■ ' . ■

oots down to the
represented in 83 Knnili— ) (Holbrook & Putz,

(Gentry & Dodson, 1987). \ a-

.'!!■;! " 'ill. ;'■
■: ' ■ ■ I ■ ■ . ; > ' :. i ■ I

' • , ,.■•■.;..:,.. :l|.,|.!

. . i , , , ■ i . r,

f.-llousriip support. A

: ■ ■ ' . " ■

. : .. ■■..,;. •., ,:.!„,!>.■:. -v. : ■ ■ ■

■ ii.l mi I ...i '.

.' .' I > .1 1 1

1 ■ I

memory of our frieiu

Ciencias, Universidad de Chile in 2008.

1

doi: 10.3417/2006210

ouri Bot. Gard. 97: 117-12 31 March 2010.

y

SH V ^^

1 Ss=»

F

^ ftr- -•if

1%^

(Moffett, 2000).

It is widely accepted ihat the epipln lie habit
evolved independently in different vascular plant

. :•'.:■.■:<!■. i ,
if nucleotide sequences. The

! labile character (\

habit

proposed to expL is associated with

:' :;:■.:;.: ■:!,■■

are abundant in many
1 in the fossil record.

■ . ■ ■ I ' i i I ■ : I I ■.

elopment of lianas.
Temperate rainforests of southern South America
are characterized

piphytes (Armesto et al., 1996; Arroyo et

of the biogeogr; I I he temperate

1 . ;■■ In in.
:

orests. Among the

genera of Gesneriaceae

in! ,;,■■ '■■

Wang et al.. 2(.

Diphytes in Coronanthereae

Epiphytic shrub

:

Rivero, 1991; (10) Smii

l the STUDY SI'I'KS

century ago by Reiche

comprising about 120
mquist, 1981). Species in

< r 1, Appendix 1).

'

.

■ i ivr .-i id

hi: ■• i- III ■'•'! i-r :

, I I.. I ,,

] Senda Darwin Biological

■ i , ■: I'.' ! ' '■ .

Evergreen broad-leaved trees and a lew narrow-
leaved conifers do est canopy in both

.,.. ,,.; .....

Illli II il

■ ■: :■ ': I":;

-st (Table 2).
Other vascular epiphytes in these rainforests

i'. ■■!: ;■[;,.
I . ■■ . I ' ' : . .:

(Hymenophyllaceae) (Salinas. 2008). 'I'll.

74° W \

73° W

Fundo *

"> c^ ^\ //

Guabun

Cisnes v

^/^ ^s^^ y==^i

3

f^J* ^ * ^<T w

Ahuenco ^

V. Senda Darwin ^^^^rCUJ
^y\ Biological Station ^C]{

^}<*v> <^r

5 ■§^K»\?

\ {

f

a Chiloe ■
\ Island c

^5p-#

K i\

<K

74° W

KC-

Table 2. Parameters of 0.1

Total basal are

Caldcluvia C. paniculata D. winleri

'. ".. ' :

Diphytes in Coronanthereae

ucli as fire or
clearcutting. Tot, ot was calculated

ii i;i

each plot, four equidistant 50-m-long transects were

hi I

Frequency and roo

'M'.li \

each forest plot

<-|;r.l '. ;';■ ■.■;■■■

o, Japan) 12.5 X

..'.« ii ;■'■' . !■■ : :■

the epiphytic stem toward the !r

iot reach the forest floor, the
plant was recorde e. A total of 1071

, II ,i i'

(Table 2).

rley, 1978: Morlev & Toelken, 1983:

(:,■.,:■>■ -ill'..

1 I [ II !

I . 1 * III ■

.. ■.. i ,!■..■ ■:-;-;; l,:; i

as not found on

!" "." '"

rsl. Z = 2.92, P

i nd A. ovata were
more frequent than S. repens c

hi I i I I

ICIVM «!• ■ ' ' ■ : ■ ■

jiii others and were connected

more than 10 cm
ground.

3 ground and on trees

die one-way ANOVAs with 10,000 randomizations of

■ ' ' ' ' !■■■■ m> !•,!.:■! ; ■-«•( is";

trees bearing each Gesneriaceae species

(one-way ANON I ita, P = 0.0829).

.;>..>■ o.x9„r

-B. Mean f

pens was never found n; ! as hole-epiphyte.

ithin Ivvo North PaLagoni

= 139) occurred on a |»ro|

ntlwra (n = 40) had the
jwest proportion of 0.04 on trees sampled (Fig. 3B).
Differences in the rooted substrates of the epiphytes

i I

Ii I. ii, ii!

lassified as holoepiphyte,
ot rooting on the ground.

reae consists of nine genera and 20

! lie ?■>). with a vicariant Ni

origin of the Gesneriaceae (Weber, 2004). 1

i i | i i

'.cntina, mainly in
ord Howe Island,

Caledonia (Table 3). Only <

■ ■■-:■ .. r-M

(Table 3) support the contention that current Cor-
2004).

' ' :■.:■ ii"' II', in: 1 ;

'

ill " ,'',<■

li , I II j i < I II 'I 1

(Table 3).

Mitraria and Asterantherc

tes as they \

ble fossil evidence of Gesneriaceae from south-

Hants as well a

Diphytes in Coronanthereae

Stamen
number Fruit
5 cap*

:

. I ill : III

....... . . .

patchy habit (Wei the Beslerieae and

he sister family
iaceae (Soltis et al., 2005), also presents dehiscent

:

nanthereae (Table 3), there app< ,| the ancestral

amnus A. Cunn.).

ill' , | ; . ' i

' ■■:■■.:::■■<<: >. ■ . '' . ' - 1 I J : - i I . - H III, ill- , ,-lli'l

. ' ' . ' l-.^.i ■■■

than the third (Reiche, 1898), an< character,

stamens (Table 3).

of rudimentary, u

I I i . - > ■ I I i . . '■

of evolutional? cli

. . ■

within the lineag< have been from the

III mil : . I ' ill "

strated. However, considering the relative a
position of Corona i

ieage would have

sera, which occurs in the tropical

■■■■ ^v-i

1), and is described as a tree (Wieh

: • -' .'-;.. ■..■■■.

I 1 , li ••.. ::U\.
| i J II ill

i i I I > '!

1 'i i I 'ii HI '

i ill •

;• shape of the reaction norm in t
. ■

I I

ii 1 1 ill .'I

nearly so. Early i s of an organism

p. I ixi i in ■ II io.

". I:, ii, ■> II II. '■,;•::

tyer et al, 2003),
;lor will be shown

.-.. ' V|: ,.,.

gn in early stages o

in the Coronanthei
developed from the c

Gesneriaceae

habit in search of more
into hi | | 1 I

Within the Gesneriaceae there are 598 epiphytic
Dodson, 1987).

(V. i; il<-,. Ii' ■ ' '

habit in different phylogeni

iid Perret et e

;

"ii, .

Whenever holoepiph

'I 1 " II" in

al., 2005). The derived form would be a climbing he

Diphytes in Coronanthereae

steps leading to

' ' , >. ■■: ' '■

ences in vertical

. :,

. A. Penaloza, M. Riveras & \.

M. Faggi. 1996. Relaciones fitogeograficas v patrones
regi ale le jueza de especies en la flora del bosque
lluvioso lemplado de Sudameriea. Pp. 71-92 in J. J.
\rmeslo. C. \ illagran & M. Arroyo (editors), Ecologia de

lands.

i .

participation and adaptive diversih. Ann. Missouri Bol.
Card. 74: 183-204.

. I-'K. .

Press, San Diego.

Lol. 26: 65-84.

Rica. Biotropica 27: 13-19.

World, XXIV: Tentative keys to the tribes and genera.
Notes Roy. Bot. Card. Edinburgh 24: 20-220.

). 1-27 in P.

Flowering Plants. Columbia University Press, New York.

continents? Annual Rex. Karlh Planet. Sei. 20: 501-526.

■■..ide 1 Id

i evolution. Bot. Rev. 43: 3-104.

Sysl. 9: 365-392.

The evolution of plant development. Amer. J. Bot. 91:
1726-1741.

Gentry, A. H. & C. H. Dodson. 1987. Diversity and

Missouri Bot. Gard. 74: 205-233.

. 2002. Th

Gravendeel, B., A. S

| I ' II M

Guillaumin. A. 194;

:

III I, i„

vascular epiphytes: Efficient barriers for water loss after
stomatal closure? Ann. Bol. 86: 765-769.

"vuiliago.

',-■ ! " ,

I.' ■:,:■: -,'.!■ I

I , i i ' In

Lopez-Portillo, J., F. W. Ewers, G. Angeles & J

.•■■■;>■:; n,

form. New Phytol. 145: 289-299.

Pp. 1-14 in U. Luttge (editor). Vascular Plants as

Studies: Analysis and Synthesis, Vol. 76. Springer- Verlag,

(erred from plastic! DNA

the basic terms ol cam
596.

II: 187-192.

" II

■..■...

Munoz, M. 1980. F
Editorial University

i :' '■>*>

I Mil

2001. Epiphytes and their role in

the Lropical foresL canopy. Pp. 23-86 in J. Nieder & W.

t (editc
, funded by the Volkswas

>el, P. S. & T. L. Hartsock. 1990. Dial patterns of C

; ' ' ■,■■:!

/er, W. R. 13. 1930. New Zealand epiphytes. J. Ecol.
on, M. E. & J. Rosell. 2006. l.sing heterochrony to in
734.

Pp. 73-106

analyses of six plastid DNA regions and nuclear ncpGS.
. 90: 445-460.

solandri, A. Cunn. Trans. & Proc. New Zealand Inst. 35:
321-323.

: n & C. D. Schichting. 2006.

■;,■:,:> :■ ;: . nii^. .

58-89.

. :■.;.,, ..:„:
■ , , In !

flora de Chile, Vol. 5. Imprenta Cervantes, Santiago.

sobre la Biologia Reproductiva en

turn en el Fundo Sa
Venez. 29: 163-169.

Gilbert, G. Zotz & M. T. Twee. 19
ival of aerial roots o!

fcF sequences. Syst. Bot.
2000b. Phylogenetic resolution within the tribe

DNA restriction site variation. Syst. Bot. 19: 317-336.

.-' C.

713-725.

.! <: ," • i:-..-,, i . .

Denton. 1997. Tribal relationships in the Gesneriaceae
Evidence from DNA sequences of the chloroplast gen
ndhY Ann. Missoun Hot (.aid 81: 50-66

!, C. 1993. Los picaflores y su recurso floral e

isla de Chiloc

Stebbins, G. L. 1974. Flower

Nadkarni Takhtajan,

Oliver & Boyd, Edinburgh.
. 1976. Neoto

Evolution of Angiosperms. Col
New York.

I ' ■ ■ Il in hi

. : i . ,!■.

An-iospermae. Kvol. Biol. 9: 35-106.

Villalba. 1995. The ecology of the conifers of southern
South America. Pp. 120-155 in N. J. Enright & R. S. Hill

. Melbourne.

Nac. Hist. Nat.
& L. Hin,

70: 241-267.

m,;. '

ferred from four different gene regions. S\sl. Bot. 29:
407-418.
Wang, Y. Z., Z. Y. Li, K. Y. Pan & X. H.

44: 903-907.

Diphytes in Coronanthereae

. Wallace, G. C. Stocker & Z. Roksandic.
lytes and some related s

■■;■!■:■■ ,ii i "... ;.>■.■!!,■■; p n,.;

/ • 1,1 lull hi L ■.. .

lv coaslal lemperale

head of Bunyip \ all. n ilia: and Lwo tropical

. . r., , ,

! !■: ;!■!;■, .: ■., I:.:,:, ....

C. clarkeana Schltr.

nas 814 (CONC)

Sal

nas 776 (AK, CONC, NOU)

Sal

nas 759 (AK, CONC)

CHROMOSOME STUDIES IN
AMERICAN PANICEAE
(POACEAE, PANICOIDEAE) 1

). Of Ihe remaining

Chromosome numbers have proved Lo be of great

. ' i ill

polyploid taxa (Davidse et al, 1986)

in many tropical

-II-'! : 'irvri ' • '

a series focusing on chromosome numbers
e et al., 1995a, 2006; Hunziker

following indexes: Ornduff (1967, 1968, 1969),
Bolkhovskikh et al. (1969), Moore (1970, 1971,

1985, 1988), and son (1990, 1991,

1994, 1996, 1998, 2000, 2006).

population) was analyzed for each species studie
except in Eriochloa punctata (L.) Desv. ex Hai
Paspalum denticulatum Tiiu., P. pilosum Lam.,
plicatulum Michx., and P. robustum (Hitchc. & Chai
S. Denham, for wr h f f two, t\ I t

i I

II! 'I ii

. ;

ris ethanol:;

Ii : fv.i| !|: , ...

microscope (Zeis equipped with a

A complete list of the species studied including

i I I .. i ii I i i ! 1 1 i
tuto de Botanica
plicates at CTES, LPB, MO,

and VEN).

Rim lis \\n Discussior

.pus P. Beauv.,

I ' . . i, I -

\gencia Nacional ,1< 661. and 1286; and tfc
Geographic Society for research grant 7792-05.

'ii-.-. ' -i- ! '■ ■ • • '■ • • I'M:' \ll":..

doi: 10.3417/2007118

\nn. Missouri Bot. Card. 97: 128-138. Pub

31 March 2010.

i American Paniceae

. iridifolius (Poepp.)

BOLIVIA. La Paz: Nor Yu

via can. antigua Los Yu
Belgrano 4904 (CTES, I

■■■, ■■■:■,■!,.. - , .:,|. . :;..r- ■:■,:■■

i;
BOLIVIA. La Paz: Nor Yungas, camino de Unduavi a Co

;. MO, Si)
BOLIVIA. La Paz: Nor

por la carr. nueva Los Yungas, Morrone & Belgrano 4
(CTES, LPB, MO, SI)
BOLIVIA. La Paz: Nor Yungas, camino de Unduavi a Co

VIO. SI)

.

VENEZUELA

Aragua:ColoniaTovar,cerc

i del Monum. Nat.

Pico Codaz

(MO, SI, VEN)

BOLIVIA. San

79 (CTES, LPB, MO, SI)

Aragua: Placibel, via Colon

Victoria, sector Loma Briza, Morrone et

1. 4666 (MO, SI,

VEN)

Entre Rios: Victoria, Viadu

uiflo de Chavez, 9 km de Concep.
camino a S.A. Lomerio, Hda. San Lorenzo. Morrone &
1987 (CTES, LPB, MO, SI)

Villa Paranacilo, Morrone el al 5199 (SI)

958, Ayo. San Lorenzo, Morrone el al. 5328 (MO, Si)

Caranavi, camino a Rio Coroico, Morrone & Belgrano 4
(CTES, LPB, MO, SI)
BOLIVIA. Santa Cruz: Nuflo de Chavez, camino de
Concepcion a San Javier, Rta. 10, Km 73, Morrone &
5081 (CTES, LPB, MO, SI)

entre Chalk V Coroico
LPB, MO, SI)
BOLIVIA. Santa Cruz: Nuflo de Chavez, 6-8 km de

4971 (CTES, LPB, MO, SI)

6-10 km dc K.ii.

:'iO, SI, VEN)
m:j. ;■• ni V'. .

Nac. 12 n Km II

II u ,1 II - II. , I

Caranaw. \l« II 1 . I .PI!. MO. SI)

I ' I

\VA. , .Til','".
SI)

SI)
tratum SwalW 10 II BOLIVIA. Santa Cruz: Ni

Concepcion a San Javier, Kla. 10, Km 73, Morrone &

Brlgrano 5082 (CTES, LPB, MO, SI)
in, (Hack.) S. 20 II VENEZUELA. T i i u.kil < amino a La,

)enham

2 km de Pabellon, Morrone
ommuneUWo 20 II ARGENTINA. S Nac. 9, camino al Abra

de Santa Lai W0 (MO, SI)

lentkulatum Trin. 20 11

Bclgmno 4964 (CTES. LPB.
rtrichon Trin.* 10 II VENK/.l KI.A. Miranda: Area Metro. Parque Nac. Kl Avila,

sums Chase 30 11 'ongo, camino de La Paz

.:>;,"! : :i , ' ;

(CTES, LPB, MO, SI)
/le&wn Munro ex Morong 20 11 ARGENTINA. Corrientes: Empedrado, Rla. Nac. 12, Km

itton
ahum Chase 20 II ARGENTINA. Corrientes: San Roque, Bta. Nac. 12, Km 870,

31 km de S Ro( orrone et al. 5336 (MO,

SI)
ensii Hack. 10 11

i American Paniceae

nacrophyllum Kunth + 20 1 1 VENEZUELA. 'II : eclor La Honda camino

:i .:,:. '

Morrone el al. 4705 (MO, SI, VEN)
naculosum Trin. 10 II . 9 km de Concepcion

Belgrano 4985 (CTES LPB. \1(). Si)
nalmeanum Ekman 10 II BOLIVIA. Saul; . 9 km de Concepcion

Belgrano 4991b (CTES, LPB, MO, SI)
vm J. PresL 20 II VENEZUELA. ( naquillo a Tinaco, carr.

VEN)
nulticaule Poir. 2n = 20 VENEZUELA. Portuguesa: can.

de Acarigua. VI 0, SI, VEN)

yenicillatum Hook. f. 20 11 tig... camino de La Paz

a Zongo, Afom (CTES, LPB, MO, SI)

nlosum Lam. + 10 II VENEZUELA. Merida: Fac. de Cien. Forestales, Morrone et

al. 4721 (MO, SI, VEN)
nlosum' 10 II VENEZUELA, t Parque Nac. Canaima,

16 km de Quebrada Pa, lie, o > a 12 km de \ umani < ammo

. ::,.- ■
)k«m Chase 11 II + 18 I ARGENT1N

ilicatulum Michx. 20 II BOLIVIA. Sanf •

■•;:..;...

Belgrano 4979 (CTES, LPB, MO, SI)
ilicatulum 20 11 ARGENTINA. Ji , Nac. 9, camino a Abra

de Sanla Lu
■egnellii Mez ca. 10 II ARGENTINA. Entre Rios: Concordia, camino de Colonia

■-..,i :

5303 (MO, SI)
-emotum J. Remyt ca. 20 II ARGENT] N Vbra de Canas, camino a

Valle Gran. >2 (MO, SI)

■epens P. J. Bergius 10 II ARGENTINA. I ux . Brazo Largo. Rla.

:, . 1:
■obustum (Hitchc. & Chase) S. 20 11 VENEZUELA. 7 ; I .mute Nac. El A\ila.

Denhamt
■obustum? 40 II VENEZUELA. Portuguesa: Guanare, predio de la Univer.

Nac. Exp. de lo Zamora, Morrone et al.

MO, SI, VEN)
nisetum latifolium Spreng. 18 II URUGUAY. Tacuarembo: II

Sauce, Morrone el al. 5278 (MO, SI)
"■: :!'. -:- !- Mi

,' (( ll>. LPB, MO.

lervosum (Nees) Trin. ca. 18 II ARGENTIN ; az. Rla. Nac. 12 y Rio

Guayquiraro, al. 5355 (MO, SI)

a Schrad. ex 18 II «. a Yanicucho, a 1 km

schult.*

Belgrano 4860 (CTES, LPB, MO, SI)
)Roem. & 9 11 . camino de

Schult. 1 " Concepcion

Morrone & Belgrano 5023 (CTES, LPB, MO, SI)
Chromosome associations at meiosis: J i II |iiadri\alenl. and V 111 = octovalent.

.:■.

B

•

c

A

i

F,

1

D

I

■'■■

v

J

K

1.) :■■ 1 ill.. ;:<";! ■'■■ ■■■'. '

: .■ ■. : ■-,. 1*1,1. I!

i tu,-ili-/-ir:

i American Paniceae

1), Davidse and Pohl (1974),
orrmann et al. (1994), and
Morrone et al. (1995a).

Dichanthelium (Hitchc. & Chase) Gould is an

i from Canada and the United

lull. I

' 'I ill"' I i ",l I

I I | ■ I ,

ca. 80%, have I orth and Central

;
Zuloaga, 1992). .unt of D. hebotes

time, while that of D. viscidellum (Scribn.) Gould (2n

• • ■■ : .. i'S i).

Il,,- M I

strom, 1967).

/:■■■: tt ;■,!>.. ■■•!; '

;

Rugolo de Agrasar, 1987; Watson & Dally.

II : ■ Hi..",; . ' :

«.■>■ , a » ■ i K"

(Fernald) Wipff (2n = 54), and D.

>■' 1 1

1995a; Hunziker et al., 1998).

Echinochloa P. Beauv., a pantropical genus of
) species (Clayton & Renvoize, 1986),

tetraploid, hexaploid, and dodecaploid

(Watson & Dallwitz, 1992). A new he .

. ■ ■ ■

ecaploid count of
2n = 108 (Pohl & Davidse, 1971) a

i as n = 54 (Davidse & Pohl,

reflexed.

Eriochloa comprises about 30 species of moist

II) I'. "■it'i, !';■!■

(Clayton & Renvoize, 1986). The genus

octoploid cytotyy orted (Watson &

of 2n = 18 was

'Iil( I I'.'l I I'

ill lee counts are
i«- for E. punctata: 2» = 36 (Fig. 1A),

ild, 1966; Gould & Sodestr.

8); the other two
counts. 2n = 1;"'

Hymcnachnc P. Beai

53). The genus i

nberfor the genus

li i;. i -In !

'■■>: ■-;.'» i ■: ■■ i ( : ■.
arc 2n = 24 and 2n = 40
(Gould & Soderstrom, 1970; Pohl & Dav
Honfi et al., 1991).

the New World. The genus is distm

1 X the length of
the spikelet and nspicuous wings,

or scars, at the

1967; Pohl & Davidse, 1971; Honfi et al., 1991;
Hunziker et al.. 1998; Watson & Dallwi

with that oi a previous leport (Gould & J
1967).

at the apex, and the
m. Although few counts
jnus (Gould, 1966; Gould

Davidse, 1971; Davidse

Panicum L., si., has nearly 450 species worldwide,

1 ii i ' i i -I . i ! '

I' i ,

Dallwitz, 1992), although Pan,

(Hitchc. & Chase) Honda
(Zuloaga, 1987), is in agreement with previous reports
of 2n = 30 (Coy;:; 12; Urbani, 1990).

■ ■ - '■- i?i' ■■!■'

reported counts

,! ':t I/::'/ ..

1 1 et a I.. 1991;
,!.. 1W4: Monone et <.L -

■'; ' ii- '■ * ■■:'■<

!■::.■■■:![■:■■

indurate, willi boLLlelike

ioaga & Morrone is a
; (Fig. 1H). Previous

27 (Davidse & Pohl, 1978).

The genus Paspalum comprises approximately 310

» I

I iber of x = 10 (Burson, 1975). The

glume absent, occasionally reduced.
I _\. i^ i i . •< ill i it within t he-
America in Argentina and Uruguay (Denham et al.,

::,;.h'M '• " ! :

■ , ■ ■

Ekman is a di|

1990).

Subgenus Harpostachys (Trin.) S. Denham of

ii '! ill >>

t2n =40 for P.

) S. Denham is in agreement

: ' « ■ I''

i em has 2n = 40,

couiiL. under

Within -ubgciHis Paspalum, the group Livida

'■■ i i i"iil

i I j i -

'■.-•.' : \\

|-<-|||>. T-l. :v

i American Paniceae

(cf. Zuloaga & Morrone, 2005). Five

(Quarfn et al.. .'

I<m.-.| ii,:,, I!.. , ' . ' • '

■ ' ;■!.■■:■■,■ <■< i".::..

et al. (1998), who found an octoploid cytoi

The informal group Quadrifaria Barreto of Paspa-

. ■ i '. !;, il ;;■

species: n = 30 (Davidse & Pohl, 1974), 2n = 40

cells; a simi

alents, were ol)served in several
i ing with different

! i 1 li (,

1991). The count
of 2n = 40 for / iro ex Morong &

li '■■■ . i i !■:■■»■ >'-■,!;■■■
1 1 1 1

meiotic configura I II + 18 I. The

' ,,-Mf :■!

1994).

Paspalum regnellii Mez and P. commune Lillo are

; ^ ' ^ ■.!"■ ' » -J' »'ri\ v, ■:■

inirlii"! I." i- ■.!.-'.. ,; ■

'■-!■ >"»1 .! • ■■ ■■

1 . i i ' i 1 1 I i I

40 reported by Norrmann (1981) and Hi

II II 1.1 with 2ll ~

40, in agreement nts recorded by

i al. (1998).

! r ". I ',;..

with 2n - ca. 20 (Fig. ID), the first count for the

(1972, 1974), Ho id Pozzobon et al.

(2000).

The informal group Notata (Chase, ined.). which

1 I

et al., 2000). Pas Trin. is a diploid

cytotype with 2n = 20, in accordance wit!
of Norrmann et al. (1994).

iLh. a member of the

- , . I i '

j

(Snyder, 1953; Davidse & Pohl, 1974).

[.; Zuloaga & Morrone. 2
our count 2n - 20 for P. multicaule Poir. is in

1971; Davidse & Pohl, 1974).

Racemosa within n (Morrone et al.,

nth 2n = 40 (Fig. 1G), in

li. in i"i ii I ' 'I I In

.

I , I'll
Davidse and Pohl (1974).

species of Chase's

II I!. 'II'

al., 1974; Bursm Ylorrone et al.,

the hypothesis
atuie within the grasses. We found only

i ''iii'ii'i il I

il'l I

F. M. Vails. 2005.

ferrugineous: and uppei anthecium pale and shiny.
Pennisetum Rich, is a genus with about 80 species

'I'll! ' II

; ■ ■ : ■

urn led, 'Villi i» : k :■.<■;<: ilier v,iiii ilie spd; liP,

specimen exhibits an irregula

s with Parodi (1946) e

i his of ca. 110 specie:
tropical and warm temperate regions.

persisting on the axis, below the spike
anthecium indurate, usually rugos

Schult. is 2n =

I .;W !'i- I !'■

! I ■ i i I

pes. respectively, from pro i

was analyzed, tin this contribution

support, as previously published by Quarin

, F. 0. Zuloaga & E. A
• phylogeny of Panicun
lonophvly and phylogeneLk

I I I

..

■■■ ■'■;.

:

'he North Ameri
. Herb. 28: 1-3

. Ined. Revi

genus Paspalum.

Institution, Washington,' D.C.]

Genera Graminum.

V Reunion Aniversario Institute Fitotecnia Castelar, P. 38.
Grins, W. J. 1991. The gener;:

Panicoideae) in [he soulheastern United Slales. J. Arnold
Arbor., Suppl. Ser. 1: 171-312.

W. Pohl. 1972. Chromosome numbers,

America and the West Indies. Canad. J. Bot. 50:
1441-1452.
& . 1974. Chron

P.i.'i; .'".'I

/■'
American grasses (Gramineae). Ann. Missouri Bui. Gard.
65: 637-649.

,. T. II a: ■ :

ii 'I

i American Paniceae

■.<.<■■■

reiision and ph\logem of Paspalum subgenu

& F. 0. Zuloaga. :

:

(Gramineae: Paniceae). Ada Amazon. 19: 47-114.

1975-107!;. Monogi. S N sl. Ilol. \lissoun I'.ol. Gaid. 5.

. II 1 l,i I h; ! mi i In hi ,,, I' II

1981. Monogr. Syst. Bot. Missouri Bot. Card. 8.

II <*::■. . . , ; i '-.,■■.

:.;■■: i..

1985. Monogr. Sysl. Hot. Missouri I'.ol. Card. 23.

•,M. Bol. Missouri Bol.
Card. 30.

Plant Chromosome ]

Moore, R. J. 1970. Index t

1968. Regnum Veg. 68.
. 1971. Index to

1969. Regnum Veg. 77.
. 1972. Index to

1970. Regnum Veg. 84.
. 1973. Index to

•.mm Veg. 90.
.!"■■[■

um Veg. 91.

.. II": ,

.iiiim \eg. 96.

■,V, :.,■■■: ]■■'!■■ . . . ■ .

M. 0. F. Sacchet. 1974. etiological and e\olulionar\

lias (Poaceae: Panicoideae). Darvviniana 33: 53-60.
, F. 0. Zuloaga & F. Carbono. 19951). II;

■ ! :l r \ ;«-,
.. \ \,-
especies del genero Paspalum L. (Poaceae: Panicoideae:
Paniceae), grupo Dissecta (s. str.). Candollea 55: 105-135.

.■■■■■:■

studies in American Panicoideae (Poaceae). Ann. Missouri
\: 647-657.
, S. S. Denl 0. Zuloaga. 2008.

cular data. Syst. Bot. 33: 66-76.

Gramineas de America Austral. Editorial Hemisferio Sur,
itologia y metodo de reproduccion

■:

149-158.

' ■ ■

. II ■■'.:■. •. .

_J_ & P T j Ki n een 1994

Canad. J. Bot. 46: 1315-1325.

oi

& C. F. A. Clark. 1978. DichantheUurn i

,i,ii ,

65: 1088-1132.

gramineas argentinas de la tribu Paniceae.

,- r

tropical American graces. Amer. J. Bot. 54: 676-683.

.. 1 -:■,.;:

& . 1970. Chron

Mexican and Colombian grasses. Canad. J. Bot. 48:

. ; .„ .-■. ; ■::>■.

1 !

American grasses. Canad. J. Bot. 52: 1075-1090.

1965. Regnum Veg. 50.

relationships in the genus Axonopus (Gramineae). Cytolo-
gia 40: 185-204,

Estudios cariologicos en gramineas sudamencanas Dar-
winiana 30: 87-94.

II I.i I

1998. Estudios cromosomicos en Paniceae sudamericanas

(Poaceae: Panicoideae). Darwiniaiia 35: 29 36.

issouri Bot. Gard. 77: 125-201.

F. R. Carraro. P. M. de Freila>. F. V.
A. R. Batista & J. F. M. Vails. 2001.

' . ...

Panicoid grasses. Apomixis Newslett. 5: 7-15.
— .1994. Ylelraploidc\lol\peof A/.s/

.' ' llni . ,i i

apomictic Paspalum species. Cytologia 56: 223-228.

& G. A. Noiimaiin. 1987. Kelaei.

y 73: 254-256.

-116.

. H. 1975. The bases of angiosperm phylogeny:

724 764.
. K. 1971. Notes on
chromosome numbers. Britlonia 2

■iologia do algunas especies del genero
•Icrin. 2: 41-48.
-. 1948. Cariologia de grammeas en \t«enlma.
sla Fac. Agron. Velerin. 12: 51-67.

. de planl as colombi-

:

Poaceae in IOPB chromosome number reports \L\ ill.

i: 367-372.

Sla. U.S.D.A. Oil Exp. Sta. 18.

: !;.< :• ;,.

iarini & L A. K.

!iM, .i.i, r ■■ '

li.Mica 99: 89-94.

de reproduction de

■■(.; ■,,: i.'ii

26: 205-208.

information retrieval of data including synonyms, mor-

Panicum (Poaceae: Paniceae). Pp. 287-306 in T. R.
Soderslrom, k. \\ . Hiln. C. S. Campbell & M. E.
Barkworth (editors), Grass Systematics and Evolution.
Smithsonian Institution Press, Washing

I ! iii

Bolivia, sur de Brasil. Chile. Paraguay \ Uruguaj).
i.i. Card. 102.
, R. P. Elhs

(Poaceae: Panicoideae: Paniceae). Ann. Missouri Bot.
Card. 80: 119-190.

O :, '

Peterson, R. J. Soreng & E. J. Judziewicz. 2003. Catalogue
of New World Grasses (Poaceae). 111. Subfamilies

„,. .4;..,- C:>Mi!

■ J. ^. : . . .

. Ylonogr. 71: 1-75.

Acknowledgment of Reviewers

The following individu

3 thanked for their

This

by the Annals.

Abigail Moore

Jerry M. Baskins
Ilsi Boldrini

John Clark

Monica M. Ponce
J. Mark Porter

El l 1 Ll R rer

ligolo de Agrasar
iahagvin Godinez

Bruce Sampson

Diego Giraldo-Canas

Peter Stevens

Elton M. C. Leme

Jose F. M. Vails
Stephen Weller

www. mbgpress. org

( Lauraceae)

nig-IPeng 1

Estudios en el Genero Paspalum (Poaceae, Panicoideae, Paniceae):

i: Fernando 0. Zuloaga 11

!■,;■■:■■;■■:!

Shirley A. Graham 34

pical Rubiaceae. I: Rubioideae Michael Kiehn 91

] ■ ■< ' ■ i'\ . ■• ■■.:,„■■■■■■■.-■:■■

aceae and the Evu
le M. Fernanda Salinas, Mary T. K. Arroyo &

Juan J. Armesto 117

rican Paniceae (Poaceae, Panicoideae) Silvana Sede,

Alejandro Escobar, Osvaldo Morrone & Fernando 0. Zuloaga 128

sou
Botanical
Garden

blume 97
Number 2

The Annals, published quarterly, contains papers, primarily in systematic botany,
contributed from the Missouri Botanical Garden, St. Louis. Papers originating outside
the Garden will also be accepted. All manuscripts are peer-reviewed by qualified, in-
dependent reviewers. Instructions to Authors are printed in the back of the last issue
of each volume and are all ine at www.mbgpress.org.

Editorial Committee

Victoria C. Hollowell

Editor,
Missouri Botanical Garden
Beth Parada
Managing Editor,
Missouri Botanical Garden
Allison M. Brock
Associate Editor,
Missouri Botanical Garden
Tammy Charron
Editorial Assistant,
Missouri Botanical Garden
Cirri Moran
Press Coordinator,
Missouri Botanical Garden

Roy E. Gereau

Latin Editor,

Missouri Botanical Garden

Ihsan A. Al-Shehbaz

Missouri Botanical Garden

Gerrit Davidse

Missouri Botanical Garden

Peter Goldblatt

Missouri Botanical Garden

Gordon McPherson

Missouri Botanical Garden

Henk van der Werff
Missouri Botanical Garden

For subscription informal ion conlacl Aw us
of the Missouri Botanical Garden, %
keting & Management, P.O. Box 1897, Lawrence,
KS 66044-8897. Subscription price for 2010 is
$180 per volume U.S., $190 Canada & Mexico,

price of the Annals.

The Annals of the Missouri Botanical Garden
(ISSN 0026-6493) is published quarterly by the
Missouri Botanical Garden, 2345 Tower Grove
Avenue, St. Louis, MO 63110. Periodicals post-
age paid at St. Louis, MO and additional mail-
ing offices. Pos 1 ess changes to

The Annals are abstracted and/or indexed in AGRICOLA (through 1994), APT Online, BIOSIS®, CAB Ab-
stract/Global Health databases, ingenta, ISI® databases, JSTOR, Research Alert®, and Sci Search®.
The full-text of Annals of the Missouri Botanical Gal BioOne™ (http://

cal Garden Press 2010
Missouri Botanical Garden i
in order to preserve and enric

) discover and share knowledge about pla

»fANSI/NISOZ39.48-l

status (Chiapella & Probatova, 2

PeLrie, and D. lenella Petrie in New /

Hubb., D. robusta C. E. Hubb., and 1). wacei C. E.

■■

[dar sequence study

''! 'II I'' >■

& Fingerh.) Drejer or Vahlodea Fr. are in«

The first South American descriptions of taxa later

II, .-, i I

>t I! .. : IKl . I.

ok. f. Hooker also mentioned collections
mil Islands (Islas Mabinas)

rather vague cod

■:'.", v i. I ,. ;
Hartm. have had an obscure t

■,,■::! , \'>,;:.
al., 1997; Frey, l ( >W). and instead treated under

tes (Trin.) Munro ex Benth. and D.

1 ,, i i „

i ; ■ i < i i i .

I

P. Beam., and D. parvifbra P. Beauv.). Linnaeus
(1753: 64) separated the -|

and included A. cespitosa in the latter

: .!: i..- Ill, ill','

,■,.'■.■;.■.■.■(- •

collecting look pla(

Dcsvaux (1854) made three new <«.

i II. ... i i II

ned by Desvaux (1854) for

Nees & Meyen ( pulchra (Nees &

V I ■:-•-.■ M

; . ^ :, . ■ ■ ■.■',. :■■■■.-.,!,..
: ' , ■ " i/;i;'.i:

(Trin.) Munro ex Benth.).

botanist, R. A.

. ' 7 >■ ! ii;ii

E. Desv.) in 186

.'■.■■. •>>■!;<!,!

'' II I I '

'■ I I 1

Chiapella & Zuloaga
Revision ol
Vahlodea

..".<■'.■:.:' : it. ' .

to Deschampsi

" I ' 'I III

I . i I! i i

also updated Deschampsia in South Americ

■;■■■■■
I. I : ".

il.) Parodi).

Matkrials AM) Mkthods

BA, BAA, BAB, BM, CONC, CORD, K, LE, P, S,
SCO, SI, US, and W (Holmgren et al, 1990),

! , 'I

■:■ ';■■;■;■ 'II .''.' :ii

' , ' . ' '.I •.,:« .':

'..I ". I. C •'-

' ' :

i

; , .

iristlelike', ca. 1 mm wide; lemma

21). Leaf blades Hal. ne\er ;

stout . .'. ' il

. ,■"■".:■.'.'■,:■■.■','.:.■■'

Taxonomic Trhatmknt

,m//.s Honda ex Nakai.
Plants perennial, caespitose, somel

I'm .■■:■>>. " '. ■, ' ■::.!

"I I ' >' ' i. f

, ..

'■>'■. 1 1 1 '1 IT'-'"

: I i' . !

"' - , i ■ -I • ii' i

.::■!» in"":. n !"

minute, central teeth larger thai

bentandhvisled.inseiUHla.il)

keels, apicallv i Caryopses ovoid,

Avenella flexuosa (L.) Drejer, Fl. Excurs. Haih.
32. 1838. Basionym: Aira flexuosa L., Sp. PL 1:

/«« (L.) Trin., Mem.
Acad. Imp. Sci. Saint-Petersbourg, Ser. 6, Sci.
Malh., Seconde Pt. Sci. Nat. 2(1): 9. 1836, non
lees, Gen. Fl. Germ.
2(1): t. 43. 1843, coin
(L.) Pari, Fl. Ital. 1: 246. 1848, nom. superfl.

Transsilv. 753. 1866. Podianapus flexuosa (L.)
Dulac, Fl. Hautes-Pyrenees. 83. 1867. Salmasia
flexuosa (L.) Bubani, Fl. Pyrene (Bubani): 4. 319.
1901. TYPE: Europe, "in pelris. rupibus"

Redhead & Polhill [1970: 94], LINN 85.11 not

Schuliesl 2: 679. 1817. T\ PK: Argentina. Lslas

'I

Trans. ,K ' Proc. Neu Zealand Inst. 23: 102. 1<'W1.

■ . :.. ,>/■■';.. .777.

TYPK: Chile. "Vallc Huminis Palena," Jan. 1887, F.

. ' . ■■:;;[ ;:.":!. II: .■■

i 337. 1929. T\PE:

= hi • '.7,M !l'::i ' ..

.871 not seen).

:

Martin s.n. (holotype, SCO not seen: isolvpe. BAA ex
SCO!).

. (■:■::.:,■.:■.■ ■■'.!

28. 1913. TYPE: Argentina. "Falkland Islands, ad East
sberg 124 (holotype, S not

Discussion. Avcnella flexuosa has been cited as

I i i i I I i I

: Ml I, i »i

i ii i! ; i !■■'..

Voy. Monde, Phan. 2: 23. 1829, nom. illeg.

Specimens examined. ARGENTINA. Chubut: Dpto.

:

:■.-■ ..v.':- i ; . ■•-

se, membranous. Panicles 7.5

: : Is;, Ill';

' • • : ■.''.■!■ ■

', ;■ k ;■■ ■'!

:

in the keels, erose

li <" ,' :il|i,

ovoid, brownish purple.

Chromosome number. 2n = 28 (Hubbard, 1984,
as Deschampsia flexuosa).

Illustration. Nicora (1978: 230).

',"7,7:.',','/. '.■:■

: :

'.',:. ,'!.;.' i

' . :.. I i

». [rroyo 3667 (BAB); 26 km S of
Argenlino, Lago
72°57'30"W, A. Cocucci & A. Sersic 2493 (CC

'■.'■■■■

V. Alboffs.n. (CORD); Ushuaia, 7

', n ■,

Li,: Cnili.lr. ..

c. 3, San Sebastian,
Srlloi, s./i.. \(» |

\ iehadem. Casa
II ■■-■:■■ .. '. ::': i ■ ii =: ■

;

\\ n-r,-.\-A \ ■:■,.; . ' '

: :

;. ., ;,:, !-,,,,;.■:

I'm ,!■■ i I'

-. : ■ ■ . .■.•■.:. < !■;.;■■

Jacquinot Hombron s.n. (BAA).

C f t [ 1 1 1 L L it extra-

rather scabrous,

• in

<> :7"lii." lis >".!,:, ii.

- 1 1 ' | ' I 1 1

1 -nerved, keeled,
brous; lemmas 4(6)-toothed,

inserted in the ii| una. rarely in the

eeled; keels scabrous, sometin

Hartm., Handb. Skand. Fl. (ed. 4): 30. 1843.
Basionym: Aira atropurpurea Wahlenb., Fl. Lapp.
:;7. 1812. IIolius atropurpureus
(Wahlenb.) Wahlenb., Svensk Bot. Tidskr. pi.
687. 1826. Avena atropurpurea (Wahlenb.) Link,
Hort. Berol. 1: 119. 1827. Deschampsia atropur-
purea (Wahlenb.) Scheele, Flora 27: 56. 1844.
TYPE: Finland. "'I lab. in fruticetis campis et
juniperetis subuliginosis per partem subsylvati-

juxta Jvalojoki et Sotajoki," 22 Aug. 1802, G.
.. (lectotype, designated by Mo-
berg & Nilsson [1991: 293], LPS not seen, photo
ex LPS!; duplicates, LE-TRIN 1856.01*!, BAA!).

i magellanica Hook, f., Fl. Antaxct. 2: 376, t. 134. 1846.

Aira alropiir/mrca var. magellanica (Hook, f.) Skollsb..
Kongl. Smiska \H

(Hook, f.) HvL. BoL. Not. 3: 356. 1953. Vahlodea
magellanica (Hook, f.) I

.,., I .;.,■,,-, (i : a :•

Chile. Fori Famine, s.d., James Anderson King s.n.
(holotype, K!; isotyprs. BAA (ragm. ex K!, pholo IIS
867650 ex K!).

Perennial, tufts loose, extravaginal or intravaginal
brown. Leaf blades 2.5-6 cm X 1-4 mm, flat,

pedicels scabrou hairs reaching

Chiapella & Zuloaga

145

Revision of Deschampsia,

Avenella, and

Vahlodea

5 mm, broadly lanceolate, 1

-nerved, keeled, upper

glumes 4.5-5.5 mm, lancec

date, 3-nerved, usually

,; lemmas 4(6)-toothed,

e, equal, 2-4 mm

, membranous, awns 2-

tally geniculate c

r occasionalK stiaight,

at, scabrous, inserted in

II". rarely m the 1

ower; paleae 2-3.5 mm,

hyaline, 2-keeled, keels scab

rous, sometimes slightly

scabrous between

; anthers 0.8-1.5 mm,

purplish. Caryop

nm, narrowly fusiform,

brown to brownish red.

r number. 2n

- 14 (Albers, 1972a, b).

Illustration, Hitchcock e

■t al. (1969: 548) (as

■'.■■.■.'.■.',.',■■■",■;■..■■.■,■ ';, . ■

atropurpurea has

Northern Hemisphere,

r, amphi-Atlantic

distribution; in southern

,, ,

(Strait of Magellan region), wl

lere it is found on rocky,

humid .-Jopo,., !•

and 2300 m elevation.

,■,■■■.,:■, u .).:■;■

Discussion. The populations in South America (vs.

hi,

i ■: ■■ l- ■ f r i ) »li 'M

; '. ;'.n II I'lln'i

I I, ' j II i I,

arranted, and we

i j 1 1 i

■
azufre, 80 km W de El

as Mellizas, valle

■■:■■..■.

. . '• : i!-r ■ : : Sv'. i-!

2628 (\IAA): n,in ' Horhke & M. \.

:

Cruz: Dpto. Lago Martin, desemboca-

:

' ■■■>. I '.>.:,::. '.

• . ■: '

- I ' , l!

Peninsula Brunswick, A. Donal 455 (BAA).
III. Deschampsia P. Beam.

pi. 18, f. 3. 1812. TYPE: Deschampsia cespitosa

(L.) P. Beam,

:

Monandraira berteroaim (Kunth) E. Desv.

gantulum Steud.
TYPE: Arislavena selacea (Huds.) F. Albers & Butzin.
Plants perennial or annual, often forming tussocks;

I < Ili'l.

I ' '• , , ( I I II I I II

!■■•! «■ vivr I.

■■ ■ ! ■ ' ' '■ ■■■ • ' ■ ■

continuing as th< straight to bent,

a few apical tricl laryopsis ovoid to

Discussion. Cheeseman (1906) I 1 ll I ll

nely reduced and s

] i i In

genus, which gen at are developed

-,■-■ . ii MV

trnL sequences, i of the New

. ■' ■' ' " ■ ' : . . : ■ :
inls up lo 50 cm.
Plants annual.
3a. Leaf blades stiff, ere 1. D. airiformis

. ': II,. ■!

la. GUinics wiili a 3. D. berleroana

., e scabrous.

5b. Awns 7-10 mm, inserted in the middle of the lemma; panicles 4-12 cm 10. D. looseriana

7a. Plants rhizomatous '. 11. A mendocina

8a. Awns slmil..

9a. Callus hairs not reaching the middle of ihc lemma ... 2. I), anlarclica (Antarctic specimens)

14. D. setacea

lib. Lemmas 2.5-3 mm 15. D. venustula

I D. kingii).

13a. Spikelets 3-5(-5.5) mm.

Chiapella & Zuloaga
Revision ol
Vahlodea

The 15 species of

;s outside this main distnbut

Deschampsia airiformis (Steud.) Benth. &
Hook, f., Gen. PL 3: 1158. 1883. Basionym:
Trisetum airiforme Steud., Syn. PL Glumac. 1:
229. 1854, TYPE: Chile. "Arique, in pratis
paludosis," s.d., Herb. Lechler 723 (holotype, P!;
isotypes, fragm. BAA ex P!, fragm. BAA ex K!,
GOET not seen, K!, US 91466 not seen).

rostis desvauxii Phil., Linnaea 33(3^): 288. 1864. TYPE:

: II 'I I. Il V! II '.I

glabrous with mem

i margins. Leaf blades

■ N II II

with the nerves

Illustration. Nicora (1978: 242).

etween sea level

Discussion. Desclun

& KAerh. (\icou. 1978,). 'flu's mst fun

infects mostly pooid grasses as

■.■■■■)■; -r-t-n/,--.

' I 'I i i '

contracted panicles with densely scabroi
branches. The o> tided range of the

annual species of Deschampsia agrees with

• • ;

Specimens examined. ARGENTINA. Chin

!); Dpto. Los Lagos'

TrafuL L R. Parodi 15358 (BAA). CHII.K

:
(CONC).

L 1-1 Ti lin[l H ill ill n :

(Gay) 6: 338. 1854. Replaced n
antarctica Hook. L, Icon. PL 2: tab.

awn stout, bent, rarely straight

apex 4(5)-toothed,
2 -keeled or rarely fh

452. 1949. TYPE:
1853. W. Lechler 1220 (\
I fragm. not s&

DescUmd^anfan-rta! I lL iari.iala H.rk , erted in continental

>00, nom. nud. die coiiliiienl and

■
leaves; culms slender, 10-25 cm tall, 1- or 2-nodcd.

1 I t 1th

1.5-5.5 cm X 1-1.5 mm, adaxial nerves scabrous. . . . ., .

is sensu Du Rietz

i. -lie planls are

iii iii

....... ' ' ' . .

I'll 1 In f A ' 1

Spikelets 2(3)-flowered, green to violaceous, or varie- ^^^ ^

gated with both colors; lower glume narrowly lanceo- ' * ' ' * _

l l I ' I | | lormal pio|

. ... . . ' . . * , require suppou

mpsiuanlarclicaas
nd in 1936.

li,.. , (1 :,^i: '• '

ha f:

than the central, s,

spikelets. The quant

2-3 mm, 2-keele

nvoid brown Kerguelen Isi

anil Tierra del Fuego (Corte, 1961).

(1900) published the name; Deschampsia

ation. Hooke

nology. Deschampsia

:a is one of only two ■

vascular pL

ant species

[Islas Malvina

50, Bouvet,

Kerguelen) an<

1 in the

n continent. Fl

(McNeill et al, 2006: Art. 32d). The search for
sue c essful in the herbaria \S (Hackel collection

71°20'W. cosla del H

: Yalle Lagiuia ISWa. 71 15' \

from this taxon by the longer awns that Tehuelches, 1 10231 (SI); Est.

.ceed the glumes and the spikelets. which arc-
die keels in D. 4 ™'S,7 'foJo^ljl^ (BAA);^

..... .

Tecka, Esl. La

: | II All). Kio Nejiro: Dplo.

Esl. Ra\huau, O. Boelcke 4486 (BAB). Santa

,r:.::. ".',:!"

itarctica show clear

:ic and continental

Pilcaniye

ipermost sheaths in

Chiapella & Zuloaga
Revision ol
Vahlodea

: : ■

■ ■,■.:..■/..,. ..:','■"

eau 1923 (BAB); Est. Harberton,

•: .'■ r ■: , I , < U ■ . ■!■,-.■

;■'<-,.,. ■:.;. :
.1. ' hi !

' : ! ~ '.I' I .■■'-■■■

,'. , , \ in.!,
■■.i--..ii;,::. ".'■ ' '

/.:/■'.■.' lit.S : ..:...

Fori Stephens, Cape Meredith, D.

V. Luti 1485 (BAA,

I in I

, ., I ,.
, '

;.,,:■ ':• i! • ", • '

Hi ' ! i i .'

Sladen H639/1 (BM lands: King George

1152, 10153 (BAA,

'

■ ■.!,■„ i'- ;

,1.1 ,,, II II MM ' , , I i, Ml II , I

Ricardi 11938 (BA Arenas, moist sandy

:

, ,.i :• !':..!,:■,.,.

(BAB); Laguna Blai 'uinazu 183 (BAA);

■1,1 i !.i,„-l, (! '

Burkart 9507 (BAA). Kerguelen Isla

,,i
:

Gramin 2 4i7 tab 142 1831. Monandraira
berteroana (Kunth) E. Desv., Fl. Chil. (Gay) 6:
343. 1854. Aira berteromana (Kunth) Steud.,
Syn. PL Glumac. 1: 220. 1854. TYPE: Chile.
Rancagua, Oct. 1828, C. L. G. Bertero 30
(lectotype, designated here, P!; duplicates, S!,
SI ex P!, MO not seen, photo!).

.

Annual, slender, delicate, culms up to 45 cm tall,

. -.■.•; ■■ , I. il : ■■

folded, 4-11 cm X 0.6-1.5 mm, nerve

■ . ' ■!( ■ ; ;|.t all-.:

) cm, with 5 to 7 verticils,

1- to 3-niTvcd. upper glume
lanceolate, 4-6 mm, both glui

" !.; '.Ill, ill , I, inn

lemma; lemma

, ii I! ,i II I, ■ i

i near the lemma

:: i ,. .•II:: - ..

. ill Is: '

fusiform, brownish red.

Illustration. Parodi (1949: 465).

.:■.■■:/:.'),• '.'■■,■.' .','■■ •'.■■'.■ ..

' . ' II 'I .1

00 and 2800 m elevation. Although its

■"HI |i ;!«,;'■'. ! i

al., 2001).

Discussion. Deschampsia berteroana belongs to a
small group of four annual sp<

■ ■ Hi f ll.il ' hT

I " t r.h
numerous annual species ai

winters followed by h
, 1981). These con-

cles and the ability t

developed as an adaptation to ecological

Carlo Luigi Giuseppe Bertero (1789-1831) was an

li ! I! nil )

■■■■ -.vHm l;'. II i

specimens were lost with him. Among the specimens
in P. S. s(;<). siiicl TO), i

: ' .

Specimens examined. ARGENTINA. Mendoza: Las

Heras, cerca de Po A. Ambrosetti & E.

3 (MERL); pasando Polvaredas, cerca del lugar

de camping, 2200 n )2 (MERL). CHILE.

:

■ i ■■ ml.

':■,;■',-.:: V'. \

Ml, Mid.

irdillera de Combarbala, Potrero Grai

ex K!, BAA 869fragm. ex B!, SGO 37213 not seen,

pliolo!. US 556497 ex SGO PIIIL-201 not seen).

Perennial, densely tufted grass with extremely

: i! 1 1 mi I

1 1 1'-iii 11 :■'!', ■:■.,,;■.

linear, flat or <•< cm X 1.5-4(5)

1 i i

OA A). ■.

.. ■ :■

. ,i" I'-,-,,. ■,.

Agrostogr. 91, 149, 160, pi. 18, fig. 3. 1812.
I ... Sp. PL: 64. 1753,

Prodr. Stirp. Chap. Allerton 25. 1796. Campella
caespitosa (L.) Link, Hort. Berol. 1: 122. 1827.

IM'ili - II ■ I . I • ;.

zig 45. 1867. Podionapus caespitosus (L.) Dulac,
Fl. Hautes-Pyrenees 82. 1867. Aira major Syme

Hoi., ed. 3b: 11: 64. 1873. TYPK: "Habitat in

: ' ' ■■■■.::;■, i;i;'« (M , |, ;.;

Polhill [1970: 92], LINN 85.8 not seen, photo!).

1866, R. A. Philippi s.n. (hololype, SGO PHIL-201 noL

! ii. '.I II

1 1 ■■ I i: I

H Ml ,

glumes, scabrous; pale;
keels scabrous. Anther
Caryopsis 0.5-1 mm, o^

ellow or purple.

2n = 26 (Albers

■■ ■ : ' ■

, i ' '

America, Deschampsia cespitosa can be fou

nes" in Patagonia), bogs, and

n !■».;»;.» i >-\^..r
Discussion. Individual specimens of Deschampsia

il

I

Chiapella & Zuloaga
Revision ol
Vahlodea

clades (Chiapella, 2007). This species is

n r... i:.,il«-r

...■,.

ied. ARGENTINA. Chubut: Dpto.

(Ml.: \;il ,".1: '" ■

: :

(BA); confluencia Rio Colorado coi

;.

:ini;, ■. I.!-.. '

. : ■

(BA 78632); Lag., ' 938, A. Castellanos

, I i ! ,.
- .

1 . I! ■

Kurlz 9667 (COK : trl: 9727 (CORD);

'II II .•. i li ;,
.. ' '. ■■■ . '

.

■■:.-.■..<!. :. ! I ..■ " '

, - VI. ,' M.

5962 (S, SCO). Ma u Cordillera Volcan

G. Grandjot 3486" < ,o, F. Schlegel 2590

Kaschsimpms: ca--::-,; . ~ : -.. ■ '. ■■■■,. ;

Meyen) Nicora, Darwiniana 18: 101. 1973.

,■■■■■:: ' ■■ VI- ; li

in Nees, Gramineae 24-25. 1841. Aim pulchra

(Nees & Meyen) Steud., Syn. PL Glumac. 1: 220.
1854. TYPE: Chile. Cordillera de San Fernando,
ad Rio Tinguiririca, 4000 m, Feb. 1831, F. J. F.

. <-. W).
Plants 20-150 cm, panicles open. Leaf blades flat
lc 5-10 mm.

■

V :

V (!■■ \ ' )

5. Deschainpsi Hauman, Anales

Soc. Ci. Vrgent. 86: 231, pi. 4. 1918. TYPE:

Cuevas, Mar. 1918. M. S. Pennington 22
(holotype, BA 39306!; isotypes, BAA ex BA!,
US 865607 ex BA not seen).

.11 ■■ ,- "-: ro-
iled. 5.5-12 cm X 1-2 mm,

'. • !'. (■;■. II,: 1.11:

\<»,r. i'-. \.
'■■'■ i in / ..

/S or at the base, exceeding the

v, 2-3 mm, 2-k<

Illustration. Parodi (1949: 435).

Distribution and habitat. Deschampsia cordiller-

3300 m, where it
grows by small

. ,,■'...:■ I ''.I Ill' I

"111 -II Ml. II i

I lr

1 i 1 1 1, -I i. I!

46212 (COJNC).

Hartw. 342. 1857. Basionym: Aim danilionioides
Trin., Mem. Acad. Imp. Sci. St.-Petersbourg, Ser.
6, Sci. Math. 1(1): 57. 1830. TYPE: "America
Borealis Occidentalis," 1829, Lindley s.n. (holo-
type, LE TRIN 1873.0T!).

Deschampsia calycina J. Presl. Re

spikelets. 1 fie species

Aim calycina (J. Presl) Steud., Syn. PL Glumac. 1: 220.

fungus Tilletia cerebri

tiales) (Castlebury et a

T. Haenke s.n. (hololype, PK nol seen; isolypcs, LE

sdmmpsia glauca (E. Desv.) Parodi,

MacKay 29623 (BM). U.S

Darwiniana 8: 467. 1949, non Deschampsia glauca

Horse Flats, V. Duron 350

S. Hitchcock 1419 (P); «

i ,!:■!,■'..., ■:■>■ :',-

Creston, Shandon rd., R. 1

DESV 70!; isolypes, P!, US i'ragm. ex P DESV 70 nol

A. Beetle 1731 (BAA). I

Deschampsia gracili : 224. 1885. TYPE:

Nachlinger 14258 (CORL

" ,;■■ ;,M

2157 (P).

,

II : ;.l .■', :. ; >l ,

CHILE. Coquimbo R,

Marticorena & 0. Matthei

i! : :. ■-!:■■...

Buenos Aires, C. Martia
Elqui, cuesta de Buenos A

,us with membninnu.Mu.rf.ii

i inrolled. imm.wlx lanceolate, 3.5-10 cm X

Region: Rancagua, TV

0.8-1.5 mm, alia

70°34'W, A. Pfister 1310.

' " < : '■ ;iiIVI t;i|:'l ,1 I ■■:,

central tooth, 4-nerved, sparsely scabroi

scabrous, inserted at the base

. .'

Illustration. Holmgren and Holmgren (1977:
263).

Distribution and habitat. Deschampsia dantho-

it is found from fornia in wet or

■■! . 1M :,!■:■

. 1 1 ■:■:■. \'. ,:■■ M-l I

D n D I ni}. I ^ I hffers

■ - in ■ r;iiri.-,ii\

;n i< :'-«! ;ni:

usually infected by the rust
2005).

c cliffs, /. A. Colder & K. T.

Chiapella & Zuloaga
Revision ol
Vahlodea

■ :■'! i i ■::■.. S

of the River Columbia, s.d., D. Douglas s.n.
(holotype, K!; isotypes, BAA fragm. ex K!, US
76303 fragm. ex K photo!).

:
1889. Deschampsia aciphylla (Franch.) Speg., Anales
Mas. Nac. Buenos Yiies 5: 89. 1896. TYPE: Chile.

■ ,11! I, r

isotype, US 76296 fragm. ex P photo!).

Bol. 5: 384. 1889. TYPE: Chile. Palagonie, Punla
Arenas, 5 Feb. 1879,

■i... ev !•!. US 76297 fragm. ex P

80 cm tall, 1- to 4-noded, wit!

I!i i i ■ ill I, ii n;

... I 1 1 'In

I -i

sparse!) scabrous. Spikelets 2-flowered; rachilla ai
callus pilose, with few long hairs ca. half the length
the lemma; lower glume narrowly lanceolate, 3.!
4.5 mm, upper glume Lanceolate, 3.5-5 mm, bo

scabrous on all nerves, most rarely between the]

Si:-., ■ , ,'::' I

lemma; lemma scarious, 2-3 mm, apex 4-toothe
;er than the central tooth; awn straig
or nearly so. twisted, 2-5 mm, inserted between t
middle and [he base of [he lemma, more often in t
lower 1/3; palea hyaline, 1.5-2 mm, 2-keele

' \: ; i ■' I!";; ■ |, .fr

" I • ii!'." t.-:i )]..

.■;.■,■■.■.■■.,.,,.,■,

lotte Islands, Moresby Island, Gray B

near summits of ml i R. McVaugh 1 0323

ARGENTINA. Chubut: Dpto.
(CORD). Neuquen: Dplo. Huilirhes. Parque Na<

reddish. Caryopsis 1-1.5 mm, fusiform, brown.

Illustration. Holmgren and Holmgren (1977:
261).

1 ! I i 1 1 1 i

mi bogs, wetlands, and along
, i III ,ii i

50 S latitudes.
Discussion. Deschampsia airiformis and D. elon-
their contracted,

a. Los Lagos, Fortin Chacabuco, ./. I

' . ■ ■

o v lago Felipe, 0. Boelcke & M. N. (

:

I ■

! i.

,;:.!■: M •:■■■;

,, l.iueura. en la

A ^ :. .■ . .-i - ■:. . ■' ■:.-!

lima Esperanza, Cueva del Milodon.

:/. !;..;/.•.■• '

!0NC 71822); Lago Balmaceda, A. Kalela 2022

,. ■

Calavera, E. Pisano et al. 8191 (C(

4i (Hook, f.) E. Desv., Fl. Chil.

I I ,,!■■, I '■:■.:. .!.,:.... , ..

f., Fl. Antarct. 2: 376. tab. 135. 1846. TYPE:
[Chile.] "South part of Tierra del Fuego, Strait of
M II It Famine," Jan. or Feb. 1833, C.

,'.'."'. : • :■■■■■. I ■'■ VI

Porter [1986: 30], K!; isotype, CGE not seen,

dozei r ranch.. Miss. Sci. Cape Horn, Hot. 5: 384, pi. 9
& f. a-e. 1889, nom. superfl. TYPE: Chile. Sandy
Point, II. Uchlei 1222 (hololype, P!; isolypes, BAA

, , . 'i

Perennial, caespitose, sometimes rhizomatous,
culms 25-125 cm tall, stout, erect, 1- to 3-noded,

imes lacerate. Panicles
: 3-10 cm, with 5 to 10
pikelets 2(3)-flowered,

58 km south of Punta Arenas at 58°36'S, 70°5
(Ortiz-Troncoso. V

Trin., and Geraniun

duding Charles Darwin.

:

1847: pi. 135).

id phenology. Deschai

Ml'-:

.., Il III , I I . . . I

Discussion. Desrhampsia kingii is a stout plant

: ■':;;,:■

Fuego represent the typical form, while the

The type locality mentioned in the protologue (Port

■ ■ < i \U-y I ).■:■■!
■

:

I ;■ I .■ I - . ,.V:> I'M.:- :

■ ■ .

:.

:

• l , . ,

:
(SI); Patagonia Australis ad Punta

i kill

Punta Arenas, W. J. Eyerdam et al. 24

. : . " ■ ■ ■

■ i.- i - i

!.■ ' * i..-i.- ( „. : "•

Perennial, delicate, culms 50-90 cm tall, 1- to 4-

15 cm, with 6 to 11 verticils, panicle branches up to
12 cm, scabrous, grouped in the base of tin

een to whitish,

Chiapella & Zuloaga
Revision ol
Vahlodea

i i Hi; li
, 1 1 i I i II i i i i I ' I

- 1! III.

2-3 mm, hyaline

membranous. I

s. Anthers 1.5-2 m

aryopsis narrow!)

fusiform, 1-1.5 m

Nicora (1978: 230).
Distribution. Deschampsia laxa occurs in the

. ■■■!<:: !■(>

II

Discussion. Deschampsia laxa differs from D.

■ :i H! ;' ;i:i<i ;,,

i'l In III, ill I l III I

. II ,1 II „, ill ,„
;] MMi;' »; u ; (:■ :.;.■ ;

;i!M ,i :',•» I :■ i

•i (SI); "Patagonia," s. loc, A. I

■ ^ :: ,,',,!l A,,i :„,r
l.i I i

m;.. ii J 'i ■■■: -( ■ i: r .■ :■.-. , .. '

8: 460. 1949. TYPE: Chile. Santiago, Batuco,
500 m, 17 Sep. 1936, G. Looser 3439 (holotype,

»ser 2049 (hololype, BAA!).
Annual, delicate, slender, culms 15^40 cm tall, 2-

I ' ; i M. :,.;■.

:• i • in x ■.:■ ■;-

• \,:U\..

f contracted, 4-12 X 1-4 cm, erect or nodding,

lower branches adpressed and

d in clusters of (2)3, moderatel) to densely

us. Spikelets 2-flowered, pedicels scabrous;

• I II

.

■:ll Il>' r. ,;.....■■ ,ii

I I; > I

•ted in the upper li ill. -! < - nn mini i I

i.:--. 'M [; ...•>!■■■

ied, t\\c. lateral teeth are prolongations of the

wis ted in the lower half, 7-10 mm, inserted in
ddle of the lemm;

i the keels. Anthers 1 to 3, 0.5-2 mm,

Parodi (1949: 462).

•:m. Deschampsia

. i | . . i i ,

■■..:• "!„ ■■,r r ,l; 'i

ber and November.

Discussion. Deschampsia looseriana and the other

I i

■ i".

i . II, .. ■ i II

(Campbell et al., 1983) and

flowers with one stamen with very reduced anthers, a

i ',' !-: !!■■;«■! I.

!HILE. Biobio Region: Concep-

!.■,■;//■■■■.■■ ■■:;.-

(CONC). Siiiliiiu. , ',, i ,„: |5 m,,,,,. G.

la dc Peiialolen, Y.

er 3718 (BAA).

i "

8: 447. 1949. TYPE: Argentina. Men*
de la Medialuna, valle, 1700 m, 15 Feb. 1922, C.
(holotype, BAA 4685!).
Perennial, rhizomatcms. culms civet,
[he l.ase. 20-25 em tail, 2- to 3-nod<

■ ■;■ .■>:uhr. '.

■ ■

lilla pilose; lower

,.ii, .„,.;.

2-3 mm, 4- to

orange. Caryopsis

Parodi (1949: 448-449).

(culms onlv to 25 cm vs. lo 100(120) cm i

(only to 7.5 cm vs. 1

1).

absent in D. cespitosa).

Chil. (Gay) 6: 339. 1854. Basionym: Aira parvula
Hook, f., Fl. \ntarct. 2: 377. 1846. Trisetum

:
parvula (Hook, f.) Macloskie, Rep. Princeton Univ.
Exp. Patagonia, Botany, Volume viii, 1 [2], Botany

e perennial, culms 5-25 <

brous, widened at the ba;

membranous or scari

ous margins. Leaf blades 1

filiform, abundant, fc

irming dense clumps, blad

6 cm X 0.5-1 mm,

nerves glabrous on the

side, sparsel) scabr

ous on the adaxial side;

} the culm ;:

" ■ ■:■. r: - ■:<■■■:■■■■<>.. ; ,;

:

ic 2-3 mm, bi-

■: v.

■ I J mil I '

\'M* ,. Mi :

Discussion. The contracted panicles of Deschamp-

latter genus by the 4-toothed lemmas.

irvula is similar to D. patula in the

' I 1 n ii ' <

,/. Ambrosetti & E. Mendez, TBPA

• >7 .■?:.' i '. 'Mi;;. ■:

II' ,i ,, II .' ,1.:

. C.mndona 7226 (BAA); Sierra

•■.■■. ■.,■■;■.■;■; (I !■

II , i In ,
■:,.;.■:„■ '. .hi.

,u Imiii
29 Feb. 1896, \.
Puerto Abrigado, A. Castellanos 12831 (BA); I (a

. '. .

Chiapella & Zuloaga
Revision ol
Vahlodea

: / .

!■,,...-: :..■

1916. Basionym: Monandrciira patula Phil.,
Anales Univ. Chile 43: 565. 1873. Deschampsia

'.'.".".',.;/;,',' '

8: 454. 1949. TYPE: Chile. Magallanes, Punta
Arenas, 1869, s. coll. (holotype, SGO-PHIL 244
not seen, photo!; isotypes, SGO 37214 photo!, US
867651 fragm. ex SGO not seen. K photo ex
SGO!).
Perennial, caespitose, erect, culms 8-20 cm tall,
•''.- i'.' ■■■■■■>( ■ ■ : ;

/

usely scabrous,

moderately to dei clots 2-flowered,

I II i

exceeding the middle;: lemma 2-4 mm.

>.:: '■; J ,'■■:■■

the middle or lower 1/3 of the lemma, 1.5-6 mm,

ill II

dark reddish to

.■■.,■

Illustration. Nicora (1978: 234).
Santiago to Tierra del Fuego and also in tin

•■ '. ;■.!!>. II, i' m; .:'
' ' I I'V..

more contracted panicles, and

proaching D. patula.

■■..■.
:
12358 (BAB); seeeion San Anion

,-/.".. ■<•;■■:

: ■' . . ■ . • ■ ,i .■■

'i. ^im.'i i--. ,

67°19'\V, K. I'isano 5123 (SI).

14. Deschampsia setacea (

Gramin. Portugal 33. 1880. Basionym: Aira
setacea Huds., Fl. Angl. (Hudson): 30. 1762. Aira
monlana var. setacea (Huds.) Huds., Fl. Angl, ed.
2: 35. 1778. Aristavena setacea (Huds.) F. Albers
& Butzin, Willdenowia 8: 83. 1977. TYPE: United
Kingdom. Litcham Common, 18 July 1883, F. J.
Hanbury s.n. (neotype, designated by Chiapella
[2009: 242], BM not seen, photo!).

itose, with vegetative shoots densely
2- Lo 3-noded,
■

les 2.5-10 cm X 1-1.5 mm,

:

i" ' i i i ! ! ,

..■.■■ ', nil;'! I.- '
',.': I I .1:,: ,

: ■■ : I' I", >!■;', I:,'

: .1. I ■:■!: ; v -:

glume narrowl) lanceolate, (3-) 1-5 mm. 1-ner
upper glumes lanceolate (3.5-)4.5-6 mm, 3-ner

■i..... ; ii.ii' ' i

2-keeled, 2.5-3.5 mm, keels

, :i:',i: ■::■; ■ i, *\^-\\ I

Parodi (1949: 446).
number. 2n = 14 (Hubbard, 1984).

i " I
southern Chile (Parodi, 1949), but no m;ii

" : ■

and February.

Discussion. Deschampsia setacea is similar to

:.-.■ - ■ ■ '■ :;.:,•■.',■

: :

. . .

(SGO 045880).

Valle Largo, Feb. 1892, F. Philippi s.n. (holo-
type, SGO not seen; isotypes, BAA ex SGO!, US
556484 ex SGO not seen, photo!).
Perennial, caespitose, densely tufted, erect, culms

.././<■ ■■ .

> I • nil

X 1.5-4.5 cm, with 5 to 7

" '.,, ,.r!lM,
! ! Ill,

' 1- ■■■:■,!■ I,'

Ill

. . : „

5 mm, scabrous, inserted al or ne;ir

in' in i, in

. Caryopsis 0.5-1 mm, fusiform.
Illustration. Nicora (1978: 234).

;t. Deschampsia

Discussion. Deschampsia venustula and D. patula

i.".-,.-ir<l hi;

'I I 'I. I II . mi,.

10 X 6 cm in

Specimens examined. ARGENTINA. Men

> in, ,
Paso del Portillo y la Laguna del Diamante), F.

■;■: .;:■; I '. : ■.!■■■. ..

. -■■ ..■/.V'!l.- ! - '
BAB); /. Hueck 18 Dpto. Chos Malal,

cajon del Arroyo del Cruce, 36°43'S, 70°23'W, 0. Boelcke et

■

Conclusions

Deschampsia in South America comprises 15

' ' '- : I' ..' I I Mi I

c region: Avenella flexuosa an

mi i
. ■. I ■': ' i.
2000; Quintanar et al., 2007; Davis & Sur

in, ii I' ill i
II -I • ,

i "II ill. . I

is well known
(Brummit, 2006; Middleton, 2006). The dif

■ ■ Mi' ■". I ."i.."'. Ii ■.■:■: ; :,,'■

g diem in the

■.,:: ;•' .;);
.':'. nil II i II I I II ;.L ill I I II I I -..v- M-. || ill

Chiapella & Zuloaga
Revision ol
Vahlodea

et al. (2007).

■

■■ .1. and former Aveneae). Kavv,

■re almost completely, and
!■■'-■ ■ i ■ t ■ = . ■

iii oil; in i In ii i I II it I '

-> Long-distance dispersal

hose of the north. The limited
ilecular data available (Chiapella, 2007) suggest

i i "

'. cespitosa. Based
ividence, Hartley (1973) found

Excluded or Unci:

Yigenl. \

brasiliense Louis-Marie, Rhodora 30: 242. 1928 [1929].
TYPE: Brazil. Rio de Janeiro, Alto de ll.al.iaia, dense

toothed apex. The plant has

described for Peyritschia E.

(2004). The spec risen and Ulloa

'I. collected in

:

ii

i i 1 i ,, i I I ! I , i

197 (holotype, SGO PHIL 197 nol seen. SCO pholo!:
isotypes, BAA fragm. ex SGO PHIL 197!. IS 556494

i ; r; .'.[,:■; i . > ,

have no awn or 1 • are ca. 10 mm

wide in South America

1896. TYPE: Chile. Coquimbo, Enlrada de Tililo, 7

(.!■ I

photo!, SGO 63067 not seen, photo!, LS 865603 fragm.
seen, photo!).

The specimen conserved in BAA is a complete

■ ■. i- !■.:!: ■■■■; !■
1-1 m I

I! II i I I .In I I mil ill C II II

i II I II i
il ' !

In I '111

Agron. 8: 127. 1941. Basionym: Trisetum conferlum
Pilg.. liol. Jahib Sns|. 25(5): 714. 1898. Peyritschia

Rugolo (1986) for Dejei

Beitr. Biol. Pflanzen 48: 1-62.

. l')721, i

Subtribus Deschampsiineae Holub (Tribus Aveneae Nees).

i l.'i i • ■■■:■. .' ■

DeuUch. liot. (;es. ;:

' ,■■..!.■,■, vii'i l:!: - in,

. 1980a. Sm

denzen der Subtriben Arislaveninae und Airinae (Gra-
mineae Aveneae). Pinion (Horn) 20: 95-116.

I' '•.
Subtriben Arislaveninae und Airinae (Poaceae-Aveneae).
136: 137-167.
. 1980c. Kan:

) & J. R. Gutierrez (.
i de Coqui

central Chile. J. Ecol. 69: 205-223.
-
2002. Analysis of the contribution and efficiency of the

(COTECOCA),

, (:■ i!lo:|

Gebirge, Persien, Afghanistan, Teile von West-Pakistan,

■,!•■ ::<!-. ■nli-,c
Deschampsia-Atien. Pinion (Horn) 1: 190-193.

,1 In, II II II

lia 27: 239-242.

;: Aveneae) with special reference 1

. 213-228.
30. Deschampsia. Pp

.i

Clayton, W.' D. 1970. Gramineae (part 1). In E. Milne-
Redhead & R. M. Polhill (editors), Flora of 1.

Africa. Crown Agents for Oversea Governments and
ons, London.

it. Ser. XIII.

', I.:,-,-!. HI:

Teil 3. Parey Buchverlag, Berlin.

thol. 1: 159-187.

lolmgren. 1977. Intermounlain h

ss, New York.

[ . | (>; ::■■■.

994. ifca*™^. Pp. 888-999 fc G. Davidse,

'

Vol. 6: Alismataceae a Cyperaceae. Universidad Nacional

Aulcmoma de Mexico. Mexico D.F.: Missouri Botanical
Garden, St. Louis: The Natural History Museum, London.

■ i I
imidamental units of biological
taxonomy. Svensk. Bol. Tidskr. 24: 333-428.

Beilrage zur Flora der Oslkiisle von Patagonien. S\enska
Exped. Magellanslanderna 3: 77-264.
Kinol. V. L.. P

issouri Bot. Gard. :

■?.i >

;7: 888-900.

Wellington.

■ ■-■■■\'--\\ ■•■■•'■■■ !■;

Bot. J. Linn. Soc. 134:

it. Geobot. 7(Suppl.):

Carvajal, J. A. Fernandez-Prieto, A. Roca & R. Giraldez.

I ( > ( >7. Diversity and systematic s oJ Deschampsia sensu lalo

. : : 10.
,. I n II I

in the amphi-Atlantic plant Vahlodea
(Poaceae). J. Biogeogr. 1J

■■<U->,.,: ..

I MUNI: .I'- . ' . I .

;ent. 86: 121-188.
Jepson Manual: Higher Plants of
California. University of California Press, Berkeley.

:
Thompson. 1 909. Vascular Plants of the Pacific Northwest,

cotyledons. University of Washington Press, Seattle.

■•■

Chiapella & Zuloaga
Revision ol
Vahlodea

= :■■■■ ,::

H.M. Discoven ships A>/;//s and Terror in ihe Years
1839-1843. J. Cramer (reprinted 1963). Weinheim.

II M ■ ■ I' ImI

Identificalion, Uses, and Distribution in the British Isles,
3rd ed. Revised bv .1. C. K. Hubbard. Penguin Books.

Lund.

. 1968. Flora of Alaska and Neighboring Territories.

I ii iwrsity Press, Stanford.

Reports No. 34.

. J. Bot. 41: 719-742.

idies of line

« Plantarum. Holmiae, Stockholm.

Princeton.

Hawksworth, K. Marhold, D. H. Nicolson, J. Prado, P. C.
Silva, J. E. Skog. J. II. \\ i,.|s,-iiw & Finland (edilors).
2006. International Code of Botanical Nomenclature

: 502-506.
vascular plants. 1. Names published by G. Wahlenberg.

in VI. N. Con-ea

(editor), Flora Patagonica, Vol. 8(3). Instituto Nacional de

& Q. D. Wheeler. 1990. An amplifi<

.. \ 16th century Hispanic

ill les caraeters de tous les genres. Paris

(VI).

Deschampsm. Darwiniana 8: 415-475.

Linnaea 29: 48-95.

. 1864. Pla

mclusis quibusdam Mendocinis el Palaaonicis. Linnaea

33: 1-308.

.1 ll Mil 1 1

Anales Univ. Chile 43: 179-583.

94: 5-34.

specimens from the voyage of HMS Heagle. Bot. J. Lim

Rugolo de Agrasar, Z. 1986. Las espccics extrapatagoi
del genero Deyeuxia (Gramineae): II. Morfologia c

Rzedowski, J. & G. Rzedowski. 1990. Flora Faneroga
del Valle de Mexico 2. Publicaciones del Institut
ilichoacan.
Soreng, R. J. & J. I. Davis. 2000. Phylogenetic slruclu

(editors), Glasses S\

wealth Scientific and

Collingwood, Victoria.

, & M. A

J genes

:

!;>n. '

use, Leningrad.

■ n "

van de \ ouvv. M., P. van Dijk & A. H. L. II

is in Antarctic hairgrass
(Deschampsm antarctica Desv.). J. Biogeogr. 35: 365-376.
Vigo i Bonada, J. 1983. Flora de la Vail de Ribei

i one collector. Specie

a antarctica E. Desv.

a cordillerarum Hauman

a elongata (Hook.) Munro

a kingii (Hook, f.) E. Desv.

a laxa Phil.

11.) Pilg. ex Skottsb.

Suds.) Hack.

a venustula Parodi

: . ' ■. ■ . ' ' ' ' '. ' ■. ■

-s ] 047 (15).

: :

/-V/jjp/ n./i.(4j).n./i.(7i

Garaventa 544 ( 1 Gehrling 109 (4a);

Goodall 4700 (8); Grandjot 15a (2), 3486° (4a); Greene 3058

; . .

:
Jam s.n. (7); /fc 3623 (5), 4743 (14), 6073 (3); Johnson

:';■ :"•'! .',/ ."•

KaZeZa 2027 (8), 3 (7); Koslowsky 142

■0991 (15).

1485 (2).

■.. -i,,../.;,-.-

7349 (2), 1654 (1 2), *WJ (12); Moore Jr.

3126 (7); Morrison 174,

I 1-64/7(2).

,'J (1), s.n. (8);

."■• ..„,■„■

' ■:■ .-:. ' ■:.-.■

(2); Ryves 96/081 (3).

Saratoga Michel 3411 (7); Scft/e^eZ 2590 (4a)

U)2 (1); Spegazzini 20701 (12).

. ; ■
W/7/(^v.s- .<./?. (2).
Ulibarri 1067 (2).

A TAXONOMIC REVISION OF
RHODODENDRON SUBG.
TSUTSUSI SECT. BRACHYCALYX
(ERICACEAE) 1

i I".' .■■:■.' ■. ■:■;,

well known as a

about 1000 specie: leumer (1949, 1980) recognized eigliL sub-

1996; Fang et al., 2005). The Sino-Hin is: relationship of

■v^ions are flower buds and leaf buds,
',-ni Sichuan. and lepidote or non-lcpi ..

nera. Cullen and

i I ', !l • I . -II i i

widely (Philipson & Philipson, 1973). In terms of

: iM. '.■ ■;!:■■■ .

problems (KurasluV

■■■■■, ' ■; i M

U ', ii i ■■■.[.'
; '. " , „ II! ,i ii I

'

<:':i ' !.::•" ill.- i,i I,;--'. i|.i-;' •• ' ,: I I : M 1 , ' i II '

sections. Hooker"

'This work is , u ,, f». The author* are

ITC. II

Jian, Yu Sheng-Xiang, and Xu Xue-Hong for providing some lile,, > I lie locality' names in

310036, People's Republic of China, docxfjin@163.com.

.■•,,■■ ■ i ,1 . ■

. . ■ i
i .■.!!-■>■:■ :■.[ \ . . .

"' ; '';-iC ' I M -.■■■■ '. Ill . ■■:■! Mi: :::■ :!!■...

M

7/2007139

5S0URI Bot. Gard. 97: 163-190. Published on 9 July 2010.

i>h;vrw.. :)<:.■.

■.:-'■. II:.. I'.") I,

li -u.

lain, 2005). Willi 1). in .4 1/ono-

.'!

(Yamazaki, 1993, 1996). Nakai (1924, 1927) posed

third section to be established, had evergreen leaves

Ji'-i ..'.-ir-r. .•■■■

49, 1980). Spethmann (1987)

i relied :■.[!:■■

:■' ■ '■' i ■;■■■

i// IE. II. Wilson & Rehder) T. Yamaz
(Table 1).

During a recen

.r was able to

i. ml that it was

analysis of matK quences revealed

'In . h
farrerae and R. wadanum Makino (kum-

...

this taxonomic view as well (Gao et al., 2002a, b).
Brief Taxonomic History

|, I ! Ml

(Cullen, 1980). Don (1834)

. ex G. Don in A

Japanese; plants (Makino, 1917, 1926a, b; Nakai,

. -,.ll.: II -.UM

■■■■■••>'•■ \< ■ • '•

In Flora of J apart was very similar

to Hara's, but son is were neglected

:

broader-scale understanding of the Japan*

(II 'ill

■ . f ; liii' -■!■

stem (Yamazaki, 1981, 1984,
1987a, b, 1988, 1991, 1993, 1996).

■<■■■<■•■ ■■■"■'■ 'I'.' '■

l.'insl. & E. H.

'<'i!|:.'.rirr

northwestern I In

Hayata (Hayata, L996). Tam Pei-

C. Tam and R.

■ : '.-in. [■■:■.■■:!.

Jfjl

V V

f f

I ^

3 5 8

nu

tj

jjlj

ce two collections were cited as type (Ding & Jin,

05). Further examination of the type and observa-

n of seed coat and pollen revealed that R.

adingense should belong to section Pentanthera

1993, 1996),

Don (Jin, 2006). Ding and Fang (1989a) also

med a white -flowered form of R. mariedi when they

rveyed the rhododendrons in Zhejiang, eastern

i V( ,yrirhii. R.

ina. Kurashige (1999) published R. chilanshanense

Heeled in Taiwan.

: herein recognized:

locality rather than a comprehensive

sparsely soft pubescent
taxa); and (4) glandulai
times with sparse sof

,■ ■■;■!. ,'■■■;,■.'. ,■■;■.■

'.hi, II ,: II ■'

>, :■' > , III, I--. : I •

III .1 I ■ ■::! ■

,1

gland. Leaf-
margins are minutely c

Is of Rhododendron
that seen for petioles.

■ il"

.'•' ! !i:-.;-.'

1 1 II,

hyugaense (T. Yamaz.) T. Yamaz., R

nukusaense (Takada ex T

■T I-'I/,. ■ ' ■

revealed th

reliable, a

2 -flowered

■ ■•■.:,,::■ ' i •'

1984). Flowers of three species (R. sanetum. R.

Revision of Rhododendron s

lobes ca. 5 mm

diam.), with the lobes inconspicuous or slightly

i dors are variable,
ely white. Most species have da]

;■■...■■' ..' ' rr-,. i ■

Stamens are five to 10 in section Brachycalyx, with

' ' :

The stamens are generally unequal and ,

I!

■■ ■ ■

',■■...■■:;■;.■...

1994; He & Chamberlain, 2005), but Fang

(Ding & Fang, 1989b).

idendron sect. Brachycalyx are 25-

than or equal to the corolla in length. The stylar

. :

' ' ■■.:;:■.;'. I. '

i the lower half.

1 I II ii|'. ' II

II
II ll' MC> lllllill I in III I i I I ,■}:.<.: ■ :

■■•;
pubescent, some! ill Lrichomes (e.g.,

shape of the capsule

. Brachycalyx. Capsulet

hyugaense and R. quinquefoli

;■/;;>.'- ;■;(■.'.■■;,',■

:• ■ IK'iiii

this section are otherwise sparsely or dense

!i i i i "

uia (B, CCTM

CDBI, FJFC, FMP, FNU,
GXMI, GZTM, HGAS, HHBG, HNNU, HTC, HZU,

3, LBG, N, NAS, NF, P, PE,
SCFI.SZ.TI. I'\

Descriptions for

specimens, ll was not possible to examine

;

In" 1

<> ■"N )'-i.

■ll I ' i h'CI /.

corolla or capsule apices. Corolla colors v

are recognized lazaki's concept

we recognize only
subspecies concept embodies a geographic;

».'-T .I::"; ■■■! ■

better suited for horn

gun or -yama/mura, respectively.

Trees or shrubs, terre
indumentum various (s<
peltate scales, glabrous,

al., eds.) (ed. 2) 3a: 35. 1993. TY

..I. ■.-!: .; :

relirulaliun D. Don ex G. Don [= Rhododendron
Vile ex Sweet].

; '■.'..' ': , I )■■

ie cx Sweet.

552. 1949. Rhododendron subsect. Tashiroia (Rehder)
Spelhmann. PL Sysl. Evol. 157: 28. 1987. TYPE:

1): 43. 1922. TYPE: Rhododendron reticulatum D. Don

and trianguh
nes reduced to a rim; cor
funnelform to campanulate, occasio:
panulate, regular or slightly zygomorphic,

i • Ii i' ii

II i "I" I il

■ ' ' : \ ill <l I

ml moving down,

■ '; Iiri ! l!l|.';ll

■■;■■■., ' ' ; ■ ■

without appendages.

Rhododendron sect. Brachycalyx Talc

i i I !

Syst. Evol. 157: 28. 1987. TYPE: Rhododendron
farrerae Tate ex Sweet.

al, eds.) (e<

weyn

deciduous or evergreen: shoots verti

or pubescent. Leave

is, glandular, villose,

t when young, glabres

same mixed buds. Inflorescence 1- to 4-i

..."•■: i - i. I ' I i I'll"!

II ii ) I , ii ' i

E. H. Wilson (Wilson & Rein
79) and Azalea si (Rehder & E. H.

R. quinquefolium

■

> Spkciksof Rhoi>i)I>e\I)Ro\ -

Revision of Rhododendron s

i

■

10, J. Jap. Bot.

. ■■■ i i ..,..■ | ;■ ii <> !.■■

suka City Mus. 15: 23. 1969. TYPE: Japan.
Honshu: Prof. Idzu, Ml. Amagi, T. Makino s.n.

1932. Rhodr

ai) Hatus., Sci. Rep. Yokosuka City Mus. 15: 23.
, syn. nov. T, PK: Japan. Honshu: Pref. lae, June

1996: 89, TI!).

.'.;■■■ ;.■";>:;■/:

Gen.

. Honshu: Pre"

Shrubs deciduous, 2-4 m tall, sometimes to 6 m;

i, . . I! 1 1 mi I i

I i II "

5-8 X 2.5-7 cm, acute or acuminate, with an apical

dorsally glahrou

I I ',}■ 10 nun ill Ca ;,\ I II III i| I c;l

lobes inconspicuous; corolla

35-^5 X 40-50 1. [, Lube 10-15(-18)

ii

oblong, 25-32 X 13-20
purplish red spots at bas

mis or sparsely

I <

-.-<■:.■; ;rr:-.::h , ;■■■

Lricted to Izu Oshima and I In
if Japan. It grows in forests at eh
300-1000 m above sea level (a.s.L).

■ ■ ;'.ns--' *■:■■ I I

I in .■ II I!

ence. In contrast, the petioles of R

i u, II

the flowers open before or with the leaves.

Rhododendron sanctum was published as a new

i try smaller, with

, ''^' i ii

'.' . ■ ' , •. ',■ . . ' ' . '

: ;; ;. ;ro>i!.; ;■
I." i -ii

Considering the similar

■. ' !i i <:,)

Revision of Rhododendron s

m .■ :

; ■ "."'. : : (!■ i ■:<.<■:■■■■
: ■ vi .1

2. Rhododendron chilanshanense

urgh J. Bot. 56: 75, fig. 1A-F. 1999.
TYPE: China. Taiwan: Taipei Co., Mt. Chilan-
shan, 22 Oct. 1992, ETOT 136 (holotype, K not

. V;|'

Shrubs deciduous, to 2 m tall; young shoots with

I i_ ii | i i

.. , '■ ^ > \ 1 ..:>

in "i i i Inl i hi inn iiinii \ I i } ;h ■<:. .

■'.'. ;V il.'.li ■.

■:■■ .■,« <■!■;•;■;■ -
or 3-flowered; pedicels 5-7 n

I I | II i I I !'

I I I 1 , III null'

• .,:.H :■- ■■

27 X 7-8 mm. u

base; stamens I II in length, 10-

21 mm. with ghinds and mixed with sparse pilose
trichomes on lower half. Mature capsules not seen.
Distribution and habitat. Rhododendron chilan-

■■;::<.<;■■:■:..■ u

Phenology. Rhododendron chilanshanense flowers
in May (He & C with the flowers

Discussion. No material was available to the
vas verified onh from the
lire
1999: 75, fig. 1). The author who d<

;■■.-.'..■ -.' ' II l'!i;

is similar to R. in

in synonymy; they share the s;

1999 protologue by its
nd deciduous leaves, and

!■■ V H : I 'II. '., ,. ',; MM. I ■.■;>.. ,

i II I i i I II

Ann. Mus. Bot.

' ':■■ ' ' <V' ;■■:■'

■■!■■ ■;■■::■! I; ■. Ill ,1

X 1.5-4(-5) cm, acute or

midribs glabrescent or sparse!) I ii n

i-n. ip ii'

: I- lull i -

' ' ' "■.'■':!■ i 1,. Ii-'!.!: . .■■.!!■■■■

mi, I , III I

30 mm, deeph 5-divided, corolla tube 5-7 mm,

Ii I i

I I ill

sometimes sparse!) pubescent;

■■■■' -hiiih. '

' ,.. VI: IVIIVI'.,

seeds 0.9-1.9 X 0.4-0.7 mm.

. . .... .

> ("ill |i |i; III',

F Rhododendron sect. Brachy calyx

Figure 3. A-F. Rliodr

;::;:! " .

G. H from X. F. Jin 1415.

:
Discussion. The typical subspecies of Rhododen-

AddlUona! specimens examined. JAPAN. Honshu: Pref.

.:
. . ■

Iwatsuki 529 (KYO) j . Ooyada, from the

; , v:..-, : .':..,',- ,,.-

1662 (KYO); Tano-gun, Manba-m

-I... ',K:.M,. • ■

r. ui ;<,:.,;>■ . ■■

. MM.,,/v,.',,

1169 (KYO). Pref.

, „ l„. I! ,. M

:

., Yakei
s.n. (KYO);

i, , M ii

;

:

' 'il

(11); Tano-gun, Ueno-mura, T.

,1

Kazumi Tsuchiya 536 (KYO).

Urayama-keikoku, H. Ohashi el al

I III. I ,\ :

"... , Ii,! ,;■/.,.":;:.. MM . i; M

I.I

iga-gun, K. Morinaga 3204 (TNS): Ni

. (TI); Fuji-gun, Kamiide-mura,

u s.n. (TI);

(Makino) X. F. Jin & B. Y. Ding, stat. nov. Basionym:

iij. var. decandrum
Makino, Bot. Mag. (Tokyo) 7: 134. 1893. Rhodo-

21. 1917. TYPE: Japan. Shikoku: Pref. Tosa, Ochi,

I II i i
MAK not seen, MAK photo!). Figure 3G, H.

H. Hara, Enum. Spermaloph\ larum Japon. 1: 20. 1918,

pum (H. Hara) T. Yamaz., Fl. Jap. (Iwatsuki et al., eds.)
(ed. 2) 3a: 33. 1993. T\PE: Japan. Honshu: Pref.
Wakayama, Aritagu.i, Vll. Yawata. 27 Apr. 1935, 5.

-loUpe. KYO!).

drum Makino var. pilosum H. Hara,

II MM !

I":- '.M::MM I .

s.n, (hololype, TI!).

Obsumi, Tatakumayama, cull. Tokyo, 1 Apr. 1980, T.
Yamazaki 2534 (hololype, II!).

1974, syn. n

Hikkaido: Hidaka, Maruyama, Shoya, 1 1 Sep. 1.974, H.
Hara et al. s.n. (hololype, TI!; isolype, TI!).

1939, N. Inobe s.n. (hololype, TI!).

Revision of Rhododendron s

2): 509, 1972. TYPE:
, S. Sako 3384 (lectotype,

Japan. Kyushu: Hyu

p«l here, TI!).

/.■;■■■ '-■.-:.■■.'■:

-::■... ■.. . .
;-.v-/.;Y Y.v ; - '
Mus. 15: 21. 1969. T\ PE: Japan. Kyushu: Pref. Osumi,

(holotype, TI!).

fakai var. amah
Yamaz, J. Jap. Bot. 59: 208. 1984.
amah e i e (Takada ex T. Yamaz.) T. Yamaz., J. Jap.
Hoi. 62: 72. 1987. T\ PK: Japan. Kvuslul: Isl. Amakusa.
24 Aug. 19,

18. 1984, Rhododendron hyugaense (T.
Yama/.) 'I'. \am,]/.. J. Jap. IS..I. <»_>: 72. I<«J7. I ^ PE:

Shiono, 11 Sep. 1978, K. Tab-da 89101 (holotype!

Caly\ dcn-ch to -par-rlv glandular, sparsely

I | I ' "

is: stamens (8 to) 10, unequal

Distribution and habitat. Rhododendron dilata-

! In; :■ i. 'I- :'!'■:■ !:■ V '

in forests, or on slopes at 100-1400 m a.s.l.

Phenology. Rhododendron dilatatum subsp. de-

■ ■ . ' n:l

September to mid

Discussion. Subspecies decandrum differs from

any (10) stamens (sometimes on!

'' ' ■ I ii

of subspecies dea i hern than that of

differ in both

According to Articles 37.1 and 37.2 (with Art. 8.1)
(McNeill et al, 2006), a n;

.•:/. ■..,■, ■■■■■■

■ . . .

combined as R. viscistylum var. glaucum in

U-\,\: : ■<■<! .' M
■ '■ Ml-.'

lectotype for the formal appli

Additional specimens examined. JAPAN. Hokkaido:

' ' ' " ' . . " '

, Sinya Miyake 6330 (KYO), N. Fw

/- . , ! ,: ■

:■.

I ! i

Watarai-gun, Ichinose, Kawakami, T. Magojh

■ . ; .

j Ik II otako, G. Murata & K. Iwatsui,

,:ahi el al. s.n. (TI), G. Murata
,l,i: l/umi-shi, Mt. Katsuragi,

. .■'■■.■'..■,■,■,; ■:...-
'..

' ■ ' ^ ...... ,-■.'■;,-,..-,,,,■■.■■

:

I!: " :■- "-■ .

/.:■ .■...:.' ' r. ' ' ' ^ '.

: .

:-i-:iln.. I in

.

Nishimera-gun, Yokono, K. Takada 89106 (K

.,,.:.■::. 'Vi'ii-i. '■•• ' :

.■ ■ ' ■

(TI). Pref. Kagawa:
Isl. Syodo-shima, Kankakei, G. Murata el al. 191

■■■;}.■<:..■!. : :■:■-.

■7" (KYO).

t Sweet, Brit. Fl.
Card, ser 2(1): tab. 95. 1831. Azalea farrerae
(Tate ex Sweet) K. Koch, Dendrologie 2(1): 178.
1872. TYPE: tab. 95 in Sweet, 1831, based on "a

mi in! |Im mill I i. in ,i,i I. i
Farrer in 1829" (holotype, Sweet, 1831: tab. 95).

Rhododendron cinereoserratum P.

Harbin 2(1): 77. 1982. TYPE: China. Kujian: Nanjing
Co., Huxi, Amoy Univ. 20 (holotype, All!).
Rhododendron daiyunicum P. C. Tain, Bull. Bol. lies.,

II mI.iii ) I

P. C. Tarn. Siirv. Gen. Rhododendron S. China: 28, 96,
1. 22: 3. 1983, nom. illeg. superfl. TYPE: China.
Eujian: Dehua Co., Ml. Daiyunshan, 20 Apr. 1975, L.
K.Ling 3140 (holotype I

MM, ■/.■..■:■■./,■■;■

Franch., J. Bot. (Morot) 9: 394. 1895. TYPE: Chin,
ed here, P!).

MM

1910, T. Nagasawa 239 (holotype, TI!).

, m Miq. \ar. hho.su

ill i

liikoku: Pref. Awa. Ml
Kixosumi, 22 Max 1929. D. Suzuki s.n. (lectotxpe

'l

i •;.-.■ ; .,, ' ■ '

i mi. Sperm. Jap. 1: 78.
1948. Rhododendron reticulatumD. Dou ' Don u

Sep. 1925, 4. Kirnura s.n. (holotype, TI!).

M M.,/. ,M .,,,•. ■ .

Inform, ken 1007(6): 211. 1907. as "Maiicsii."" sx n.

-a. Hubei: western Hubei, Apr. 1900,

E. H. Wilson 29 (leclolxpe. designated here, P!;

not seen, W!).

,''. v, ■:■..,: ■■

Ding & G. R. Chen, J. Hangzhou Univ., Nat. Sci. Ed.
PE: China. Zhejiang:

>■■:;,. mm, : ,„ i : .

3825 (holotype, HZU!).

M

Geobol. 25: 37. 1972. Rhododendron viscistylum Nakai

Mhpe, KYO!).

;.'■■■..,/,■../.,.■/,■.. ■ . .

'". M .. . .

Japan. Kyushu: Pref. Kagoshima, Aranishiyama, 21

July 1978. K. Takada s.n. (holotype, TI!).

' M M ■..:..

(holotype, TI not seen. TI photo!).

MM M'MMMM:

turn D. Don ex G. Don

:

Ml. Aso, 19 : .

:"Mmm/':,:mm'm

Jap. Bot. 59:

kulshu: Pref. Mixa/aki, Ml. Kirishima. Sonoura. 27

Aug. 1972.

J. Jap. Bot. 56: 363.

lagopus Nakai var. niphophilum (T. Yamaz.)T. Yamaz.,
J. Jap. Bot. 63: 410. 1988. TYPE: Japan. Honshu:
Oziya Shi, Oziya. cult. Tokyo. 18 May 1974, T.

h'raaz.. J. Jap. Bot. 63: 110. 1988. TYPE: Japan.
Shikoku: Pre!. Axva. Mixahama Sasaloge, 14 Aug. 1941,
lolotype, TI!).

lagopus Nakai xar. hurugisanense (T. Yamaz.) T.
Yamaz., J. Jap. Bot. 63: 410. 1988. Rhododendron
amaz., J. Jap. Bot. 66:
125. 1991. TYPE: Japan. Shikoku: Pref. Tokushima,
Mt. Tokushimasan, 9 Aug. 1976, T. Yamazaki 1128
(holotype, TI!).

J. Jap. Bot.

nov

culatum D. Don ex G. Do

syn. nov. TYPE: .

gien Garden, 22 Ap

r. 1959, F. Yamaziki

e, designated here, TI!).

Rhododendrc

IfeticultiumD Dcfr

^onTlifoZn

TYPE: Japan. Honshu: Pref. Yamaguchi, Yoshikigun,
Higami, 17 June 1895. ./. Nakai s.n. (holotype, TI!:
isotype, TINS!).

Yamaz.. J. Jap. Bot. 59: 209. 1984, syn. i

II ., , ii hi

el al., eds.) (eel. 2) 3a: 37. 1993. TYPE: Japan. Shikoku:

■■in ala. J. Coll. Sci

Tosa. Takaokaguu, Kiyama. 21 Oct. 1942, T. Yashi-

■ ■ ■ . r,i ; -■::

Nantou Co., 12 Aug. 1902. T. Kairakan

■■■:■ ':iA ■,.,,.

nov. T\PE: Japan. Honshu: Pref. Nagano. kiso.

nudipetiolatum T. Yamaz., J. Jap. Bol. 66

In

syn. nov. TYPE: Japan. S

1983, C.Abes.n. (holotype, Tl!).

H. Lev., Keperl.

,iiio& \,. mi .l„): 890. 1931, syn. nov.

Regni. Veg. 12: 102. 1913, syn. nov. T

i-hCi: I'i.I -l.izouka, Shidagun, Mt.

Guizhou: Pingfa, 2 Apr.

Hanashi, 10 June 1930, D. Shimidzu 2 (holotype, TI!).

E nol seen).

'■: ■ "i

■■■■'
icf.'i ."i I:-: ■.■..; ■

,ii |. . i

' ..i ,
silky pubescent on Ix.lli m..L.««-. uL.I.i, m «m.I <.i (He, 1994; He & Chamberlain, 2005), R. mariesii is
,].'■,,:.; • i.; ■..;, ; - ;u i r.-h : r .

reticulate on dors;

differs from R.

1- or 2-flowered; pedicel- 5-101-12) mm. with In-own mariesii in ha \ lobes 5-6 mm in

villose indument. Calyx bowl-shaped, ca. 3 mm diam..

mi. 22-35 X 30-40 mm & Li 67. Lin on collector 82075).

5-divided, tube 6- n (2005) reduced #.

■■mrifsii. and herein
ly oblong, oblong-. , 15-20X8- this name shi of R. farrerae.

12 mm, upper lobe;
without spots albas, >'<- taxa. Miquel,

1-2 mm; ovary ovoi.

glabrous. Capsul

cal, 10-15(-18) mm. 4-5 mm diam.. <lei iraf surfaces, the

,; , ,,;

of the leaves

is distributed I'm,,, vnspecies from R.

China across lh i. farrerae.

Guangdong, Guangxi. Guizhou, Hebei. Henan, Hong Rhododendron farrerae \ar. leurolrirhum was de-
r.o i.;>:. i !i« .<■ .

Sichuan, Yunnan. - i- aUo in , (l( . prot ologue. Consequently, the name of this

.iijapan.lt umel) b 1]ol cording to Articles
grows in mixed fore

Nomenclature (McNeill et al., 2006). The two syntypes

Phenology. Rhododendron farrerae flowers from w ' !lt we were onl y able to examine

late March to mi, I "' [lus liame ' the

before or with th ; m S°° d COndition '

from September to November. 1S ^signaled as the lectotype.

■■i-iic-:.!- ,. ,|| ,| ;; , ■•.

.■j--i- ! . i i " ■' " ■. ' i: , , ■;,,...

mined as R. mariesii, which was noted to differ 29 as lectotype and the remain)

10 mm in R. farrerae, and the petioles and leaf blades iculatum was described by Don

Don indicated that

' ■ i

■ ■--'. ■■■■■ ■!■■■. i ;.-. : : . ■■

n order to validly

Revision of Rhododendron s

ed at TI, has

i 1 1 • 1 1 II i i i i I ■

designated here as the lectotype.

I ■ M I I..I1

■ ■-. C-, ■■) ;;. .:.

■:.;■■;•. ! . ; ; •

' ; ■ ■ :-\.,... ..,,'

Areore. IS05 (PE). Shucheng, Mt. Wanfoshan, M. B. Deng & J.

(FJFC); Yanghou, L. A. Li 7. i

■, ■ , ■ i ■

I>. /.:■,:.',...■,

(PE); Yangzhuang, M. Suzuki el al

' ■ ., ii, r. .:.

:

■ .

Siqian, Anon. 80111.'! (FN I ). Hua'an, Wenhu

■ , ■ • , ■

!i. , i ! I " • >,..

MM. I. II

" ' 1 ! ) ">.-'
1

10163 (FJFC). Shaxian, Maixie, P.

Yanyang, Zhangda Yong'an, Luofang,

!); Shangping, Anon. 1173 (FJFC).

mi'mm \. '
;:■::;/ ;i.v7 .:■'■■

r. rsarcg 20507 (IBSC, N, NAS, P, PE); Wenquan
C). Dapu, Mt. Damaoshan, W. T. Tsan,

. . ' ' ■ r: , ; i:!; :;

:...■■,< >.. I, ,■- . ,

II,, m ■' I i : ■

III „ II, I, I

:

M, I

■■,■■.!, li.„-„ , .

;. : .; >, i a-

:m i. ,..,.,„

: ■ ■ ■ . .

..-.■.■' :■ : 1 1 -.-

■■-, :'i; ■■<:.)

50 (IBSC). Wuhua, Changbu, Mt.

' ,

; :

.ii.:i.ir r::,:.
'.",,,,, .v,:...
. ' I '.. ' '

;

king Exped. 894038
i, Peking Exped. 895118 (PE). Jinx
Mt. Shengtangshan, Dayaoshan Exped. 12440 (

-:■ ■ .. • ' : "

: '. ■■iir i -,,,K'i,.

;...-:■ ..-,•■■.■. ' '

:

....,:., .■:■:.■■■■;.
(IBK, IBSC); Ml. B soong 81621 (IBK).

:

V ill .i

>'„■.,:..,.■ ■'>.':: . .

! ■■',.,■,.■■■.■/

1

" I

■■.■..-./. mm-
Tongren, Yangtou, Jiulongdong,
' . . . ■. . ' ' ■

l, s. loc, Z. X. Zhao

. ■'■ :•:.■■; I !■,:,

:< r MM.M

.urn. 2027 (1HSC). Henan: Lush,

In, II „ I
!!<:.:;■;, r-.;,: . .

Bureau 969 (PE); Miaozi, Henan Exped. 1834 (P

12600 (IBK); s. loc.
initio IslundS. >

'^ . ■' ' . .' : . I--

". I; ':■<>

777 (PE). Ea

( .!;< .'... IT.) ! • :

; .1,

F. S. Peng He-833 (PE), R. H Huang 790 (PE); s. loc
Wang 6203 (PE). J K . B. Lin 8

Junxian, Mt. Wudangshan, J. Q.

' .. " . '• '

■■"■ :.■:■■: ■ . • •

/ (PE). \\. ■

: : - .!,.■■ ■

' • . ' " ':-..'. "... .". .'..'

Zhangjiajie, Central-South For. (7

:

.h.ui. W ma.

- II I i ,

Cangjingdian, Y. Liu 338 (WAS. PE). Ningyuan

IK), Pingjiang, Mt.

ulii ! . )

Exped. 87157 (PE); £>«i i286 (PE),

Wugang. Wuhan. \eg. /n/W

' . . .

: ' ' ■;>,.■:; ; . i

. ; : :
(PE); Wanfeng Foreslr> Farm, Z. C In,

...,;-■:. ■■-■■-■■

. '.' . ■;:.,, ,■.■'.'■■■■

(NAS). Danyang, s. loc, Nanji

: • .'...-■/ ;■■!■■!.
:

■' l 11,11;:'::.. IT.

:

. -.;.■:.,. .'.. :..
.

: : :

Urn i „ vii. I m I, mi ' /. - , T. •■"

' . ".,::,

al. 400787 (PE); Mt. Huanggangshan. X. Q. Huang 235 (NF),

I M Ml

;■. .-r, >-.,■:■■■.•■ ,

: - ( ,i-,i. •]:.

■;:■:,:■ - ( .

• .' ' ' ' ■' • .

i ■■ l,.in Li,,,
h-:!i-.', !--,i. I;

HI , hi, i

■■;..:■ ■■ ' .- : ■}■■■■ <<■■ ! .

Near Ningqiang, T. N. Liou 11869 (PK).

■ --■-■■". = . ;o;!.,. '

.;..■:<,■ -■ ■ ::: ■ ■

Revision of Rhododendron s

.

r.-.,.-,,':,..

v. ji: ■;/;/;,■ :

Y. Fang 23929 (IBSC. k L.N. FK):

.umii. 17. 1. /«ng

24511 (IBSC, Kl N 26608 (SZ); Xinhe,

ii- - i, n_ I oi. Mix

-.). 1 ejiang, Fubao

:

(IBSC, KUN, NAS) : Zhou 93025 (IBSC,

■': ■ ' . ' . "'•

-;;. in- <:

; . ;

/', ,'.;:. .-: (i-

o 899 (CDBI, PE);

■.:

: .

, ; .... ; ,

:

,wd 30263 (PE).

Chang 2362 (HHliG. PE), A. /'. ,/», ,s.„. (
Jiande Forestry Farm, M. C. Liu 770025 (ZJEC):

Kenghhuwun. \n, i». Baihc. ,S. >.

Ckflg e/ «/. ;«.>« (WAS). !/„>//

,;:„-.-.i,- ':.

/-'. ./tn s.n. (HTC), Y. 1. //«

,■:;,.■;.,,.:.,:,.■:.

.:
"/.:,'.'.. ill" ,|. ,';'. ■

i, I M .

(HHBG, KUN, PE), G. Y. Li et al. 579 (ZM): j

■■ ■■■ ' . ' ■ :

:■.■■■■■■.■

g Wed. Bot. Exped.

I h i
' ' :: ■ . . :' "

■ ■ :; ,■:!■■■:.,.

'• ■ ■ • ' ■ • :

HP I: I--!' .

;,./,:■.■■„...:'„■

■•,525 (KYO); Sandankyo, H. Hara s.n

ih 1 I '

mura, H. Kanai s.n. rata & N. Fukuoka

'■■ ;■■■■.■.■■; i ■ ' )
. , .■■■;„/..■....■
:
i n :■:■■ ! ■■: •

^ ' ■ . ■.!,; ,,!,,,.. .:

<.<■"■.'■.< -:i i :

■■ ;;p ■:■■■:,:. i

; I :-.,■ -:,,,

ora ef aZ. 2i958 (KYO); Kyoto-shi,
Takaraga-ike, Z. Sato s.n. (TI); Kitakuwala-gun.

■

ll.:l i :|hl:|.Tl, (;

be, Yasaka-cho, G. Murata 20158
u, N. Naruhashi & M. Wakabaya-

! Mil Ml

Minagi, J. Murata

. '• ' ' , .-.-.■ .■;■;■/.,<,■.■

(TI); Sengenkeikoku, Okutsu-cho, Kariyama Sfcungo i2969
Osaka: Kitakawachi-gun, Tsuda-mura, U

(TI).

■-,:n-i ;'.

. . ..,..!„:„ ;.i V-i

Mitoku, M. Togashi laku, Daisen-machi,

I , I, ' ,!,.!■. .■,,

Murata 10926 (TI). Pref. Toyama: Ml. T,

:

wakuni

■/.■.-.■■.■.■ ' r .,.;.

chifusa, K. Takada

(TI), 5. Yamaguchi

■ ■:'■■';■( , ;

■■'. •-',-.,. ■,■/,.

iyama, N. Fukuoka 7204 (KYO);

Mitoshima-cho, Mt. Shirodake, M. Holla s.n. (KYO);

(TI);

7 (KUN). Pref. Oita:
:ho, Mt. Hikosan, G. I

rcazaAi 5223 (KUN).

' ' ■ ■ ■.. ;>>.;:;,,!.:

ogaslli :

:

a & T.

848 (KYO); Ml. I,

:,M,'.:,. !;::::.;,■•!■:::'

£ G. Murata 4183 (TNS).

surfaces except n

2-flowered; pedicels 8-15 mm, glab)

divided, tube 10-
13 mm, glabroni;

^ ^ ^ ■ ■! I i i . 1,'il I -

. .,'.,' Ih )" ; <Mhi:l

M'"'» is kn.

ii illi Hi I i nil In I
■■>■«;■ I.', i

.' : ^ .•; -il},;

i II .'llh. I' I . : ■■;
: ::•■■]■■■■

I, Hi;! 1,1; ;■■:,!■ '

Moore, J. Bot. 15: 292. 1877. Azalea quinquefolia
(Bisset & S. Moore) Olmsted, Coville & Kelsey,
Stand. PI. Names: 27. 1923. TYPE: Japan.
Honshu: Nikko, 23 May 1876, J. Bisset 233

E no l seen). Figure 5.

YonezauKi s.n. (holotype, KAN A not scon).

. . . . ; .

:

■■■■■■ ",.;,-;•■ :: :

Revision of Rhododendron s

.■■V..,V,- •■■■/;. :

igahara, T. Yamazaki et al. 892 (TI,

( ', !'. ■•,».- I!

akumogahara, Mt. Doman, M. Ito

(KYO), Mastuda s.n. ara-gun, T. Yamazaki 6215

;T ; ■■■;,!,-,! .

Abetoge, Yamazaki & Matsuda

.. I.:!. ,.„ .;.

in.. Bull. Acad.

Imp. Sci. Saint-Petersbourg, ser. 3(31): 64. 1887.

L F. Copel., Amer.

Midi. Naturalist 30: 597. 1943. TYPE: Japan.

ia," s.d., Y. Tashiro
s.n. (holotype, LE not seen). Figure 6.

:V;,:..;:v. .■:■■;/.::■

Yamaz., Fl. Jap. (Iwatsuki et al., eds.) (ed. 2) 3a: 31.

• • • • ■.-., .,-....i.::! 1 ,

Ml. Cho>d. 16 \pr. 1967. H. Hatusimu & \ Sako
30554 (holotype, TI!).

Shrubs evergreen, 1.5-4 m tall, sometimes to 6 m;
hirsuLe, later glabrescent. Leaves
whorls of 2 or 3 (opposile or

I' II ii I; ' i I'" i i 'I

3-6.5 X 1-3 cm. acute or shortly

appressed, cinereous-brown i

i l>. ■-;■■ ■":•! ;

20-25 X 10-12 mm. upper lobes with dark purple

0.4-0.7 mm.

■
has hern roll, 'lima, as well as

i'i • ' ,
in forests or at forest margins at 200-1300 m a.s.l.

Discussion. >amazai,
considering variety lasiophyi

ill nil'

; ■..-,■ Ill Mil:

1

II ill Ill

same specimen or even along the same yc

/■■■>,.'.'/■). V-

pin Hum to synonymy with R. tashiroi.
Based on this species

. ' Ml , I 1,1

ill II III III l l, I

amberlain (2005)
iberlain and Rae

i

g et al., 2009). Based on the

choline. Pollen «■
r than those of R. U

inulated (Zhang et a

CHINA. Taiwan: Gao-

1742 (KH)i
JM-*-... I,. i,i

(KYO); Isl. Amami. Yuwan-dake,

(TNS), H. Yamamoto s.n. (TNS); Isl. Amami, Ooshima-gun,

'■.■■..'

,;„:!,...„ ■ ' '

V. Fukuoka & M. Okamoto 1 07

;

. Vagamasu 1035

;. ,■'.■■..-.■,,

Kuniwaridake, T. (KYO); Ohsumi

Takakuma, K. Kuni, (an, Kamiyaku-cho,

Kumago-gun, H. Takasaki 80043

i ! i

:iv.;i!.;i. >.'■■■■■:

no-shima, Toshima-

: ■.. ' . . :

a: kunigami-gun.

.' I' ::'■!. > ; ■.■■;/
:' .' : ' : ' :

■..;.,■:,,,, ,-m ■ ■.

^ . . ,1 ,:■;

Mitsuta & H. Nagamasu 764 (KYO), S. Mitsuta 1

■ ■ .■ .,■ .-.■ ■..; : ■

(TNS); Ryukyu, M. Nakahara 241

Yamaguchi 6884 (TI); Miyaki-gun, Tashiro-mura.

Shrubs deciduous, 1.5-3 m tall; young shoots

I! It III: I: ;.i
■■ ' , ' ' ' .

" i=' ! -'"'I: I* ,li..

es, lobes obovate to oblong, 1 <

■ [ i .,1 .h- ni;

• '. • in,:,;

Distribution and habitat. Rhododendron wada-
known only from Honshu
'rovince in Japan ed forest at 900-

500 m a.s.l.

i emerge i

.' : ^ .•; ' ; ,

3-verticillate leaves ;

TYPE: Japan. Honshu: Pref. Kanagawa, Hakone,
Mt. Kintokiyama, 15 May 1927. T. Sawada
here, TI!). Figure
2A-E.

j£zx£

iodendron wadanum Makino f. kaiense Hiyama, J. Jap.
Bot. 28: 217. 1953, as "kaiensis." TYPE: Japan.

Honshu: Pref. kai. Ml. MiMUage. 12 Max 1938. K.

synonymy with R. wadar,

w species, but no collection or illustration

i 1 in, -II ■ '.

tionT. Sawada s.n.

, TNS!

.■■.,■.',■;,'.'.■■■'.■.■.■ •■■.! ■:!<:

f. leucanthum (Makino) H. Hara, Enum. Spermatophy-
tarum Japon. 1: 56. 1948. TYPE: Japan. Honshu: Pref.
Kanagawa, Sagmai. Hakone, T. Sawada s.n. (holoUpe,
MAK not seen).

Kai, 5 June L949, S. Okuyama s.n. (holotype,

TNS!).

:-i:ll::l IIV.'I.

■;■:/:■:

, . •■'" ,■...■;■..,:■.-

:

aba-gun, Naraha-machi, T. Nemoto 2952 (KYO);

Revision of Rhododendron s

■.■!...^!.;..n. ! |--
hi, m .':■...■..

io-gun, Onishi-machi, Shimokubo,

IU,/«!^(IO<». Pn-I. Ivhum

& S. Kitamura 1568 (KYO); Inabe-

'.....■

FamazaAi 9970 (TI) gun, K Katsumata

. ' ■■■..■:■;.■'.■:

. : ' ; ; i ■.■.-,

Akasawa. Mural,, 0); Komagane-shi,

:

,'■■ ■■:■■■. ."'''/

N. Fujita & M. Katayama 3 (KYO), ft Ohashi

ML Fudou, ft

■. : :

(KYO), 53 (KYO); Nikko-shi, Jakkonolaki Fall, ft O/ias/i; e«

: :

Kimura s.n. (PE). Pi gun, J. Matsumura

Fukuoka 6676 (KYO), 6672 (K

....-v.,. ;.■,■';■ ;

i. Daibosatsu, G. Murata 16940

: ' ' " ■■.<!,,!;■

t. Fuji, Y.Satake 47

s.n. (KYO).

!.•■■:.■.„■.

.,■■.-?.■■.■;,:';■
.

. -hi. cull. ToLno. Ma\
iliololype, TI!).

,i; - i ::,>!.
Mag. (Tokyo) 40: 487. 1926, syn. nov. TYPE: Korea.
Chc|u<lo Island (laqucl). Jul> 1911, Anon. 5785
(hololvpe, TI!).

.
IM I' i !'

' ::,;:.! ;.:,:■;:)

Shrubs deciduous, 2-5 m tall; young shoots with

.■■:■■..[.:■' : '.i ,!:.■■;.. |in.;iM|:

in l

i niied at base, minnteh d

in

2- to 3-floweml-

1,11 I I

or white, bro.i I
■■■i i .

, i ,|,
ts at base; stamens 10, unequal
in length, 10-'

Olt .III.''.. :':,'.

35-40 mm, glabrous. CapMi

. I • I X
0.5-0.6 mm.

Distribution and habitat. Rhododendron weyrichii

es at 200-1000 m a.s.l.

'-■■:.■;■ .;.■;;,■■■

' i.i i

. . r.

re red, rarely purple or white, and

i , i i lii I

i in having young
leaves with brown pubescence and sparse]

utift in having

Revision of Rhododendron s

Swiomim. Renal Botanic Garden of Edinburgh, Edin-

- ' i :

aier. Midi.

s.n. (KYO); Kita-

< I! ■

i ., ,1 , I
:

.. . . ' ■ ■•• ■ " '■ .
•"■.'■

. -,i. (^ ::■..:

Murata 1 7844 (KY ( shima, 5. Kitamura

,. Niyadao-mura, T.

Yokogura, H. Koyama 4253 (KYO); Takaoka-gun, Hidaka-

: :,!■ I'^liMih

" 1 'I. :■:: ■

h-< : ;■■!■■;

■■:,■,:.<.<: :.'•' •' .

Mima-gun, Anal.uk N. Kurosaki 8156

:

533-625.

Rhododendron sections Rhododendron & Pogonanthum.

I ' ; = ,

of the genus Rhododendron. Notes Roy. Bot. Gard.
Edinburgh 36: 105-126.

& . l')7<>. ' ,

37: 327-338.

192-200.

.. 6-25 in Y. Y.
Fang (editor), Flora of Zhejiang, Vol. 5. Zhejiang Science
e. llangzhou.
,'•
from Zhejiang, China. Hull. Bot. Res. 10(1): 31-33.
& X. F. m of Rhododendron

, !!

.■:■■! m;;,': .:..'|-i.i.. :

Sin. 15(6): 36-42.

I uiK. \ol. 3. J. F.
Rivington & F. Rivinglon. London.

I! I. ■. ! I , -.„. .'■

D. C. Chamberlain. 2005. Rhododendron. Pp. 260-^55 in
C. Y. Wu & P. H. Raven (editors), Flora of China. Vol. 14:
Apiaceae through Ericaceae. Science Press, Beijing, and
Missouri Botanical Garden Press, St. Louis.

598 642.

«,;,.:» I. Yll :

Phylogenetic rel ,

Lricaceae) and its s

(VIII). J. Jap. Bot. 11: 820-830.

. 1948. Rhododendron. Pp.

Enumeratio Spermatophylarum Japonicarum, Vol. 1. lvva-
nami Shoten, Tokyo.

.;■,!.

Brachycalyx) from Hokkaido. J. Jap. Bol. 49: 353-355.

\l.:..:\r. '•:. \

; ,a. Taihoku.

136//! I, C. Hu & M. \. Fang (editors). Flora Reipublicae
Popularis Sinicae, Vol. 57(2). Science Press, Beijing.
& D. C. ( 'h.

Chamb 1 n

D. F. & S. J. Rae.

1876. Rhododendron. Pp. 599-602 in

. 1932. f

. -I.'-

. 1935. N

subgen Z\h/shsz sensu Sleuraei (Eiicdceae) PhD Dis

add, W. S. & K. A. m of Rhododendron

-: :,.-• ! :,

1971. Rhododendron. Pp. 148-176

Woody Plants of Japan.

—

. ' i i.:«i ..::..' ,:... .;.,,

, J. 1. Eloh, T. Handa, K. Takayanagi Is

(Ericaceae): Evidence from mcUK and trnK intron

•' ; I: II

;!. 1. Stockholm.
,. I I , , ., I,,,

(Toyko) 7: 133-135.

. 1 91 7. A < ; edge of the flora of

Japan. J. Jap. Hot. 1: 19-22.

of Japan. J. Jap. Bot.

— , , I i, Ill i

of Japan. J. Jap. Bot. 3: 17-20.
.1931. Aeon

Japan. J. Jap. Bot. 7: 19-24.

: r i . 7, 16: 1-53.
VI. Bull. Acad. Imp. Sci. St.-Petersbourg Ser. 3. 31:

distribution of genus Rhododendron L. Acta Bot. Yunnan.

Indigenous in Japan Proper Vol. 1 (1922)," with additional

remarks on some species. Bol. Mag. (Tokyo) 38: 2.", 48.

" ' ! • i

. 1927. Rir

(editor). Trees and Shrubs Indigenous in Japan Proper.
men. Tokyo.

synopsis of the genus Rhododendron III. Notes Roy. Bot.
Card. Edinburgh 40: >

Rhododendron, classification. NoLes Roy. Bot. Card.

I'd :n d,

im, ,

Bot. Jahrb. Syst. 74: 511-553.
. 1980. Par

II'!!, II"'-" ■■■:. .■,! Ii,

'■ 'iiiil .::;..!."

I' vol. 157:V31.

. : : : ■ ■■•.;

. 1983. A

South Ch ( IS W 1 1 P

■;,,.-. i I '

d&: 357-366.
. 1984. Some new l.i

Brachualw in Kyushu and Shikoku, Japan. J. Jap. Bol.

59: 205-210.
. 1987a. Id ,i three la\a ol

Rhodod I ct. Brachycalyx. J. J,

. 1987b. A new variety of Rhododendron reticula

. . . . i 62: 288.
. L988. On Rhododendron midipes ssp. nndipes

ssp. niphophilum. J. Jap. Bot. 63: 409-410.

use Yamaz. J. Jap. Bot. 66: 125-126.

. 1993. Rhododendron. Pp. 16-44 in K. lualsuki

Yamazaki, I). K. IJoufford & H. Ohba (editors), Hoj

^hang, Y. J., X. F. ]in,B. Y. Ding & J. P. Zhu. >

. . . : I.-:: \:-':,

MOLECULAR PHYLOGENETICS, Anm-Cath

CHARACTER EVOLUTION, AND 0lofR y din L *n?>* \ ktor A.

SUPRAGENERIC
CLASSIFICATION OF
LAMIOIDEAE (LAMIACEAE) 1

•v i. :.;.., :■,!..

plnlogenetie studies on plants has increased at a characters (Bentham. 1876; Briquet, 1895-1897). A

• : :-;; ••; id !nH' .: : , ~ . ; - , ■ ' ^

i ili li 1 1 1 1 I
been that molecm

ii i hiii ii II

a I., 1992). These

'" . ...i'l'. : : V. ! i

al., 2004). comparatne

Vagstaff et al., 1998). Currently,

supported by a grant (no. 154145) from the Research Council of Norway to Victor A. Albert.

1 0-0318 Oslo, Norway, a.m.bendiksby@nhm.uio.no.

' ■ ■ 1 •!'.• .i.::>\ :■,;:

"..

■0316 Oslo, Norway.

A. cl243@buffalo.edu

: . - ■■■■■ .rrii

7 These aulhors cm

5S0uri Bot. Gard. 97: 191-217. Published on 9 July 2010.

< I ] ■ ■ I

the best investigated.

Throughout the taxonomic history of Lamiaeeae, the

ideae. The [

I.. :■:■. I : id .» i '.li ■!.!.■,: a I

«. ,i ii c... r, ■'.':■.■

morphology (Abu-Asab & Cantino, 1994) provide no

■■■■! IN- I ;! :.'

' ' '. . ' ' . .

'.-■v.
iLalion of the subfam-
ily, how can the I Losed as currently

characters seems to distinguis

typical labiate bauplan. The inflores

h :■■,,:•!■; ■■■■!■ : ' ■

I . . I , ! I II II

•-'.-' I '<

ous, and embryos

ill i i ill

ii i" I l Hi I !, ■ II

Although it has

third), and ca. 50% of the total :

;

I i 1 1 1 1 «

eae are rare outside of Eurasia and Africa.

" ■ )■: :■■; .;:

nany members in
cularly Africa and

largely tropical East Asian.

widespread in

■■ ■ ■

Europe and the Mediterranean region.

I

previously been the subject of targeted pi

' ; ..lll hi:

Ml II II

'

:. : !>:■:■ i IHIhll; I'i-il I - . ... .

een et al., 2008; Scheen & Albe

' ' ■■■■-,<< .'.I .: ,■. !■.
I I !

;i i. -s " i. » ■■ ■

|i. i| i i ■ in i mi i |n ii._ 'I , I

MATK RIALS AMD MhTHODS

and Pogostemonoideae

selected using 167

■!'■<■ : -!i ■'• : ' ■

Ill

■.:-■■.'■-. <■:.•:

' ' ■■■ ■ ■:■•'

outgroup for all analyses. \
sequences for the re retrieved from

GenBank (see Table 1).

., i'K ■,■■■!■: .

i . I i i , • I I i

if •■ i -i i ni''>

DNA Laboratory ilo). In addition,

sequences from previous studies of lamic

2008; Scheen & Albert, 2009; see Table 1).

DNA was extracted from silica-dried leaves (vouch-

< I i

llden, Germany)

primers c and d, and e and f, respectively.

rpsR2R (Oxelman et al., 1997). When DNA of low

GACATTACTTO CGGGAATCGA-

CTGTCCATAG-3'). PCRs were perform©

U.S.A.) containing 0.2 mM of each dNTP, 0.04%

liiiiilnii I Ullni Mil, i I I i III 0.8 " I Ml I I, i in, I

■' :■:;:'■■

perf 1 GeneAmp PCR System 9700

,'M,. m: '..
I

.vac lions were
or 8 liL 10 X diluted exoSAP-IT (USB (

..<■'■'■ ■ !■''■■

ing was performed using the

PCR and the Hi; Cycle Sequenc-

ing Kit (Applied Biosystems). Quarter reactions were

.in

Sequences were assembled and edited using Se-

;■■■ .snow i i.'
the advice of Kelchncr (2000). Inscrti.,
(indels) were coded as presenl/

in that when analyzed

i , 1 1 | . 1 1

2000; Jobson el al.. 2003; Paton el al.. 200 1 1.

..'III:'. IIIOII'.

analyzed: (1) data without in

; data, and (2) data with indels coded

Parsimony analyses were run in TNT (Goloboff et
u lion in a driven

' : - i' '. .'in';]

ill >

(TBR) branch swapping. Additional TBR branch
! on trees resulting from the

iii

■ . : ■ .

: reported. Because the

the PHYML (Guindon &

urn africanum Baker

TWwm 44i (UPS)

FJ853999

.Wg 89733 (UPS)

A. cryptanthum Baker

Malawi, A'. K. Brum in.

A. fruticosum Benth., ace. 1

Phillipson 2082 (S)

A. laterale Baker

Malawi, R. K. Brummitt 11554 (UPS)

FJ854252

FJ854139

FJ854005

- S. Moore, ace. 1

Uganda, A'. 4 Dunir,::' . ,

FJ 854006

Ethiopia. /. Fiu, el

FJ854007

A. cf. parviflorum S. Moore

Ethiopia, W. J. J. 0. de MMe &

B. E. E. de WUde-Duyfies 8874 (UPS)

FJ854134

FJ854000

A. „«&»» Giirke

Tanzania. E. Farkas & T. For, 80604

(UPS)

FJ854008

A. schimperi (Briq.) Perkins

Achynspennum sp. indet. cf.

Achyro^eZum sp. indet.

Burundi, ./. Leu all,'

Acrotome hispida Benth.

South Africa, P. Her:

A. irc/Zata Benth.

1072 (UPS)*

EU 138300

A. pallescens Benth.

FJ854259

FJ854012

A maZaiarica (L.) Sims

gerlind & Klackenberg

343 (S)

.

fiaZZoto acetabulosa

Greece, M. Bendiksby & A.-C. Scheen
0412 (0)*

EU 138342

EU 138296

B. africana (L.) Benth.

South Africa. K. B.c.

Iran. ,S. Sabaghl s.n.. 02.06.1993 (S)

FJ854015

ft integrifolia Benth.

)erg s.n., 11.06.1939 (S)

,

I',,,,,.

liksby & A.-C. Scheen
0431 (0)

( 77/,/rm<M (L.) Benth.

uksby & A.-C. Scheen

B. undulata (Fresen.) Benth.

Jeiusalem. /. \nuli

Betonica alopecuros L.

Italy, S. Vaulier 2661390 (US)

FJ854308

B. macranlha K. Koch

eal et al. 161 (C)

Turkey, P. H. Davis & Hedge 31895 (C)

FJ854320

FJ854106

B. officinalis L.

eultivar, C. Imdqvist & V. A. Albert 357

(UNA)*

AF502056

FJ854109

B. scardica Griseb., ace. 1

1048 (C)
Greece, J. Ugelvig & L

FJ854326

FJ854229

FJ854114

B. scardica, ace. 2

1051 (C)

Bostrychanthera deflexa Benth.

Exped. 1923 (A)

FJ854020

U.S.A.. XL It . Tmn

Chaiturus marrubiastrum (L.)

Germany. .4. /W.-

FJ854268

FJ854022

Spenn.

Chamaesphacos d cij

Iran, K. H. Reehir

Chelonopsis long.pes Makino

Japan, S. Okuvama A V Maruyama
s.n., Nov. 1951 (UPS)*

EF546938

EF546861

FJ854024

C. mo.c/iata Miq.

cultivar, P. D. Cantin

Craniotomefurcata (L

May 1973 (UPS)*

II Hill ({])■■■
Taiwan, Cien-chang Hsu 5824 (S)
Japan, M. Ono & S. Kobayashi 45908 (S)
Japan, Shigetaka Suzuki

nzu 12869 (S)
Nepal, 0. I'olunin et al. 5638 (UPS)

■■her B-200 (US)
Nepal, Stainton et al. 7748 (UPS)
France, E. Dahl s.n., 26 Aug. 1979 (0)*
Poland, T. Tacik & M. Syclwwu 366 (<))*

» (M-m (0)

K /-VwyVm 5.393 (S)*

: :

Sri Lanka. 1/. /«,//•

k.MlXd. I/. Ws

:

-'/« c/ «/. 5869 (L PS)*
5 /«nj Project 85 (UPS)*

Table 1. Continued.

GenBan

no.

Taxon

^Lintron

trnL-F

on el al. 661 (UPS)*
Palau, C. A. Sahedo 164 (US)*

„!- el al. 2190 (LIPS)*
Somalia, M. Thulin & A. M. Dahir
6706 (UPS)*

Ryding 2310 (UPS)*

EU 138414

F 138342 EU 138266

llaly, M. H. G. C

, G. Popov 123 (C)»

1927 (S)
10044 (S)
Bot. Exped. 1262 (A)

/. C. Petersen 394 (C)

in s./,.. 19 Apr.

/. M Taylor 17(0)*

terial, C. Mathiesen

EU 138445

FJ854048
FJ854051

EU 138368

Ge

.Bankaccessio

trnL-F

rpsl6

spacer

< ,

V. /;«/e TTmwjmk 88867 (US)*

EF546948

EF546871

FJ854066

& A. Gray

P. virginiana (L.) Benth.

U.S.A., & £. If „//<«

Pogostemon glaber Benth.

P. heyneanus Benth.

Sri Lanka,./. W« ( /„

FJ854297

FJ854184

P. hirsutus Benth.

FJ 854298

FJ854185

FJ854070

P. paaicalatus (\\

ft Lundi/i 565 (S)

FJ854186

FJ854071

FJ854187

V. Karmyscheva s.n.,

FJ854073

12 May 1962 (C)

/,'/ <//. 21115 [K)

(Rel le ) K d

/?. « reere «, (Hemsl.) C. Y. Wu

£x/>ed. 40 (A)

FJ854303

rea (D. Don) Baill.

'

EU138290

Yemen, M. Thalia et al. 8161 (UPS)*

EU138358

EU138282

Scheen & V. A. Albert

Iran, ft Nikookar s.n,, 9 Sep. 1963 (S)*

EU138438

V. A. Albert

Canary Islands, J. Barber 196 (TEX)*

FJ 854076

Berthel.) Clos

Canary Islands, J. Barber 256 (TEX)*

AF502036

FJ854192

FJ854077

. 202 (TEX)*

AF502037

FJ 854078

Canary Islands, ,/. Bui

AF502038

FJ854079

5. montana L.

Komania. ./. ««/-ier 212 (TEX)*

AF502039

FJ854195

FJ854080

5. romana L.

AF335659

S.syriaca, ace. 2

Bendiksby & A.-C.

FJ854304

FJ854198

FJ854083

Stachys aculeolata Hook. f.

24 Oct. 1992 (C)

FJ854084

Mozambique, B. Pe.lle.rxon 2146 (UPS)

FJ 854086

FJ854202

FJ854087

5. alpigena T. C. E. Fr.

Ethiopia, 0. Ryding

FJ854089

uenberg 685 (UPS)

FJ854092

Ethiopia, /. Friis et al. 3104 (C)*

AF502044

FJ854208

FJ854093

S. a/Tercsis (L.) L.

Canary Islands, A. Luadqvisl 8157 (UPS)

FJ854094

5. byzantina K. Koch

(UNA)*

AF502046

FJ854096

5. cassia (Boiss.) Boiss.

Greece, 5. & ft S«o^/

S'. chamissonis Benlh.

U.S.A., ft A. Moldenke et al.
32097 (LL)*

5. coccinea Ortega

' iNMH.i

5. <&£tfu Kunth

Ecuador, C. Jaliva & C.

5. graeca Boiss. & Heldr.

Greece, ft ft Rechinger 16887 (US)

Chile, W. J. Eyerdun

Soulh Africa. ft /,'

FJ854319

FJ854218

FJ854103

S. lavandulifolia Vahl

Iran. ,/. S. Aadersea & A. G. Jeasea

GenBank accessio

nno.

trnL-F

Taxon

Origin/voucher information

trnL intron

spacer

intron

5. lindenii Benth.

Mexico, R. Torres C. & P. Tenorio
L. 4602 (TEX)*

AF502054

FJ854220

FJ854105

5. maritima Gouan

(UPS)

FJ854091

S. plumosa Griseb.

Greece, S. & B. Snogc;

S. quercetorum A. Heller

U.S.A., G. K. Helmkamp el al. 2153
(UTC)*

AF502042

FJ854110

FJ854226

Croatia, G. Schneewis el al. 6268 (WU)

FJ854330

FJ854118

S. riederi Cham.

Japan, 11. Takahashi 2950 (C)

Mexico, D. E. Breedlove 55575 (TKX)

FJ854324

FJ854227

5. rugosa Ailon

South Africa, W. J. Ham

S. setifera C. A. Mey.

115 (C)

FJ854328

5. spinosa L.

FJ 854 117

0422 (0)

S. swainsonii Benth.

Greece, A. Sfrid e/ «/. .'•

FJ854234

FJ854119

S. sylvatica L.

(UNA)*

Stenogyne rugosa Benth.

nsl X- 1 . 1. Ubrrl
40 (NY)*

FJ854236

Suzukialuchuensis Kudo

18179 (US)

Taiwan, C-C. Liao el al. 564 (A)

U.S.A., 1. £. \h\nln

EF546893

Iran, K //. & F. Rechinger 4701 (US)

FJ854333

FJ854125

7 1 . peraca (Benth.) Briq.

l.«*.\.. 1/. //. \l,r.i

) M. W.Turner

1970 (US)*

Outgroup

Turkey, /. & F. Bornm

cultivar, K-0818400507 (K)*

AJ505535

cultivar, K-1934-12904 (K)*

Congea tomentosa Roxb.

Wagstaffs.n. (BHO)*

AJ505530

Cymaria acuminata Deene.

0. P/iiZi/)/) 446 (UPS)

FJ854244

FJ853997

China, C. r«reg 33750 (US)

Elsholtzia stauntonii Benth.

Wagstaff356 (BHO)*

AJ505406

cultivar, K-1995-1197, f

(S. Moore) J. Duvign. & Plancke

Hypenia macrantha (Benth.) Harley Atkinson & Gi

AJ505445

C. Fazguez Form 526 (GB)*

AF231884

AF231884

AF225294

Lavandula buchii We

Upson 299 (RNG)*

AJ505346

Melissa officinalis L.

Wagstaff 88-09 (BHO)*

*efcrefc 80486 (TARI)*

AJ505430

AJ505323

Origanum vulgareL.

73334 (K)*

(G. Taylor) A. J. Pat.

Suddee et al. 1028 (BKF)*
cultivar, K-1970-3559, Bru

AJ505479 AJ505479 AJ505361
AJ505501 AJ505501 AJ505379

P. petrophila B. J. Conn

M. W. Chase 6975 (K)*

Gar. S. Africa (K)*
cultivar, K-1973-1421 7 (K)*

Greece, M. Bendiksby &

A.-C. Scheen 0411 (0)*
Greece, M. Bendiksby &

A.-C. Scheen 0418 (0)*
Wtamea 73P272*
Greece, M. Bendiksby &

A.-C. Scheen 0426 (0)
J\orwa\ . A.-C. Sch

11975-1177,

Cftase 13331 (K)*
#. KaZ/ie&er 78-506 (GB)*
TCMK 15, Ctoe 8757 (K)*

AJ505549 AJ505549 AJ 505421

EF546927 EF546847 EU 138289

EF546928 EF546848 EU138288

AJ505528 AJ505528 AJ505408

i

is (f[A] = 0.34185, f[C] = 0.16969, f[G]
= 0.18884, 1[T] = 0.29961)

■ ii

phylogenetic positions. No

I | I I " ll I i I I III ;'■ I, I :

following the rules of the Internatiom

et al., 2006).

■ ■■ I ■:■■ c; n-v,

■'■■■! .:: il l [■■■■.■..

1984; Reveal, 2007, pcrs. comm.; Govacrts et al.,

. .x< ho:

> 80%) that wo

fi:;'!! ■■;

-B. Galeopsis I Sldd.uW. — C.

Vain, Roylea
bieae, and Leu deae (B) are i:

missing .lata. Se >lded an entirely

' ' i

' iiraii-ii: »V! :, : : .

coded and inclm

| ii. i i i.i i, i ill

I i I Mi II I * .

(MPTs) of 2302 step; index (CI) of sister to Lamioideae plus Pogostemonoideae. This

0.61 and a retenti-i

-. inemhers of the
9, RI = 0.87). former suhla

: i , ;■!!, I i.i'. I : i in" - i * ■ .' . .

Figure 1. Conlinued.

ii I i In

.■.!■<'■ ,::: ■'. Ml ii
! :> ,ii i :<■■.'! 'I;: ,' :"■ ' ' ■ -

(1) a clade con-i-tin- of Gomphostcmma Wall. o\ >t Stachys, Sideritis,

i Benth., and Chelonopsis Miq. and a numbe otypic genera; (6) the

Bunge, Notochaete Benlh., ;n
smaller genera Chaiturus Willi

& C. A. Mey.; (9) u

: L: and (10) a large clade ...

.1 K. Br., Otostegia Benth.,
Benth. ex EndL, Rydingia Scheen & V. A. Al

Galeopsis and members of Stachys subg.
formed a group, although not supported b

group (Fig. IB).

' "i,,M: ■'■'::,'■:

i 'I' !'

.

circumscribed by Harley et al., 2004).

The exact circumscription of Lamioideae still
remains a problem. The first issue regards the status

- i 'I

II '! II I , i i

'.-■'•■'•

plus pogostemonoids.

■ '-I" :■■■:■,. I

(99% JAC; Fig. 1 V). Cymaria is a small genus

. : , ,

: , ■■i;im l> .).

< ■ ■■■■■■■ ■

tions for placement have been made in the past, in part

al, 2004: 189-190). Howcvm

al., 2004: 189-190). I

. < r. ,;■:<■ il" Li

.;.
'i

:■', r.lr ;!i ,.'.■. ■

i with prominently pedu

' '!i liOII f

tropical East Asian monotypic genera lr.

■■■.■■..

I'M ::- ■■:, U-.;\ :■'.'.■:■ ' ■ !-" '■

'I i Ml

Ml II li.lil HI
. ■' m . '■' ■ ■; ■ '
' ■■■■'■ : i ■ "

;

la 11 into two separate

, 1 1 II ' II

roup (89% JAC;

M= :'r> ;
are >Mci laxa with high support (100% JAC),

, i i I !

prior to Cantino"

i». I \l. In all

i

monotypic Craniotome and Microtoena (2

JAC). This group tical EasL Asian,

I ' : ill • i

(96% JAC; Fig. 1A). Although only
Asia and the Himalayas.

. lack of morpholog-

stamen filaments lericarp (Cantino,

. . ■

'>■'< ■.■■■.■■

(Harley et al.,

ill ! i
a genera, Colebrookea Sm. and

There are also morphological characters that
suggest a close relationship among the gei

Even though there a:

•mil i I!

Excluding the three lamioid genera Achyrosper-

■

I 1 i I '

rs. Both Bostrvcliantlicra and Gompho-

uls ml haw previously been

Prasieae Benth., whereas Chelonopsis was circum-

(Bentham, 1848, 1876; Briquet. 1895-1897; see also
lelow). Molecular studies show

' I I

ll II II

'IMl-h ■■ •' I I . '

Yam. neither of

^ ^ ■■■'.'>.' . I V, it

1 from a fleshy

i i I! I! ii,

■ '" i'- .me ■'.!:■; i it-, <i
'. ' ' ' ir: '.■■ •:'! Ill

i: ■ Ml'-- .'.,■:

support (78% JAC; Fig. 1A). Two (of the a

" '■■;..■■'!;:■ ; : .. '■'.

apex (Harley et al, 2004). The latter character s

The four North American genera Brazoria, Physo-

i! ,:.!■! Li

een et al., 2008).

in, IU:r»r;'»"i ■ ;■

nen filaments (Maries el al, 2004).

for the group, it que to the group.

I l,i ;;■, ;nr.i" m '

ex Fisch. & C. A. Mey. (Harley et al., 2004).

i, imis and long-
petiolate leaves that are pubescent on hot)

V',l|.'iV,!|; .,',.■■■■

mostly sessile leaves (Cantino, 1982).

Together with the European genus Melittis and the

le (Bentham, 1848, 1876; Briquet, 1895-

II; ■<■■ ll;

, : fir: : .i .•!,.■■

■■■ .'■, I •..■!■.■■■ "

f.:;: I':f:. , i

' '.ii< .1 J"""

" !':;ii,!:.'|...;.i.i'.;':

ll

Scheen et al, 2008).

;:
i'' '"'i^ ;• ■■

,, ■ ;',.;,,':..

;;; ... .

i 'II

'.' , ■::■ i.i.

Ill

' Albert, 2002). The H n dian

; "I'ii'ii ; I <»■/, I

s separate from

■ :

:;■■■::■.

variation (Scheen et al., 2008).

. • nlfiMc rr<v ..,.■■;

;upport (82% JAC; Fig. 1A).

I I Mil i I

Ul cells dherge in being
large groups.

K supported el tide separate
from all remainii /n.s (100% JAC;

Fig. IB). The five included species, and about 10
hys species distributed in weste]

separate genus Betonica L. (e.g., Dumortier, 1827;
B tl n, 1829 Reichenbach, 1830-1832

'tonica is readily

■■.,.■■:■■ !<■ il.'l- li i.>:
, . ■ li >-},, •nil'"

a broad and hardened base, and anther eel

parallel (Ball, 1072; BhaUacharjee, 1980). Also,

Betonica and remaining Stachys specie

:

Within the Betonit
between the tw<

. Ii-f.'.i-.rl. II

sister to the rem

'[.' .:■!;■; ; ■

tube (Ball, 1972; Bhattacharjee, 1980).

, i .■ -.
(100% JAC; Fig. IB). Galeops

. :' ill:' ■'■■,■ ill

ie Lie study of Galeopsis will be

Goldblatt & Job hat flavonoid p-

. ..

.Ui:.'' I'' I:'/' . ^

. : Mi ','.| ■.■■(■ :;;■,

■■> I' , i .-H VM'

feature of a sw

Because of the hi these two genera

leave the genera unclassified at the tribal level here.

I I . li

dentate (Harley et al., 2004).

Stachys. as currenlb circumscribed, comprises

■ L :-'00!|. li

is the largest g< Lamioideae and

osmopolitan genus Stachys

;

The many small genera embedi

erbs that are endemic to forests
my (62% JAC; Fig. IB, clade

ii i in; mi In

MM'M; Ulll: I IMmiiii
i I -

= 17 (Goldbluii

Mi'

; ■ i , ; ■ .:■.:■(■,.

' ■ : l.'l V I I M

I II ' , I M l| | , I I, |

II III II ,1 i

> II ( M <U , >

doschema, Thuspeinanta

IB, clade B). The western Lo central A i

(100% JAC; Fig. LB). Both Chamaesphacos and

n are annuals bearing very uai

mm;m,m, : I- ■...'...

of a short. HI

! 'I ! I ' '

I In! I ,l i i M

tribe Marrubieae Vis. (Bentham, 1876; Briquet,

' IM m: •

Ii ' I) < '

Stachjs s.l. clade (Fig. IB).

clade B (Fig. IB). Both Siderv

■ I -

inlM- ,h '■

1 1 diversity that

III M | .

' ill II ,11 I

et al, 2004). In their sLudy of the origin of

Ji<»\\ here that

' ' ' ..>r; -\\\ m'iimm.

f.l'!' Ill I | III I I I <! i Mi II II) ;;'

(Bhattacharjee, 1980) are monophyletic in our
phylogenetic analyses (Fig. IB).

We found no non-molecular features that could

: Mi: [■; : I M
I I I ill ii II

Evolution — Stamen Length, I

•

>rted by several traits,

(Azizian & Cutler, 1982; Azizian &
(Ryding, 2008),

iorphological traits (as

. I I ■ . I I I; I I I i

■■■,■!■.'■■!•■■■;, ■ ,-■ /;.

I II

•III. I II I.

has previously been reduced
in ling the three
i.itli.1 Prain, P.

• here all species of the
several species i re transferred to

!,ll il Ml,

transferred to Paraeremostach
Makhm. (Adylov et al., 1986;

. ■ . 1 :' I Ml;'.

and Paraeremostachys are treated as synonyms by

this clade as tribe Phlm.

II | i ! Ml I .

western Asian an ics. Howe\ er, the

of the genus into two separate

Eurasian

... ... ; .,,,. „.....,;

,i.ii:',;'.|i I'd ... , ' )

' ■

A monophyleti. .rted (100% JAC)

Lagochilus is recovered as sis

::ii:'.d ;ni ;,

;■-",-■■ i .'•

ii ip in all trees and

corolla (Harley et al., 2004).

Chaiturus and Panzenna have been variously

(Dumortier, 1827; Reichenbach, 1830-1832; End-
.-1840; Bentham. 1876; Bri,|uet. I!!T,-
1897; Wu & Li, 1982; Harlej

or excluded. ( ,: have always

I . i

differ f

''

v et al., 2004).
Based on the paraphyly of Leonurus, as well as the

I! ii II i I

Sister to tribe Leonureae is a weakly supported
taxa (58% JAC;

1 I ; i .1

large group of taxa is separated

■•; . '

■■■■■■

i ii ' II 'I I .

1

■ ::i ;\ rt ;■!.

' "Hi ;"";ii»i ,

■

III

[36-1840; Bentham, 1876).
While most authors agree i

■■ ■ .i! ,'i ;;
■, : • N'"-V |f r Hi

1845; Bentham, 1876; Luers;

>f Lamiastrum has

the corolla, whereas Wiedemannia is charac

a 2-lipped <-t,l

i i ! ill ii
the very distinct Lamiastrum may be better treated as

"\ • . . .,/ - , ' , •]■■:■ HH; ;"H

.:,.:; I :.■■'.

II I . ;. : l a '. 'I I :"i;; !:■;: <• .1 II I , lltnii

|. M "I'llll," :•'.'. I ;:l|, ■ II ,!■.>.. -ill

/////. and Moluccclla

..

ic Lo (Aprils. [,,

key characters fo rasium are woody

il'. I-.. I"

of Ballota are h with herbaceous

: ....

The three species of Moluccella form a highly

I!

107, 2009). The

IN. 'I: :,■,[■■■■■■

■,.'■•

sli '. i;h ;•;■ ' H . ■ ], , l,.l,':: ■;!
I I ' I

: .

Prain), Prain I I i V ving the habit of

ii* VI li.il IV. ■:■!

exserted from the corolla as i

.■•:o;hi Tir ■■:

iliat form a well-

J\C; Fig. IC) are all

ction Beringeria (Neck.) Benth.

North Africa, mainly in rather dry places. Based on the

:■. ' .Ill' ii» ;■.,!■■.

strongly supported group (100% JAC; Fig. 1(

As pari of [he large polytomy, species of the six

••..• ■■■n ■■■■■■ .■■',■■:■ :■

' i '>,)■■■,.■ II ',..!,:

analysis of many more representatives of Leucadeae,

suggested (Scheen & Albert, 2007, 2009).

i
.' il i ■ I ■ i" I I

Scheen & Albert, 2007, 2009). Of the en

species, one s,

III ;i:;a i i II i i i i llm In iiiiiiini
■ ii ; " ■• v.. I

'I , i , ' II ii

of I ['I " i-

>wever, although

■: : ' .

The genus Lencas is one oi the largest genera of

."1,1. I

.-.!< 'I ]:■,

(•■. i 1 : 1,1. ' "

'. Ml, ';.:■)■:

supported as a up (88% JAC),

paraphyletic with respect to the African genera
Acrotome and Leo e African species

.orate the results

I I'" Ill I I i

', i |. ! , i ii - 1 ■; :■ !■ ' I In"! il ' .

-»■:■ <;■ '■■■■:.!

occur on hilly slopes
southern Africa and are ea;

short lower corolla lip that withers at anthesis

-. II '■ In; I

^ ■ . ■> ;. .. :'UOI.I.

Ill ' . Ill II I II il I' I

1 I '

il! Hi I III

II I I II II II ' II I

between particular species of Leonotis and Leucas.

subfamily Lamioideae,

" ■ . .

1 1 ■ I ii I

iv,.< : IH -IC; . ■ ■

II

II', 1,; ;!.■■ Ii ; II . ■.

• • I' - .i ■'■,!.:■..

labiates vary in habit from am

Woodiness has ; from herbaceous

' ': >C<1 II i ill.:-

iwe & Albert, 2002). In

1 1 1 1 I i :

. i: . I III <■: .

■ ii... -:; .'»;.< !,:

I I .:|, -<-.... ; i -I-.

I II III , Hli j III II ;

»ment of a fleshy

ii

iiulLs had evolved only once,
i . .'..'in '',

ieae (Bentham, 1848) or as
Prasioideae (Briquet, 1895-1897). Howe

, ■ r:.|r. in ;ir

I.': I'. '

fleshy fruit has

v.. ',;■■;!, I,., ■

Bostnclumthera.i shared among closely related 1

dry fruit in the genus osphace, Leucosceptrum, and Rostri

. -'.. ii i ;:■<!> tr-i<; .

(Givnish et al., 2005). In Lamioideae, a shady habit Several genera of subfamily Lamioideae a

does nol seem to be linked to presence of a flesh> terized by having a bearded margin of the

p, but this feature is only found in P

,.!,■, In the -cnu- Phlumis, the

■ioides s.l. (including /
al., 2007), Rubiacer i *,,„„. ,,| l-j-rmostachys) from Phlc

Rova et al, 2002), and Solanaceae (Knapp,

ransfer of Otostegia aucheri Boiss. to Moluccella and
and lliuspciiiaiila in tribe

1876; Briquet, 1895-1897), although this mc^v has !l ' 1PIlL indumentum

not been supports

acters seem,
J( l as haA ing characters. Homner, presence of a bearded margin of
stamens that are not or only shortly exserted from the ] '!> m;lv l,e dn example of a

morphy for the clad

Most genera of subfamily Lami(

Leucadeae, the bearded c

orollamanunispi

g xcept tl 1
appears there has been

3d genus Acrotom

n Ballot (i. nmd ,
Acrotome from Leucas and Leonotis, and Sideritis from ^ e J

II-." am ■:; I ■ . rii.'i '<■

long-exserted

chaiacteri7ed In ha\ing spinose or spinescent bracte-

are restricted to L,
differences m st ;1 „,

1,1 ' " ' ^ •!

Indumentum. i 1

, ..,-■[!: '. > .' . '. "|- :'!;'!-.

■■:■ •■ ■ U 1 ( ■ .' i.

use bract coles does
glabrous and a dei
difficult to quantify the de->

■ i ".'■' i' m! i I

■ . <>■"■■ «>

used in the key to ;

Mil,"- V, •
' I'' '

)>l\ < ; !■■■ ;ii .;

" .',■..(<! ;: ,i. ;■.
I ' •:-■ ;;■■■:■ :>■■■ ;'

■ ■ .■[./< ■::■(■.. i - i;»

support the generic segregations. Satureineae; li corrected according

Calyx fibers. Ryding (2007) studied the .noun, of l " Sandei * & Cantino ' 1984 )" Bri ^ et ' s (1895-1897)

fibers in calyces of Lamiaceae and found pa, lced b ? Bentham's

lii.-;-i ■ m. i ■. . i '

Scutellarioideae. Although the character is very ! is Briquet's recognition of a large
homoplastic, it is „

, (| , | ,,, "«

I !!• i<

very high in the large cladc of Pa io the rank of tribe,

Phlomideae, Leon, irrubieae, and i-e., as Pogosi (erred to subfamily

I, -,<■■: :',-;,, :!■■ • •

clade of £ero?H,

(Fig. IB); and generally von low in the tribes that In both historical classifications, tribe Lamieae

split off in the has; i

Mirthcr divided into
large amounts m!

ioideae. However.

evolved independ n bfamilies. 1897). Thus, the most striking difference between the

Briquet, 1895-1897) is that the genera they included in

: '" '"I ^ '

Lribal level.

six tribes are i

olecular phy-

I,,-., <!■■[-;. '; . ■■ ■

l ' Vl n 68- 1 ^T^

Bentham, 1876; BriqueL, 1<". ( ).- -ajiaUi.y .m< .. al., Jj ^^ ^ ',"',', ph € ,lo^"*i n subfamily

revision of the entii ab, 2004), no Lamioideae (Labiatae) and' it's ^nWrneUr impli.'-ali.-iis.

corresponds well to the current , ( l icat ions of ollen

correspond well to the c unentb recognized subfam- muy[)] l u ^ m .uhiailLeTL^!;!!!,^^^^^™"

-■- ■ . ..

VI. Makhmedov. 1986.
INovosti Sist. Vyssh.
m.™ K»U nn Ap ™m.„i „, | 23: 110-114.

A---. D. & D. V. Cutler. 1982. Anatom,

ow the

i ones are warranted.

ai and palynological

. ■ ■ ■ ■ . ■

■;■■.■■■:.;;/....'

. Hcywood, N. A. Bulges, I). M. Moore, I). H. '

corrected accordu.

addition to tribe Lam e Vol. 3: Diapensiaceae to Myoporaceae. Cambridge

h included die fleshy-lruitcd si ly Press, Cambridge.

SiderUis L. (Lamioideae: Lamiaceae) inferred from nuclear
23: 293-306.

(editor). Prodromus s

- I \\ iirtz, Paris.
. 1876. Labi

D. Hooker (editors). Genera Planlarum, Vol. 2. Reeve and

Bot. Card. Edinburgh 38: 65-96.

iol. J. Linn. Soc. 47: 79-95.

VI in E. Burnat, Materiaux pour
sen n a Huston e de ia flore des Alpes Marilimes. H.

.... „• I. i\ \
Lngler & K. \. K. Prantl (editors). Die naliiilichcn
Pfl an/en fa mil ion. W. Engelmann, Leipzig.

: II ;>:,.

. 1985. Chromosome studies in sublribe

(Labiatae) and systematic implications. Syst. Bot. 10: 1-6.

. 1990. 'Mi

Arbor. 71: 323-370.

i/in ! ill.
Labiatae. Ann. Missoui

(editors). Advances in Labiate Science. Roval Botanic
. Richmond.

■- I

alion. Pp. 511-522 in R. 1

tors). Advances in Labia

1481-1490.
Goldblatt. P. & I). K. Johnson. 2006. Index
Chromosome Numbei

)i. Gard. 106.

'::.■■ ' ' . ici... ,.-i. :

times: Solutions for composite optima. Cladislics 15:
415-428.

.1 ' . ■ ' '

m .( nil

April 2010.

!ii i i. 7/ •.'...', .'■ I
April 2010.

Biol. 52: 696-704.

Windows 95/98/NT. F\ucl. Acids Svmp. Scr. 41: 95-98.

ii r,

J. Conn, l{. Grayer, \1. M. Harley, K. de Kok, T.
Kiesunskuva. 11. Morales. A. J. Paton. 0. Ryding & T.
Upson. 2004. Labiatae. Pp. 167-275 in J. W. Kadereit
(editor). The Families and Genera of Vascular Plants
VII — Flowering Plants: Dicotyledons. Lamiales (Except

Verlag, Berlin.

-J!: 89-191.
& K. H. Rechinger. 1982. Sulain

org>, accessed 13 April 2
warsson, M. & Y. Harvey. I
Leonotis (Pers.) R.Br. (

. •:! i' l.iT '■ ■:■■:: :

ales Disposita. Fr. Beck, Vienna.
Gascuel, 0. 1997. B10INJ: An improved version of the

L4: 685-695.

. Syst. Bot. 28: 157-171.

Kamclin. K. V. c\ A. M. Makhmcdov. 1990a. The system of
the genus Phhmoides (Lamiaceae). Bot. Zhurn. (St.
5: 241-250.

II

chloroplast DNA and its application in plant systematics.
87: 482-498.

2022.

schland, 2nd ed.. Vol. 11. K. G. Lutz, Stuttgart.

I , , r

11.82:30-11.

Sl, C. & \ . A. Allien

mic mints within North American Stachys (Lamia

. Amer. J. Bol. 89: 1709-1724.

, T. J. Motley, J. J. Jeffrey & V. A. Albert. 2002

i 19: 480-495.

Lamioid Mint Genus Phlomis L. Master's Thesis, Natural

of Oslo, Oslo.

Silva, J. E. Skog, J. H. Wiersema & N. J. Turland (editors).

(Lamiaceae). Leiden Botanical Series If. Brill, Leiden.

■ ■ ■

statistics for pin I
65-69.

ceae). PL Syst. Evol. 206: 393

Snnmonds, M. P. Powell
& V. Savolainen. 2004. Phylogeny and evolution of basils

regions. Molec. Phylogen. Evol. 31:

■' ; : '..■■!:,

Mus ^ ien 6} 3-81

R. C. Evans, S. Oh, J. E. I
Smedmark, D. R. Morgan, M. Kerr, K. R. Robertson, JV
Arsenault, T. A. Dickinson & C. S. Campbell. 200'

■■)-. : 'i . :::i'.; ■"'.,•

266: 5-43.

Prain, D. 1890. Some ad

'

. 1901. Phlomis

1982. Otostegia. Pp. 34

) in K. H.

Lova, J. H. E., P. G. Delprete, L.
mineeae-Rondeletieae-Sipanee

lantsyst

! I |

son & V. A. Albert.

.. . ::- ii :■;.!

14: 59-63.
. 1994c. Pericaip slm. •line in lb.

; ,■:.!,!■; '.'!■'■■ - ' I i.

Bot. Jahrb. Syst. 116: 391-399.

. 1995. Pericarp structure and phylogen) of the

v. PI. Syst. Evol. 198:
101-141.

Syst. 124: 325-335.

:« ,■<

268,: 15-58.

. 2008. Pericarp structure and phylo-

Phlomis group (Lamiaceae subfam. Lamioideae). Bot.
Jahrb. Syst. 127: 299-316.

subdivisions of the Lamiaceae. Taxon 33: 64-72.

C. 2007. Molecular Phylogenetic and Transcrip-

.. ! i ' >

Syst. Geogr. PL 77: 229-238.
& . 2009. Molecular phylogenetics of the

i«eae). S\sl. Bol. 34:
173-181.

-.;. .

• : :.l, !".:'.,.; :: . I l , ,

nburg 10: 1-393.

lienlham (Labiatae)

. jahrb. Syst. If 5: 547-555.

Singh, V. 2001.

and Natural Hislon. Cambridge llni\ersit\ Press, Cam-
bridge.

1,11 ,, - ,
'I..! !,i . r ,>

University Press, New York.
Tomas-Barberan, E. A.. M. 1. (ill

, , = -:!.. i...:::!,;;..;.:;.

1 : 3007-3102.

! 5-1 47 in T. G.
Tulin, V. H. Heyvvood, N. A. B urges, D. M. Moore, D. H.
Valentine, S. M. Wallers & D. A. Webb (editors). Flora

Phylogeny of long-exs(

Wagstaff, S. J. & R. G. 01ms I .e.

il.jalae s.l., inferred from

cpDNA sequences. PL '

classification of Oleaceae based on rpslb and trnL-F
sequence data. Amer. J. Bot. 87: 1827-1841.

Ihe Labialae. Ada. Bot. Yunnan. 4: 97-118.
uml h 'i I L967. Em Vorschlag z

I.I „'

accepted: hence, onl\ clades thai include more than

II.. II,- In, .ill. i. ■ ' :. '

Lamium L., Sp. PL 2: 579. 1753.
Non-molecular features: style gynobasic; nutlets nol

| spalulale.

*Paralamium Dunn, *Paraphlom
marrubium Popov, Roylea Wall, e

e & Rech. L, as well

;•• i i 1 1 li ■■ i , i ,

Leucadeae.

ella. MelasHwh
chyopsis.

Hist. Nat. 2: 154. 1815.

3rt, scarcely hooded; nutlets fleshy or dry and
Wall, ex Benth.

af., in Fl. Tellur. 3: 84, IN
as "Synandrines." TYPE: Synandra
Amer. PL [JNuUall| 2.
Non-molecular features: inflorescence ra

II . I, ii h II i .1 III hi I i i, 1

identify all or mos

, of this diverse clade. 1

I II I,; 1 II

V. . ■:■:<;,!.■ ■■'....,

, [Asteraceae]), Suzukia Kudo, Thuspeinanta T. Durand.
fhlomideae Mathiesen, I rib. nov. TYPE: Phlomis L.,
Sp. PL 2: 584. 1753.

the following generally

:
branched hairs usually present. Br., Prod. U. Nov. Holland. 504. 1810.

.,■,',■:.'.■ ':.;.",'. i:'.'l '

deremoslachys Popov.

■• : ' ■ ■ ' i ,1 ,i ' ,! ii

,;!. :■ :■.■,■: ,

^ ',r... C,'/. ...:/,-...■/,■.

unpubl.). l5<-iilli.. AM •■ r[ (Scheen & Albert.

6. Leonureae Dumoi ier) 46. 1827. 2007 )-

1. 2: 584. 1753.

•nation; leaves GkNKKA InCKKTAK SKDIS WlTHIN LAMIOIDEAE

\\ illd..' Lagochilus Bunge ex The six S enera &*»»«*, Colquhounia, Eriophyton, Galeopsis,

Benth)Buno-e lle " or exlsl "

monogenic clades in

ii . ! - •'

Leonureae in a molecn

eilher in a lai in a dado with poor

"Lamioideae." TYPE: Lamium I...

: Ii •.!,■.,

! lrill ° i^L»ni<-<-ao thai
1YFK Mo/rafcium L., bp. Fl. 2. .^.^ ^ ^ ^^ ^^ ^^ ^ ^ & ^^

publication iieii!

REVISION OF THE ASIAN GENUS p. a van Wehen 2
KOILODEPAS (EUPHORBIACEAE) 1

i 1 1 si 1 1
. ..

Hasskarl (1855) described the genus Koilodepas

" ii I In

m' filaments are

H I ill i

■■■.■■

419), Pax and Hoffmann (1914: 268), and Croizat

'I '-■ ! i I . . i i

I II '

I ii i II !• i

■

in !■■.;:■ id • -•
i |

Koilodepas is a small Asian genus (nine species

mi mI II

- valvate, petals

II Hi i Ii i

I in In in .i n i| ii .|...m We nice ( I9V-.) ■,
.1 i I i i ill in i II .i

"I: ■. ' If I • ■

ll Ill

M ' II ill, ,11

doi: 10.3417/2007149

\kn. Missouri Bot. Card. 97: 218-234. Pub

:

' ! : • i 1 1 . i i ; !■■:

Airy Shaw (1960) divided Koilodepas into two
i broad calyx lobes that strongh

■■■" : ■ ii.'iRl \

:

stinction between

Mi!.; ;■: .; ■ i i ' !■ ii ■'..

■ \" I i I ill •

same character i

T!.-hi,:ll

revisions, Airy Shaw stopped

.

It:' : "

III I II

■ , ; ■

'•;:w:inn : I'!"
; :;r> ■■■:■■/

rulate. The stipu

tnargin

. !: , s ■= ' i il ihlhi"
: I'M i; ;.'! >

i'' "HI i Ml • ". • '.

fray along the parallel nerves; these separale

"\ - iii -

:

of the old stipules (Fig. IB).

e between brownish green and
specimens diy brownish.

be somewhat ivvolulr. '
.ui Ii sides of [he midub ill

t is typical for K. )W? cuneate base.

in); the stipules ofK

-:!) or il can completers hid

■ii in ' i ■:;!!

some species (K. bantamense, K. i.

i i

The style is the part on top of the ovary where the
an be absent or present, depend

bifurcations. The number of sp

can be several to many times. When the nuni!

islow,themdivi

. Mi :■ ,!!>!<: ; ;■

[Fig. 2G], K. calycinum, K. hairmnense, K. pectinatum)

Taxonomic Treatment

Koilodepas Hassk., Verslagen Meded. Aid. Natuurk.

Kon. Akad. Wetensch. 4: 139. 1856. Conceveiba

.k.) Kuntze in T. Post

& Kuntze, Lex. Gen. Phan. 138. 1903, orth. var.

in -In ,
Kew Bull. 14: 383. 1960. TYPE: Koilodepas
■
Calpigyne Blume, J . H PE: Calpigyne

,■,,'.■/■.■,:;■:/.:,

:lus poihttwl (kitiiiep. (= koilodepas

TYPE: Koilodepas calycinum Bedd.

Trees generally small, but can range lo 27 m
(Koilodepas bantamense), i

■■'•■■ '•'•'": !■ -'I ■ '

II-':.' ■■;■■. 1 I, ■■ . , ■

I I I I I ill , i I II i

:■■ i v.i:

■

I i

:

' , ' - I | ill

i ' "ll 11 ' ' , i I • ill

' ■■!■ ■ iili li) ■■ II !i ■ . ' . II

'II ll' . I'll

(in some species. to cover the fruit),

I I, i ,

Discussion, Hasskarl (1855, 1856) first used the

. , , , ,, or „ loco , ^ T . . ,

^ i n I I v -J J ■ 1 1 1 1

, • ' ■ i .:•:.-• a

,,,,., . , tvpc of the genus

',/■// / \ * l J T-l • •

• I TT 1 I 1 1- 1 1

aha ill I i . ,, . . "' , •

;?ra/ Nomenclature

Kn totiik Si'KciKsor Koii/)i)i:i>\s in Soitiikisn Asia and VUi.ksu

. ■ . • ma ;■■. 1 1 :-t ■■■! i .

1.3 11.2 cm, drying greenish or brmuush. margin (entire lo) serrulate (to

■ i • i' ill .•
ill 1 '.. ,ii

ting, separately visible 8.

.; i i .

,. I,: I :■; I I, . '" :,:.! ' : \ : .,- I'T

long; stigmas 2-3.2 mm long, stigma I

■in ll«; nun iirri:"

■ .. i:.|; ■..■■., :.;■ ,: M . a I , : ' .ill".

.■ ■ '■ni.a.t-. : !..■■■■

lobes connate in lower i! India, China, Vietnam,

" H.a - was i,ii,i ,i hill i aa',a I . >, fs: a ' .. ' ." a

ii; pistillate calyx lobes

Koilodepas

Meded. Afd. Natuurk. Kon. Akad. Wetensch. 4:

140. 1855. TYPE: Indonesia. Java: originally

intam, type from eultivated tree in

(holotype, L! [barcode L 0016250]). Figures 1A,
B, 2E, G.

I.-. ■■:■•.■.■.: ! >

.. ..■,:.';,■.■■■; ■:..;■.
(lectotype, designated by Croizat, 1942: 49, L! [barcode
>|. photo A!).

TYPE: Malaysia. Penang Hills, s.d., G. Poker s.n. [Hb.
KD 5017 (holotype, K!; isolype, L! [barcode L

-■■< : h!ML

, im.Ih- 1.5-1 mm diam. Outer bark

gray and gray-green to gray-

■f >i\\.. II ;■.■,■■!

lar, 2-8 X 0.6-1 i somewhat erase

>

"/.!;■ I .,':■ ' Li,:',

ed, lobes inconspicuous, extern;

v --■■ ir.iil.-. ■

3-locular, 2-3 X 1.5-2.7 mm, style 0-0.3 mm,

i
i ■ i i

nata, 16-18 X 8-11 mm, yellc

.i 6-10 X 4.5-7.3 mm. Seeds
7-8.5 X 7.2-9 X 6-8.2 mm.

!,'. ■.■■;■.!<■: i : I ■
( I 'i

yellow-red loam above a granite or sandstone bedrock
and November.

. " . . .;:..: . i :\
, I I I . I ■ • ■ ■ I

i along the basal midrib,
secondary nerve often somewhat

-. ■■ !■,:..

in bud to gray-yellow whei
flowers 1.2-2.4 n i angular, 1.1-2.2

X .. I X

■

i. mens I or 5,

androphore 0.7-0.8 mm high, filaments 0.7-1 mm

0.3 X 0.3-0.5 mm, thecal

2-7 X 1.2-2.3 i n g ft tl

i have generally

oil II II >ll< .» il-i: ...

.in ii i,,i ii ii i { mi i ta:\ II i ., I I ,

ii ill. r

■; .. • .•■.■■■;..</, ./.■:■■.■

.,.■■■•■;■<,;.■,■■;.•■■,

■:■; II"- i r; III.'

The calyx of tl.-

''II.'". : . >"l !.■!.■.■■

II I.I I 1 I, I ,' ' I '

IMii "■:■'!', .i»\:>;||:. ■

more character il

species: K. longifolium has very small glands on

marginal teeth of the

apex of the marginal teeth. Dried

■ specimen) has a ve

■-. ■! ' ■

.-

- | i ill , iii 1 !

i .■!■.>>■ i:'. ^'i ilr. ■;:!;.. \

,:■;!>• I .:■:!■,:

. ■. iiv;;l: :;lh

: ' il' . i n

the result of mite attacks (Lorzing 16329, L).

;:',li:'l , ...-:,■.• .;.,■'

frutescens were traditionally and previousl

ii ii i, < ii '■! ,■ I ill

van den Brink f., 1963), Sumatra, and Borneo (Airy

I ii

fied as K. bantamense and (

II II III nil I ii , ,

I ill . 1. ni

Blume (1856) did not indicate the specimens he

,,■■..■■.-,/.■:.. ■■. ■■ ii ■ -

■■■;■!■: I

be re [raced (the) were probabl) a ver\ difl

Croizat (1942) indicated that his

ii; i;i ^' " . .

.■..■.'■

, j! : .u, •(.(!.:■ J
Il ,ii | i ii

: : -].<■'',. -I.,-.

; ■ ,..„:;-. ". :,i

■;.

mil s./i. (L 003 1788).

tang, /. A. Lorzing 16329 (L). ' MALAYSIA. Negeri

mbilan: Compart. 8. Gunung Angsi, H. S. Loh FRI

343 (L). Sabah: Tawau, Tinagal Forest Reserve. ,/. Singh.

SAN 48984. Sai

near Patthalung, R. Geesink, T. Hattink & C. C. (

:

•'.' ; .): , 4 1,11;

l! ,, II .,1

">■, :<awi]<Mla:|.v;iiK h\-r:-.'\ r-s :

80. 1926, as "Coetodepas." TYPE: [Malaysia.
Sabah:J British iNorlh Borneo, i
July 1924, D. D. Wood 1291 (holotype, UC;
.'{). Figure IF, G.

I960. s\n. no\. koilodepas hrei ipc.s Men: \ar. slcno-
sepalum (Airy Shaw) Airy Shaw, Kew Bull, Addit. Ser.
4: 138. 1975. TYPE: [Indonesia.] Borneo: Gunung
Sahara, Belajan River, 16 Aug. 1956. L. 1, Forman 442

.,.■!.-, luv!:-. i '.

i " !■■■■ '.:"■' .

III'! 1 I i\

in 15 per side,

' ' . . ■.';■■.■■:■: J

im., green to pale white-yellow t(

dyx 1.3-2.2 mm
0.7-0.9 mm, sul<

triangular, 1.5-1.(5 >
ding in fruit up to 12

. ■■. i: !l U, !! !■ ,

it; ovary 3(4)-locular, 1.8-2 X 1-1.3 mm, style

"! -I. I !! I.'i

■:■■,!,■■:■/.:.
8 mm thick; columella 7-8 X 8-9 mm. Seeds ca.
6-6.5 mm.

I phenology. Koilodepas

1 1 II
and August to November; and
October, and December.

Vernacular names.
tan Timur: kaju gading.

Discussion. Airy Shaw (1960) published Koilode-

■V.l. Ih.v.;-.-
fferences between

sepalum. The cal tillate flower are

Mate sepals, which a

.. ! ■■■■

l -i,

>°40'E, J. P. Mogea
ca. Km 20, K. Sidiyi \ Tumbang Sah, Km

.. ihii > n

' ■.■■.■;.■ .■■,■■■■ J ;■
(L); Bulungan, Sebakis River region
13949 (L); Berau, Tdg. Redeb, Kelai River near Long Lanuk,

''., il in "',
i „, I

:

^ ' I ■

■;,■„; I',,: I;

Sinanggul SAN 57289 (L); Tawau, Sub-compart.

"Cnelodepas." H I'K: hului. Tiimevelly Hills/
A'. H. Beddome 7329

ck, shiny gland I

5 mm, somewhat

:'.ii, : ;•*■ . '■: II ,■ « ■ ■

IIC ... lil'l li If ■ -I :: I ■

I . II ■ ill'.-

Ml li ^ . I ' li

1 mm, margin eni

i

pubescent on both g

II ■ , .'
ca. 6 X 6 mm. Seeds ca. 6.5 X 6.2 X 5.8 mm.

:

; .i: II .... ■ II : f:

Welzen & Muzzaz.,
sp. nov. TYPE: Indonesia. Sumatra: Atjeh Prov.,

' . ' i ■r,i'l\ (.■'..' 'I. r,.ll

2°55'N, 97°57'E, 25 July 1985, W. J. J. 0. de
Wilde & B. E. E. de Wilde-Duyfjes 20339
(holotype, I.!).

>■■■.-■■■■ ,!!, in . .

,-■.;•: I! :■.. 'Ill: ■!■.■ ) . • " I'

ewhal

slightly bullate between the nerves. Inflores-
i to l() cm. pale gray-green to pale creamy

ral nectary at base, bracteoles

sulcale, anthers ca. 0.3 X 0.6-0.7 mm, thecae
divergent, yellow; pistillode 0.8-1 mm, 1- or 2-lobed.

bracts triangular.

smaller, 1.2-1.3

■■ ii ' ' ■ i

to 5 mm; cab

fruit to ca. 8 X

II in .!

ca. 1.5 X 1 mm, stigma 4-5.5 mm,

'■.M-lHIII: ;:

6 X 4-4.5 mm. Seeds ca. 6 X 6 X 5.3 mm.

hi Int. and phenology. Koilodepas

: in. i i-'l ii i

: I ■ ';. hi.'.:iii '■ :

lnerable (VU Bla) according to IUCN
(IUCN, 2001). The species is deemed

i )

I

(De Wilde, pers. comm.).
Discussion. Airy Shaw (1981: 311) previously

I ; ■.!■<■ 1 .1:'. -i li

I, I ' li ill 1 1

1 1 rv brown and

. , 1 1 ■ . • ■ I - 1 ii

Ill .' ,

I III li II,

and of which I
-' n

' ■ ■ ■ ,,■;':' i. hi ii li . <

Paratypes. INDONESIA. Sumatra. Aceh: Gunung Leu-

Pucuk Lembang. 3 /. 0. de Wilde & B.

. i I!.,,.. , <!,,«■
Gelombang, S of Bengkong River,

i m!, II

. ,i II"

! ,.;■ :: ■,■■■■■■

5. liollodvp^ l/iia-l.ii.sijm-':!,:' ; .^ "

nold \iboi 2) 51 L942, as "Coelodepas."
■■■■.■■ :i ir , J. 'ii ii. id
Arbor. 6: 135. [30 July] 1925. TYPE: China.
Hainan: Nam Fung [Nam Fong/Namfeng], 21
Mar. 1920, W. Y. Chun 1092 (holotype, A!;
Figures 2D, 3G-I.

■..,. I ...
.. n,.i., .,..,.

: isotype, P!).

igh, to 4 cm DBH; flowering

■■ ■■!■■!■■:■■ J.

:

ole 0.5-1.2 mm,
somewhat flatti lliptic-oblong (to

ovate to obovate), 6.5-22.5 X 2.1-7.5 «
width ratio 3-3.5:1, drying

■ . ■.li.liM I III. I..

■;■'..■.-.» id; niih, ;

, ,, , .. ,,. ,.

sulcate, anthers ca. 0.3 X 0.6 mm, thecae divergent,
yellow; pistillode ca. 0.3 mm, broad. Pistils

, broad-triangular, 2-3.5 X 1.2-1.8 mm;

.
1.5-2 mm. m I

1 mm, green with

ili'l!

6 X 6 X 5 mm.

bitat, and phenology. Koilodepas

hainanense is fo ainan), northern

ii i ii

June and fruits in March, April, May, and August.
Discussion. Airy Shaw synonymized Nephrostylus

hainanense is considered a

• '».r ■ : : ■

fin village, C. V. Lei 536
THAILAND. South-eastern: Tral Prov., Koh Chang

::. :' . :.

round Ao Yai Hay, 1.2=00' N, 1 02=40' K, C. F.
van. Bcusekom & i ho\.. koh Chang

Island, near Had Sai Daeng, 12°00'N, 102°40'h,

; •■' ..■/.,■;.: M,.:

.:
western, Nguyen Nghia Thin 010

Airy Shaw, Kew
Bull. 36: 609. 1981. TYPE: [Papua New Guinea.]
Terr, of New Guinea, Central Distr., Port

Veimauri River, 6 May 1971, H. Streimann & A.
Kairo LAE 51550 (holotype, K!; isotype, L!).

Trees, to 24 m high, bole to 18 m, straight, to 38 cm

i ■ ii i i

lies oblong-ovate, 4.3-9 X 1-

nerves 11 to 1

' ■■.■; :' i i

■ . ' i- 1 in.. s!-:i i

3S almost completely free,
ipex rounded; stamens 4,
filaments 0.5-0.7 mm,

■■ ....
id seeds unknown.

1

arrow, mainly entire stipules, the leaves drying

■':<!•; : . ; i li-
re Ml. It is the only

23: 83. 1969. TYPE: Malaysia. Sarawak: 4th
Division, Bukit Mersing, Anap, 24 Aug. 1964,
Slbai ak Luang S 21928 (holotype, K!; isotype,
2B, C, H.

Kew Bull. 14: 388. 1960. TYPE: [Malaysia. Sabah:]

..': . !,.:..■ ii. ."..: ■■:-■.

1932, P. Orolfo 1821 (holotype, K!; isotype, L!
| incorrectly as P. kny

111 Mi I

: -

; i mi ml i , I / \

lands absent. Leaves with the
neled above; blade elliptic to

II him I mi; till

nil' ii i
margin irregularly entire, seldom with oi
illie apex, flat, apex acuminate t<
abaxial surface glabrous, n«

i\.iilii , ; l !;■■■,■. I. I: f.'. Ill

ca. 0.6 X 0.6-
filaments thread white, anthers

•nvers ca. 2 mm

i

ca. 2 mm, extendi;.

erose; bracteoles li
0.7-0.8 mm; pedice

fruit; calyx with 8 t

! ": ; -I:'

ill !'■ Ml; II ■■!■:■. ■■ ■ '. ■•• V

8-10 X 8-10 X
ibitat, and phenology. Koilodepas

and August to C II n and Vugust.

Vernacular names.

.uti (Iban) (Airy
Shaw, 1960).

.',<; ;■. :. h" .hi Hi;

' Ml ill I , I ,i

; .*■<■!<■, .;:.:■ i '

Figures II). H, 2A

, ,, , „

. 'MM ! , ,
, .■:!■!:;• I IN. l-l I.

Gibot SAN 100030 (L); Pandewai

Brantian, Kalabakan, K. Muroh SAN 75304 (L); Sandakan,
.mipuit. 13, D. I. Nicholson SAN
C. E. Ridsdale 1965 (L); Kudat,

" I ,1 ',1 II 1,1 I

■■::■■ ;],) ::,.

II 1| II | lll< h II hi II : <i 1 In I I

!\5195 (L).

I. 'M.

Coelodepas subcordatm." TYPE: M

■■■,■■■,,-. .'"M"'

late caducous, n upright teeth (to

uliilli piili.c.le .* ; ' -J (::;i!.. :'.:).. i'|.; I: ;KK: ■:: Vi[ ; - » el II i pin;-'
of. ., (I !.■■■.. .''..■■■.
-,l

ill II.'.
ill I. I

■ ' III.

and basal nerves (Borneo), p

■.; '■■■■■-■■

containing a short spike of bracts. Flowers pale green

.';.■■•:/;;.;./?/"

1.8 X 1-2 mm, sometimes sp

■ ■ !..'• .".•'II I ; "ill '

I

:

I ----- 1 1 ■ Hi; i -'!

: :

.■■■■.: : ■■■!■!■ i i -.'I

ml i I ii

ibie. Fruits lobed regmata, 12-14 X 8.5-

X 7-7.5 X 5.2-6 mm.

ling Singapore), Sumatra (Riau
and Borneo (Sabah, Brunei,

ii i i 'I

(I, sandy clay, or

II II ' i

6 ' 'uppTr

S 8292 (L). SINGAPORE. Nee Soon, Hardial 352

[K); Botanic Garden,' Jungle. Jan. 1915, H. N. Ridley
%): liolani. (.aniens" jungle. ./. Smtlm, SF 10608

Ko'iodefmB p-r-.r li-.r ■ '

23: 82. 1969. TYPE: Malaysia. Sabah: Lahad
Datu, Block 62, Silabukan Forest Reserve,

SAN 39941 (holotype, K!; isotype, L!). Fig-
ures IE, 2F.
(Shrubs to) small trees, to 17 m high, bole to 11 cm

'.''!M NJ [(;■

species concept mcnse-K. haina-

nense-K. longifai discussion under
K. bantamense) appeared to

syntype

i I .in I ill i ill i i
specimen, If. V. Ridley 6481 (K), is

Additional specin
iungai Rampayoh, 4°22T>

tUNEI. Belait: Labi,
I J. E. Coode et al.

Ashton SAN 17558 (L).
I. Sumatera Selatan:

Compart. 64 EasL. 7

...■;. ,< : /. :;■■..'
. .:

Burkill & M. Shah ings, South Pangkor

:

I i. t I . ,

part, with second teeth. Leaves with

petiole 3-15 mm, round to reniform near hi

IK' !■ .'ill

'

0.2-0.4 mm high, filaments ca. 0.7 m

in i. i In X

sepals (6 Lo)10, free, ovate, 3-3.3 X 1.2-1.3 mm,

'!' l- '■ -■■■

iii.-i, 'ar ■ ; ' ■ . ■ ■ ■

■':.'■ -■ ^ ' I I "

I I ii : I

ish to brownish: n. Seeds obovoid,

8-10 X 8-9 X 7-7.5 mm.

bitat, and phenology. Koilodepas

imingly rare in the

Stone & Sidek 12616) and mainly

Kalimantan),
jtidary forest, logged-over forest,

limestone. The species flowers in March. April. June
Discussion, Of the species in the genus Koilode-

'.'■I ■■■!■. ', !■■•.

. 1963. Notes on Muhi\sian and other

Euphorbiaceae. Kevv Bull. 16: 341-372.

1975. The Euphorb

mantan Tengah: Upper Kauri

i

rea, permanent growth and yield plol

.' Yk Y

- . ^ . ' '. ■ -in -.in.. :

... I. j:, :,,„■,■:!
Pinansali. I'i.ia.i»ali ko,W li,s,ne. Amin cl at. M\

Coupe 1972, /. Chou SM 75
Lian unlogged area, F. An.,

■ !a a,.

:■ ■ - IY.-I .;.
adani & Donggop SAN 133305 (L); I

:...■:.■:, .■/ '■ . ...

: : "• .-.i.-

•,' (k); Sandakan.

I i Li,

SAN 99463 (k); J

ah Forest Reserve, D. Sundaling

' sSA.\'(>; .

.. ;■!.:;,.. ;, .,Y
landseh-lndie in h< I wild groeiende en in luinen en paiken

Groningen.

■'■

Y Groningen.

E. J. Brill, Leiden.

a Euphorbiaceae from the tropical

' , i ,n,l.' , • 'i

• ; ;, ;,■../.",■,■..

Poilaniella, n.g., Prosartema, Trigonostemon). Bull. Soc.

72 48-470.

lull

lijke Akademie van Weternschappen te Amsterdam.

4: 135-141.

, I...'
secivlaris dei INalu| u |ikundi»e Afdccling van de konink-
lyke Akademie van Weternschappen. Bot. Zeitung (Berlin)

Excluded Species

as "Cod sia. Borneo:]

Sarawak, Baram Distr., Entoyut River. 13 Nov.
1894, C. Hose 465 (holotype, K not seen; isotype,
L!). [= Claoxylon hosei (Merr.) Airy Shaw].
Airy Shaw (1960: 391) already noted that the type
'. : . ■

■. !! i- ■■ ■ li i '

Silwi.J. E.SkofU.

2006. International Code of 11

colson, J. Prado, P. C. Botanic Gardens, kew. Richmond.

N. J. Turland (editors). \\ chstei, I u n< ra and supra S ene-

.lanical Nomenclature ric la\a lissouri ISot. Gard. 81 :

33-144.
Mavae 1(2). C G. van \\ urdack. K. .).. P. Hoffmann ,\ \l \\ Chas. 2005

. i.oi. ^"' !."".'"

ORIGIN, DIVERSIFICATION, AND Steven J. Wagstaff* Murray I. Dawson, 2
CLASSIFICATION OF THE Stephanus Venter, 3 Jerome Munzinger,"

ATTCTnAT ACTATVT ^T-TVTTTC DaTTeil M.

AUSTRALASIAN GENUS Knstma L Umson ,

DRACOPHYLLUM (RICHEEAE,

ERICACEAE) 1

'!:•:■ ■■■. ,.;! '. .' ; ',■.

species richness and i md. We investigated evolutionary processes that contribute to this

distant relatives in the

I ' I !

',; •■■: :.' ..i,

l,,|M| 1|, 'l| |

'

/• Ill

' ' ^ " I I i I i il

■■;■,■: . ■'■■,'■ I ;■■.■:/,»

Due to

isolat

hence

often co

nsidered to be

s ots of

. oceanic

et al, 2000; Ei

of

i , 1 ! i i , 1 1

et al, 2007). 1

I II ' I ,. ' I

, \ I ,.■!,!■■■:■ .nu-
ll I |l

L 11' Svvensen.

' \\ ;.,,, II I ,![,,,, I, I,

ii :i>, i vim; ■-. ■■ ■. ■ ■

Caledonia. IKI). UMH '.1000 hancc.

ii ii h m II i I
6 School of Plant Scien 1 1 . Australia.

■'"•■..... ■ ■ ., .

.027. Australia.
117/2008130

5S0URI Bot. Gard. 97: 235-258. Published on 9 July 2010.

■

II Il " ill I ' i I I

■. .-■■•■ I ill: ■/..■

hi I I ■ I

Hi i

>:■*>■.■ I'l :' Hi

species richness between ci

I hi; ui ' , , < I .ahull, i II , n i I

"!■■■.,' v !

i i ' I «

mainland Australia and Tasmania (Oliver, 1929,
iter, 2008) (Fig. 1). About 51 species of

14 m tall (Fig. 2A-H). They a

'- in mainland
.».. IWcll. 1902: Broun & Streiber,

i I I , !

■.hi,. I'.'oi..

Three subgenera of Dracophyllum uere recognized
by Oliver (l')2
species have been recognized

ius (F. Muell.) W. R. B. Oliv. (Fig. 2K-H);

-■■'!■'■ ■■!<;

Dracophyllum (Fig. 2A-D); of these, seven are

L<» hi!!!

-|)C(i<^. D.

involucratum Brongn. & Gris
New Caledonia (Fig. 2E).

S\ tematists have long recognized a close relation-

■ I:- ;m ■•

<h >:■>!;/.:, !■,(■■■..

• ;h ni:'.l'l ■. .. :::\c • ; ;

■
(Fig. 2I-M) includes I I six ■■

Ml II ill , I I III III 'I i I I I M V. {■ \

(Powell et al, 1996, 1997; Paczkowska & Chapman,
2000). Unique mo et al., 1996) and

once shared a cc ose descendants

Crayn & Quinn, 2000; Krc

sampling in previous studies.

I! II. ■- : 1 ■ ■ I r ■.■ !.:■'. ,i

tnsequence, they

I li| Mllllll

■ Il" I

ill I I < I i I

range to

The Ericaceae have an ancient evolutionary history
(Collinson & Crane, 1978; Nixon & Crepet, 1993;
Jordan & Hill, IS e, 1996; Jordan et

lized insect pollin

.1 Unison & Crane,

er & Hesse, 1996). The appearance of two

crids suggests that the group

II hi , I I! ill

ii -i ) ■■■:■■ ll !l p-ll

.' ■:■:;■: hh,

& Hill, 1996; Jordan et al, 2007). Fossil
fragments of Si iding fragments

■. ;ii.v> ."i...'.

i I i I Hull II ' a II. I

Origin of Dracophyllum (Ericaceae)

ias been observed in

species richness b

Tasmania, Lord Howe Island, New Caledonia, and

New Zealand?

equencing techniques general I
>y polymerase chain reaction (P(

3 evolves a

During the 2005 and 2006 field seasons, we
conducted four collecting expeditions and obtained

. : 'II,
I; I

3 DNA samples that

Mi I

(Dracophyllum, ea, 10/11 spp.;

were selected to provide a diverse represe
Australasian epacrids, as well as

rubra R. Br. and Sprengelia incarnata Sm.

The study group is listed in Appendix 1, along with

'I i

:

nes also used with difficult

D.M.C.) for earlie caceae (Cherry et

election of matK

(Table 1) gave us better results than some of the

ccessful for epacrids).

:, „(V ; i I:.
: III ;ii.; ;

reverse DNA strands v

|....|: II I » , I -,'■, .'I;'. :

dried using silica arium specimens,

Clifton Hill, Victoria. \u

i nded protocols. Most extrac-

\-i:..i.all\ '•!■■ i '^ ' ■-..-.■■■.

:;>;e. P. Close-up (

' ' ' '.. ' |.;>.| t\'. *

ATA TTT ACT TCC ATT GTG GGT A AC GTA TTT
GCA GTT ATT GAT AGA CAG AAA AAT CAT GGT
TTT GGT GGA G( \C CCT TGG GG

AAA TAC GTT ACC CAC AAT GGA AGT AAA TAT
ACC ATG ATT CTT CTG TCT ATC AAT AAC TGC
" ' ' •■:■ <;c,-:

TGA TGA ATA AAT GGA AAT ATT
TTT TAC CCA GTA GCG AAG AGT
AAT ATT TCC ATT TAT TCA TCA

The parsimom anahsis was conducted using
PAUP* with ti

ipping, MULPARS, and randoi
with 1000 replicates. Duplicate trees were

' ■'. ■!! .: !i. ;i| ■■;■>■:<

I;;: !■'! ;■;■ :.<

( I! , ■ I i

''

of Simmons and Ochoterena
i, treated as

■■> ' ii>.',.- •

; 1 1 1 I

i length difference (ILD) test of Karris et

Support for
rap analyses (Felsenstein, 1985), with 1000

■ sites; starting

I'll or ,'.•(:■

i-swapping, MULPARS in effect, and a MAX-
limit of 1000. Clades with > 90% bootstrap

considered well s

The most appropriate maximum likelihood model

: ,

INI "

model averaging

(|V,..;„|r .'.' .

■ ■: ;l ,.;■: da '

.!.'■; hi:.. : , !■:

I • , 1 1 II i , | I 'I in!

i I

algorithm to ac< logcneity across

>!■;■. ;l|r< II

I; 1 ID II

)03). The initial r
bootstrap search, and 100 rootec

Origin of Dracophyllum (Ericaceae)

!!,,:.' A I, -,r. . ■ ■

i likelihood tree.
A fossil-based cross-validation procedure was used

I .1 ii <

of Lord Howe Is! sed age of 90 Ma

:iv.-il:, ■:: .

, m I - )

We used GENIE version 3.0 (Pybus & Rambaut,

- i . i . I

Lough & Nee, 2001). However,
several evolutionary processes can cau-r

i flattening of the slope,

tree. If the e

im. = ■■■(; -:

absolute time (Sanderson, 2003).

YVr mill i I i ii , | j I v I In mi | , ,1

Carlo (MCMC) searches using BEAST version L.4.8

H58' .
I , i

'.!>■: ■■ h :^ ■ ;| ,,,■, ; ,|V I,! ■:

I I Hill i

;.'.d ■"■ : I •■ . "ii li'MH "

■: , :T',!I - i i I

BEAST version 1.4.8 allows the incorporation of

!

97.7 Ma and 82.9 Ma for the

40.4 (43.9-37.2 Ma) for the MRCA of Rhot
■34.7 Ma) for the MRCA of

■ ■ i • vil.r \ .:,"

I, i I ' ' ! 'I i,l'

Mi ii 1 1; III ii III I Him I i inn li III hi .' u

i i,:l ill

Nee, 2001).

I - in i ,

188 variable characters were parsimony

■

ids of 700 steps

| i 1 1 I |

RI] = 0.755). A

I ■ nhi r I i

sequence and gap characters, 840 were coi

ii il I i i nl i

consistency]

,„io,, The gl slat

from one million randomly generated tre<

n Total clvu

MPTs Tree length CI RI

gl ILD test

rbcL

1402
2935

557

11177 700 0.513 0.755
432 1452 0.526 0.772
36 2166 0.512 0.775

-0.618 —
-0.502 —
-0.537 0.11

„ ll, ,!,!!

trees in a shift]

. trees are com-

(Fig. 3).

Because of the lack of conflict, we combined the

I '■:■■■■> ■" •■! ' I' !■■■■■

u'i ill'.' ■.-.

■■ -liar k !■!■'.

trees in two islands of 2166 steps (CI = 0.512
clades that were supported by the

Ml l

ill.- :' , •:-; I
!>. 1 ill

five New Zealand species of

. :

D. travers

• : ■ i ■■ i i .'i

■V.'/.. I... > .;:!

from New Caledonia (clade C) (subgenus

lis. D. IIKIC-

I ,| ,

" ! ill ;.;

from the members of Richea

' ■ ' :■.:.;<!;:.) I 1 ,.. .'•...

Br. & N. Streiber. formed a fifth clad

(100%), with the Lord Howe Island endemic. D.

' ■;■ i;-:- •-. .«;

wi Menadue, R.

>lia Hook, f., and
R. scoparia Hook BS, and R. gunnii

Hook. f. and /»'.

: .''. ; ; :i ;■■■ >■■

.

I I ii

)f most species of

'I: ' •- . ! I 5 »,'■',:

y a unique 6 bp

members of the Ericaceae m

(clade H) (100% BS), and the
omy. These three

Origin of Dracophyllum (Ericaceae)

ted the genera] lime reversible
model (GTR + G + I) with an

I! mi , ii ii

'

1 1 , i • : I i ill

ere set as: A - 0.3074, C - 0.1654, G -

0.1871, and T = 0.3401. These settings were used in

»od and Bayesian inference

A heuristic search using maximum likelihood as the

■ ■ .

..'■v. i I .<>: . ■!.
■ '., .■'-■;,;; ■;;,,■

l.r,in,'. !<■:■. I ■■ ■
;,■('■;,■■■','? , :i ! , ■ ■ ■

i i , i i i i I! ii | , i i ili
tree are approach ior. Nonetheless,

- :!■■:■. u r i i ■: :■ i .

16959.605] =

; i:-'"> ■■ '■■•■

gence times in the a

across five smoothing values to evaluate the quality of

i In 'I
that were selected for the r8s analysis. The

!' ■ i

''■I - I .■ !■'..' Vl-ll

M|| '| | _ ■

up to 4.5 milhoi

four of the five sir

> ;, in

'• i ii .

d; i,v. :■:.■:

100 BS trees pre SD and range)

' I J I Ii

■ I 'I ' Iii ' ili

± 1.0 Ma (range, 2.6-8.8 Ma compared v

.•I I ii 1 1 . ■ , „

1.1-7.7 Ma and 3.5 ± 1.1 Ma; range, 0.7-6.5 Ma),

1.1 ±1.1 Ma (range, 0.0-7.1 Ma). Zero-length
branches were collapsed in the r8s analysis, and in

lated. This was n How divergences,

ss were younger

:■ "I I Th-

interval of the HPD of 6.9-11.2 Ma.

We ran two MCMC chains, each for five million

5% (250 trees) were
and the tree files were
e combined tree files
lie 95% HPD intervals for the

identified with PP > 95% pro

I! <■ I -I', ;■■' ":;l '
ii < il i

I: ■,■■,..■, I' I, i,

ie well supported (100% PP); these

: ; Hi:"

/ / / /'

Mya

, ,ils(.l lli<- HPI).

das means ± SD wil
ntervals of the HPD.

q parentheses,

while ,l,eB, y e s i a „es< i ™,es, r e presented

Me

"lj 1 IN

likelihood (Ma) Bayesian (Ma)

v Zealand radiation

and D. menziesii (100% PP) each sisters.

The New Caledonian species of Dracophyllum
lade (100% PP)

, >,sr \ irot and
(100% PP) that is sister to a clade composed of D.

aiium. and D.

ii 'i

III '■.!.■■■; ■'.

II mi

. .■ I I'l i Hi, i , I'l'l

). oceanicum, D. secundum, as

11 In in, ill Ii

i I- ■ " i"l
panda ■•

In the Bayesian In

I '.;>

Richeeae rciv

Hemisphere epacrids (clade J) (100% PP).

■I. ■-<■ ■■ ■!

■ (I' ".. ,■ ; .

i|i:..;!i|..|| ill i;

a departure from this average

.i i.;.;Ti ■.'... ■ IV,

Richeeae (e.g., Sphenotoma, Richea, and fi

l - > ■ . II

Caledonia (Fig. 7C)

during establishmer

it. Most of the net diversification

in tribe Richeeae 1

million years, as in

cheated by the steep slope in the

lineage through lir

(Fig. 7A-C).

Origin of Dracophyllum (Ericaceae)

I I 111 ,11 III;

cated that only Sphenotoma i ph\l t 1

illi i I < , , II ..,,

species of Richea were lumped in Dracoph
taxonomic bias is superimposed on ;m <

• .

'I in

'' ■■.ih-ri ; „■;' -.';
:;•■■■:■:■., .H J

nique instances of long-distanc

(Crayn & Quinn, 2000; Kron et al, 2002). Additional

in" i l'i 'I i ill I >i

of a single bract
• ■■ ;■' u • ;

II 1 1

lacunar, and ill et waxes on the

ul, ue of the leaves (Powell et al., 1996;
Crayn et al, 1998; Kron et al, 2002; Ven

The molecular analyses supportei

H, Fig. 4). The

; ■ . .:■ i-'i : ' !"■

Bentham (1869) submerged it in Dn

/-.(.■.',• ••;(•■."/ ■■■><;,■■■

II -I II

j. i!

!".'< <;/■ :lhi",

species (Paczkowska & Chapman, 2000).

I

by Oliver (1929, 1952). only the New Zealand

i , | 'I i

.». 2F, G). The type for su "

New Zealand cla idicting the phe-

(2008) that supported the traditional place

III) and the New

■.■!•.•!■■ 1. 1; '.In ■

I c I !'■■ ■■■::■!

placement of D. minimum, as McGlone (1972)

ill ■

• "!<;.■■■' ..•■>,■••.,,■..

, i. ,'

s are 10-11 cm X 11-13 mm (Oliver,
•roaching those of subgenus Ore

.... . .

narrow endemics. Dracophyllum sen en <

northeast Queensland. Draci

Origin of Dracophyllum (Ericaceae)

Our results suggesL die subgenus is aL best

«>nized four groups based on tin-
position (Fig. 2A-D). A pan

though it can be ateral. The bracts

rictum or greatly

i II 1 1 M

The New Caledonian species, Dracophyllum in-

>■,■<!■■■■..■■■:;■■,;:

( J 1 R I g. 4). Dracophyllum

a separate pedicel

"

, 1929, 1952), but ii

. ..:

o ' <■'' ■;■ !",.; 'ii';: n >.\

ii '■■■;■> -ikt -■.■■■

I 'i I i '!

' ' ■"■■ h :

ters (Mueller, 1867-1868; Menadue & Crowden,

each lineage could potentially be recoi;

»;>■■! n:' •;:

taken by Roberi en he described

'. ; .■:.'■:■.

:'...'■ 'i. .'■;;■•■■■■■..•■■

: .;

| ' | ' i I

To overcome the issue of polyphyl

Venter (2008) advocated elevating Dracophyllum

different name to

I M ill

onia and

of monophylel

i ii

ii .ii I"

.,!.'.« ...i ,;i -■

could be recognized as a distin

'.'■■■ .
ity to the othei

II 1 1 i ii I i

Sources of error in di

■>f>). Foremost is

:■;■■'; '■■
i, 1. 1 !.■:■■■,; I : < !.',.'

ingiosperms. We
rooted our phvlt

Nixon & Crepet,
1993). The envi >ns that existed

i I'.. .

2004; Hopper & Gioia, 2004;

> < I!

there were three months of com

summer (II 11 2004; McGlone, 2006). The forest

p. >..!.tr; en;',.

1 mi 'I i i i I I l!i

nan coastline con lerica, Antarctica,

. . . ::<*■> i:

Gibbs, 2006; McGlone, 2006).

pitted in the Bayesian

(•■ihni<->.,;i i :

I > III III II I I " III

'.hit about 45.1 Ma. Both fossil I
time period (C II & Crane, 1978; Zetter &

...': . , Ml, ill

:

'" ■; 0--.<!;|-

Northern and Southern hemis

I! I ili 1 I

) lineages. This is n

egetation, resemblin

placed on these tv

Antarctica were broken. Perhi

:
Northern Hemisphere vaccinioids.

■■ . ; rill", n-fo":
i : I ■ i . '

& Hill, 1996; Jordan et al,

■ ■<■■■■■ :

i n

'" ' '.' '
of Richeeae — both pollen and macrofossil

ill, 1996; Jordan et al, 2007,

I 'i,

1 1 in n two million
et al., 2007).

16.5 Ma (Table 3). The Western Austral

Hum and Richea

Origin of Dracophyllum (Ericaceae)

: I " ■

i.' (•■.. ;■;■■! ;ti

; inc i n

ill i ■ mii I | ,,

and progressed through the Miocene 1 1

Hopper & Gioia, 2004; Crisp et al, 2004; Crisp &

, i

1 and southeasl i

i I: •• , I ; . I' I ■

■.'■■■> -.\^,T.-,-\

:

i I < . i i i i

Ix ginning f | t 1

I i I , ■ i

' i ;i.::.f i.l llir
Lord Howe end

.■; ;<■ ,■■!■. I

al. (2007). Our results suggest this lineage diverged
lro than 7.5 Ma. so D. fitzgeraldii must have

1

a large shield volcano formed

!■■■■■ <;ii.-.

1960; McDougall et al, 1981; McDougall ■

. .;; ,■; I : II ■■, '■ ,
T,ll; ,: „ I .:;(-.■!

Australia, the flora of I oid Howe Island also share

: (1 and New Caledonian species of

|; II, II II 'I I

I. Hi I I

le

Zealand were grac >y rising sea levels

i Hi oil II is! i i i l e ii, lin in ■ ill
Middle to Late Oligocene (Cooper & Cooper, 1995;

the extant flora

ih." I ,;ii; ! ; ■'!; . •

. ' i\':i- ■ I ,-.';■.

I. (Knapp et al., 2007; Lee et

■ .: , ■ i; '■.

gocene drowning.
The recent discovery of a remarkable 20-25 Ma

within the tab;

drowning. Wc evaluated the e

i ,..

i of 7.5 Ma was violated in our

'! V

' . I : ■-,.:,;■.

II.",. | I II; l|„ v, II .
^ : ■ I ■■■ .;!.'■■ \U

-'!,■■ •■ ■•'!■ ■■

■ - II

record. It is conceivable that the ancestor of D.

.'VI ,». ... iij... : ...

are evtinet in Ne\\

minimum age esti

I dispersals to New Zealand

if the earlier lineage.
Dispersal to and from New Caledonia and New

Dawson, 2000;

H ' II, hill I! i .11
et al., 2007), but Ladig^

New Caledonia and New Zealand were indepen-

I 1 1 I

- t i

, ' . ■ i I Cl.v '.

figs. 6, 7). We

logical and genei ilv be a reflection

.ill i

, ■ ■ ■ ■

sizeable trees. However, they
■luitK and rbcL sequences. This

],!■ ■. !■:■■ .:-i ■::■!■■

1 !■ I ni ■ I, I'd I i II ,1 i

,>;i'(!i<p.';i< : in l ;

of the Southern Alps in New Zea
during the Pliocene and was accompanir

"I 'IK" ■ '<■'

cArthur and Wilson (1967) sta

• ' ' :■'';■;■■«! I; ! ' '

, , i i '

II li , ' II ; ' >. ; ' II : . . |

lian lineages far exceeds that found in i!

1961. Flora of 1W Zealai

:

nces of plastid genes atpB,
i. 89:677-687.

■ I

II I Ml III

Sapotaceae (Encales): Molecuhu evidence foi generic
polyphyly and repeated dispersal. Amer. J. Bol. 92: (><>7 07.H.

II' ■ ol lii-

Brown. E. V. i

Dracophyllum (Epacridaceae) 2. New species of Draco-
Buchanan, A. M., A. McGeary'-Brown & A. E. Orchard.

1989. \ Census oi the \ asculai Plants of Tasmania.

..j-ium. Hobarl.

I. Donnellan, J. S. Keogh, R. Leys,

■-:. Mil !■. i ,i ,

Origin of Dracophyllum (Ericaceae)

1398-4417.

C. J. Quinn. 2001. Pentachondra dehiscens sp. now.— An
aberrant new member of Styphelieae. Austral. Syst. Hot.
14: 513-533.

record of ferns for the past 85 million years. New Zealand

Collinson, M. E. & P. R. Crane.

>per. 1995. The Oligocen.

i. Proc. Roy. Soc. London B 261:

utionary implications.

R. S. 2004. Origi:

gen. Evol. 16: 238-252.

, K. A. Kron, P. .

Delimitation of Epacr

Cladistics 21: 62

nal and random noise in DNA sequences. Pp. 278-294
M. Miyamoto & VI. J. Cracraft (editors). Phylogenetic
" " of DNA Sequencer Oxford Uimersih t'ress.

Floristic Region: Evolution and conservation of a global

623-650.

.1 I ! i

Bayesian inference of phylogeny. Bioinformatics 17: 754.

Jordan, G. J. cK I,

Epacridaeeae. Ann. Bot. 77: 341-346.

■ :■..

Diverse fossil epacrids (Slyphelioideae; Ericaceae) from
early Pleistocene sediments al Slum Creek Basin.
Victoria, Australia. Int. J. PL Sci. 168: 1359-1376.

. ... vl i.

il Ericaceae from

Trans., Ser. B. 359: ]
]urtis, W. M. 1963. The

M i I n I i

. ii, 1 , ,i

■■■.. ' , ■■:, . ,i.M

Farris, J. S., M. Kallersjo,
315-319.

-966.

572.

. 1988.

Inferences and reliability. Annual Rev. Genet. 22:
521-565.

.
New Zealand. Craig Potion Publishing, Nelson, New
Zealand.

II II III!

T! ■, mi

Kron, K. A. 1 ( >"

(Ericaceae). Amer. J. Bol
& M. W. (

rbcL sequence data. Ann. Missouri Bot. Gard. 80:
735-741.

, R. Fuller.

1999a. Phylogenetic relationships of epacrids and vacci-
nioids (Kricaceac). PI. Syst. Evol. 218: 55-65.
\\ "■ •

deae). Amer. J. Bot. 86: 1290-11

, , P. F. Steyens. D. M. < i.iwi. A. A.

Anderberg, P. A. Gadek, C. J. Quinn & J. L. Luteyn.
2002. Phylogenetic classification of Ericaceae: Molecular

Australian connections l5iogeographi( patterns and gcol-

New Zealand Cenozoic angiospcrm flora in relation to
palaeogeographv and climate. Austral. J. Bot. 49:
341-356.

, J. M. Bannister & .1. K. Lindqvi

Oligocene EarK Miocene leaf macrofossils confirm a long
history ofAgathis in New Zealand. New Zealand J. Bot. 45:

The biogeography of large islands, or does the size of the
ecological theater affect the evolutionary play? Rev. Ecol.
62: 105-168.

iinersily Press, Prince-

: m mi \

volcanism in the Tasmantid Seamounts. Earth PL Sri. Lell. \l(.iris„n '

89: 207-220.

; i : : -, ; !■ ■ 'U ■ * .; „■■■<■:

:>>sl. Bol. 10: 15-29.
1. 1972. The Pollen Morphology of ihe New I'
Zealand Kpaeridac c
of Wellington, Wellington, New Zealand. Oxford, United Kingdom.

. . . ■ ■ ■ ■ ' ' ' '• '■■■■:■ .-:-i-i-.i'

1404-1405.
Springer, Berlin. Quinn, C. J., 1)

molecular estimate of the phylogeny
iai. Sysl. Bol. 16:

17 March 2010.
laven, P. H. & D. I. Wlnxl. I

1360-1385.

.,::,,.■ ,;;-.! :; ,■■■ . .. .

I',. I'M !l '■

Supplement. Trans. Roy. Soc. New Zealand 80: L-17. . ||((; , A(l , {i) . 101 _ 109

their major lineages inferred in:

Ann. Missouri Bot. Card. 79: 210
aczkowska. (,. \ e\oluli.»n and divergence times in the absence of a

We, \u-ImI ll.ua. a Desenplne Catalogue. m olec uLu II

Wildllowi N,. i, _ j_ L Th(irne< \j. wil

tralia Herbarium. <

Authority, Perth. 1656-1665.

aramonov, S.J. lW>n

ellelier. B. 2006. Geolog> of ihe New Caledonia region and 369-381.

ils impluation-. loi tli. Mudx ..I ll.e P\ew « imou c\ J. M. Powell.

luodnersih. Doc. Sci-Tech. 1RD. II: 17-30. 1997. CvLoev.

'ole. M. 1994. The New /, I —

Slreiber, N., E. A. Brown, B. J. Conn & C. J. Quinn. 1999.

■■■i :•■■ ■.'-■,■.:.»■ . ' . ■:,!>■:;:■::.■: .: v ;:/■■. /,.;,. :.-,■.,■

likelihood ratio tests. Syst. Biol. 53: 793-808. Sweet, B. 1827. Elora Auslralasica. Ridgeway, London.

1-1 . uLu

:

bwell, K. A. & k. A ' »> 35 1

IIk-ii , , I,

' ■ , ' '! ,

eaceae). Sysl. Bol. 27: 768-779. Associates, Sunde " " "

Origin of Dracophyllum (Ericaceae)

D., T. j. Gibson, F. Plewr,

.

gins. 1997. The Cluslal

Flexible si

Venter, S. 2002. Dracophyllum marmo

. 2004. Dracophyllum mackeeamim

Richeeae). a new species from New Caledonia. New
42: 747-751.
. :
Dracophyllum Labill. (Ericaceae). Ph.D. Thesis, Victoria
i ,:..:■,■.:

.: 106-160.

inferred from DNA sequences. Syst. Bot. 25: 134-149.

■ I I -Ml
\\ 1 1 , 1 :

7: 514-520.

, , & . 2005. ;

disposal Onanisms Diwisiu h\ol 5 2S7-217

' • ■ <>

II ■ , . i II ,

I ; :; ;i -*,m.

M,, ,:',.- I|

kirkii Berggr., New Zealand, South

:l „ III ,i

loliads and wscin thteads in some Tertiary, Rhododen-

■
;

.:
U79742. Arbutus canariensis Duhamel, Kron (1997), Kron &

'■>,,.,■ <!v

: : : ■:

, ; II i ■ , ; ,,

.:

AF015633, U80428. Cassiope inc.

Crayn et al. (1998), AY005095. 1 180434. Dracophyllum

< ;■<:■:; \.\ : , •

■ ■ ..,,■,,,//...;,:.■.

■ ' '. ..-.-..,, ■:■. ii;

/■anii II I Ill II Ill II n, mil II , I

GQ392911. Dracophyllum mini-

MuiPlaleai

' ,',■: i":V,
' ' I, ,..: I;,...

land, South Island

GQ392916. Dracophyllum ouaie-

Munzinger 2869. June 2005, CUB 5850! !<>.
GQ392915. Dracophyllum pale

: :

. II. Oliv.. New

,.1,1

GQ392970, GQ392918. Dracophyllum ramosx

' ■ , ,' ■:,.,,.:■..:,■.•;.,.■.

- Pass, S. J. Wagstaff & M. I. i

GQ392973, GQ392921. Dracop,

:

.■■,.■

II I (.4'). G03

bautii Brongn. & ( Province Sud, Mt.

!■■ li

■■:>::■:. ^ , :

GQ392928. Dracophyllum trimorphum \Y. R. B. ()li\.,
392981, GQ392929. Dracophyl-

: . . .

P. J. Gamock- Jones 2478, 8 Doc.

Cliern el al.
.). AY005097, U7974. Leucothoe
■ I. Craxn el al.
(1998), AF124564, U83915. /,<
kron el al. ( I '

Cl.em el al.

:

al. (1998), AF539985, U80423.
Cherry et al. (2001). Crayn el al. (1998), AY005104,

re:, 'i ;:
■ ■

GQ392983, GQ392931. Richea alpina Menu,

Isnrver 5, G. L.

GQ392984, GQ39S entis B. L. Burtt,

milliganii (Hook, f.) F. Muell.. Ausl
Field [National Park, Lake Belcher, <
Sleane s.n., 14 Mar. 2005, CHK !

■ . . . .

I/. 1. konn

;.. ;!',!..".. ■■■-.-:

i victoriana Mena-

Kron el al. (1999a), Crayn el al. (1998)

". ; II,, 'I •, h

,/ s.n., 2 Nov. 2004, CHK

.; ■',■•:!,,,■

1995, UNSW 22959a, GQ392995.

...' /■■.. .,..■:

««/« Sm.. \.i

A«nvr i. 31 Mar. 2004. CHR 572164, GQ392997,
-

005105, U81798.

Chem el al. (-'

\K421107.

PHYLOGENETIC RELATIONSHIPS Deepthi Yakandawala,^ Cynthia M. Morton,"

OF THE CHRYSOBALANACEAE and Ghillean T - Prance *
INFERRED FROM CHLOROPLAST,
NUCLEAR, AND
MORPHOLOGICAL DATA 1

1,1' i • hnsobalanaceae as a distinct family

is launched to examine

pjuiplnletK .

.!■ ,■ i ,. •:■. n--i,i ar<l

I

, .■■■!, ;ti, rr:i
ii ii iioinr mi ■■:■■:■■

: 1.1 II W I Mi'':
• ■. ■•,,■■■•.■■'■;■(; > ■■.<

(Table 1). Ml

; i»."l'i :' oi ■■ ■ '.■■

■:■! ii ■'■:■■■

cence and floral structure. The flowers ar

'' . '. !::. !!',■. V

lits, from minute

ii I i II i i . i

imens also varies from

rail, ex A. DC.) A. DC. to mc

ecies of Couepia.

in Parastemon urophyllus

•■ | I In -■ i i ■ i

I " i I

i I ■ in' 1 !

Mi'lll; Il'll'li:

& White, 1988).

Bot. Gard. 97: 259-281. Publi

According to Prance and White (1988), the embry-
25 years of

attempts to apply mainly morpho-

Prance and White (

widespread occurrence of parallels

a few of the many characters used

in ii.. :-.■■■> '..■■: ■: ll,«' i: I T I . :. . I,:' !.,■■■.

medicine, and sli

cultivated. Chn.sobalanus icaco L (coco [II

,11 ..! V:' \<SH:< ■■

Benth. fruits are J 1 1 , | ar data w i t hin this

i: . :■■: !.!.■■ •■

nth. (mo bo la plum) arc , L sequence data (Chase et al.,

both eaten in Africa. Parinari curatellifolia is used in ■ m the rosid clade,

nip. A study using
leaves in West Africa. In Brazil Urania
(Benth.) Fritsch is avenue tree d l.. 1997) .u\

'I one species of
ornamental in southern Florida.

The taxonomic , atpB, and 18S data sets (Soltis et al., 2000)

.•'■-•.' . . .„■ ... ,,i •,, 1S | ;.;:•....

ie family in the

; ' ■.:■( . ,.;■■:::

i ; -<-v

affinities have bee

nned one to three

ceae and Tropar positioned in the

Connaraceae (Gutzwiller, 1961). Many of these : Tokuoka & Tobe.

iii \ \ - i

ly and the phyloge-
al., 2005).

Yakandawala et al.
Phylogenetic Relationships of
Chrysobalanaceae

id generic relationships in the

nuclear region ITS.

The present study carries out a ph\ l<

i I i " I ,

.lysis, and (2) to

. ' ■ '!■.■!■.■• 1,1", : I!"-

n pholog il and i

numbers, type of materia]

(0.1-0.2 g) leaf

Doyle and Doyle (1987). Prote

stored at -80°C.

The most recent systematic treatm
White (1988) has been followed as the basis
generic circumscriptions of the family. The gen

II i I i '

CACAAACAGAAAC) of the exon and a reverse
primer (1460R-TCCTTTTAGTAAAAGATTGGGCC-
GAG) that matched a downstream control site

(GCGTTGGAGAGATCGTTTCT), 724R (TCGCATG-
id 1368R (CTTTCCAAATTT-
CACAAGCA GCA). When prii

; ■»('< li-; (Mi -.

Spiraea L. (Rosa-

■I. \ subset of

ITS analysis, however, only
•■ and Euphronia were used because of

< -don the basis of the rbcL an

II ' I i i '

ring oligonucleotide primers 17SE (ACGAATT-

ATGGTCCGGTGAAGTGTTCG) and 26SE (TA-

AATTCCCCGGTTCGCTCGCCGTTAC) as

/ Sun et al. (IV

andard protocols: however, the D\ V

•m an initial one cycle of d

for 2 min. followed by 24 cycles of 95°C for

i"i I i"

;c. This was followed by 10 min. extension at
The same procedures described in the pre-

Cleaned products were then directly sequenced
using die Alii PRISM Dye Terminator Cycle Se-

! I I Ml

■■■ i ' sc- ;;

facturer. Samples were then loaded into a gel on an
ABI 373A DNA Automated Sequencer. Ra

\ I ,>. I il. V
in. i ::■■ ; iU i".

mist et al., 2005) under il

: ' .

" ' . ■■■■.■■

■

i.Mi. r:/u ;:i \ ;

: llUvl. " !' ■::

the remaining trees.

conducted initia

whereas the length, presence of hairs, and f<

' ' :■-■ - ■■-.■:■■■! 'I ' ■:■

■■■;■!■:■::: :l ■ .

d to a feature that
in some taxa (Maddison, 1993).
Potentially useful characters had to be discarded
because data for only a few genera were avail
o" ill In h i nv ill y II ar l;i •-.

ve weighting was

mes. branches were collapsed if their mini
3 ngth was zero ("amb-"), and no more than 2000
fere saved per search.

h In I '1 iii

[■:■■■■ i i Hi:
it Royal Botanic Cardcns, Kew. This

:
vliite, 1988) and personal knowledge of

Yakandawala et al.
Phylogenetic Relationships of
Chrysobalanaceae

Flowers. Dried !.

■■■■■■'■■I I 1"

. Mil ! I:".'

from Radford et al. (1974) fo

characters. The matrix is presented in T.

i'i II '[

If ■:■■;■ : I:- ■ >!''■ I'll'

logenetic characters in each da

trap values greater than 70%

I' i I !i

i i ''

The length of the analyzed rbcL gene is 1382 bp in
all samples, and no gaps were required for

' "| .;.■!;

ceae ranges from 0.2% to 2.9%; that between species

i i i'Ii 1 1 ,11

. '*. :>;■.■[ ■■. Hi'

in 1.6% to 19.0%. Mean
percentage G + C content is 45.0%.

. . ...,;:, . ... . [; J,, ...

.^ ' ' ..!'•' /iM/i .;

produced 139 M I with a CI of 0.67

• II". ; II Ull "•

ps, a CI of 0.49, and an RI of 0.74. The

318:200 (1.59).

Only the Bayesian tree is shown in Figure 1 due to

i ■ , ! i. i

I i II i i

ik l sih-i»i<;<

poorly resolved on the strict c(
successive weii

' .■»!■■: :,n I 1
II I i

clades: Couepia-Couepia robusta Huber (bootstrap

i in I
5S 93%]).
In the Bayesian analysis, the generic relationships

'■i ill. 'i II ■■■! I

In this anabsis. there uere 111
characters. The final data matrix cons

i'i I

d a long species of Chrysobalanaceae rang-

. : ■ .'

,. : II h'.-ivmi i-

I' III III I I I I I Ill

an RI of 0.73.

MPTs of 88.81 si 89 and an RI of

10 11 12 13

Figure 2A shows th>

.■ . ■ I ■■; ■■ ; II: 1
Ml I; iini . I

* ; .i .

resolved on the strict consensus Fitch tree, the

,1111. ,11,1,!:' :

In the Bayesian analysis, the family is monophy-

letic and well

ula [64%]) (96%). There are no hard

nparison with sequen

rin (1992). Sequences were easily

large indel. and cloning was not

Yakandawala et al.
Phylogenetic Relationships of
Chrysobalanaceae

15 16 17

Chrjsobalanus

Licania subg. Moquilea

0,1 1 1

Licania subg. Parinariopsis

Licania subg. Licania

Licania subg. Angelesia

Licania subg. Leptobalanus

Bafodeya

1 1 1

Hunga

1 1

1 0,1 1

MZmhes

! ! 1

1 1 1

Magnistipula subg.

1 2 1

1 2 1

St fl 7 / I

1 2 ?

■ .■■'■ Il-"li'" ■'

from 160-162 bp From 278-290 bp.

that of the 5.8S subunit from 163-165 bp,

it: .■■■:!.- „

naceae and all outgroups resulted in a data

2 of 332 positions

\,-- | i i
sul)iuiiU and 71

■■ ,,■-- i 11 1. m."

:

16.5% in ITS-1, from 5.7% to 19.9% in

hr. i hum. :,:

to 34.9% in ITS-1, from 36.3% to 79.1% ii
from 0.3% to 7.3% in tl

7c

VIM i;! , .;- II;-;

and the two s. 1 i nips resulted in a

; li I I"l

o i,iii \\f>yo ;:;m- n I I , i!n ,, II i >i

" , i Hi 'I

^ . . ■ . - <i in ii ...

A heuristic search under the Fitch criterion yielded
18 MPTs of 751 steps with a CI of 0.57 and an RI of

us trees of 288.3 steps with a

tatio was 371:281 (1.320).
Figure 3 A show; weighted strict

consensus, and Figure 3B shows the Bayesian tree.

II'- I. : ; •!>-!:

Ill I I
naceae (79% bool ree and 100% for

il ■• '.m; ■-; ■:■;.(■,

V

In the Bayesian anahsis. the f'amib is monophy-

■ ." i I

i ■
-'%). Clade A

the ITS tree (Fig. 3A) these; tw

"■: ' ■■:■■■; ■:■■■

Within the Bayesian analysis, one position is in

posterior probabilities greater than 95%. I

■ . ■ ■
(96%) (Fig. 2B) form a group, whereas in the ITS

[100%]) (75%) form a clade (Fig. 3B). The only

Yakandawala et al.
Phylogenetic Relationships of
Chrysobalanaceae

43

44

45 46 47

48

49 50

Chrjsobalanus

1

1 1

1

1 1

Licania subg. Moquilea

1

Licania subg. Parinariopsis

Licania subg. Licania

1

Licania subg. Angelesia

Licania subg. Leptobalanus

Bafodeya

1

1

Hunga

1

1

2

1 1

MZmhes

I I

i

!

| °

Magnistipula subg.

1 1

I

Stejl 7 / I

1

o

1

topolog) Therefor

A

leuristic search under the

Fitch criterion

there are no real hard conflicts

between these trees

yielde

nine MPTs of 850

The consensus

In the combined molecular data set, only two

i i I ' 11 i I In i l"i

Mi

i of outgroups. The total combined data set

I! , ( ,i <i

tree had a CI of 0.56 and an RI of 0. I

is tree produced

i, 1 1 III

■' ' ■■■■■■ " ; 'ii ■ !■■'

.6, and an RI of

■

. Comparison of results from the parsim

n> analvs

s of Ihc larger rbcL, rbcL, ITS, and a combination of all data.

characlers/.No.

BS > PP > PP >
Length CI RI BS 1 70%' 90% 2 95% 2

Yakandawala et al.
Phylogenetic Relationships of
Chrysobalanaceae

characters, of which 315 characters were parsimony

l!i under the Fitch criterion yielded
, tree had a CI of

./,! II.: Ill ■■an.v.i '

an RI of 0.383. One of these trer

i in n hi-: in i i nil In I il jii ill

I , , I 11; llii . i

■' ill, i I,- .:■::.. >.;■)>■■.

as missing data due to the lack of adequate material.
Chrysobalanaceae is monophyletic with strong

ii

' : ■'■ ' HI

In the Bayesian anal\-i^ (Fig. 4B)„ the family is

1 (100%). The

clades, clade A, clade B, an:

aranthes [BS 98%]) (BS 98%),

Hunga (BS 100%), which is

sister to a pc

e are no hard

us workers, it is not closely

!..■]: i ■;■.'• :■:■

1993), to Dicha 1 )etalaceae (Soltis et al., 2000), to

:-:

alaceae based on

<l'.-0\.. I'.'/ I: :

' I I- I

d Euphroniaceae. Litt and CI.

i illi i i i
niiii| , II i

. ^ ' ' • ■,,■■:!!]; ii ,

'. ■ '. ■ lhi.V;c; ; '..

:va;\. N 1 ,'l

The work of Matthews and Endress (2008)

■

: i ..II |:ih"l ..Li

1837-1838; Hooker, 1865; Focke, 1891) o

ally with the .;

. ■■■

None of the four lra<

i-'l

■' '■ 1.' 'UP "i

"clade 5." Clad:

ts of a polytomy of Chrysoba-

i il ii I

I In i

- one unambiguous synapomorphy: leaf
esence of stomatal crypts and

Two primary types of analysis were completed:

M .11 ,i I

<■■ • ■ .(■.■■■

..... ... .

., 2005; Tokuoka&Tobe, 2006; S

- , hi ..i In mi , i, In i i Jill r;., ; ^ ' '

' ' ■ 1 1 .i

-

and more taxa is

.-;: .'| . ...

■ .' '< ii: :i'i'"i'l::

i ' 'I I I

DNA re^

ii i (

i I Ii I'

,. il,l-.,i

transcribed spacer of nuclear ribosomal DNA in plants: An
example from the Composilae. Molec. Phylogen. Evol. 1:

Candolle, A. P.

) 2: 525-529.
Candolle, A. L. P. P. de. 1842. Sur del
des plantes de la fai

son 56: 822-846.

A. 1992. Cladistic:

Taxon 41: 211 223.

Chase, M. W.J). K. :

i, ,1.. Dm,. , . '

D. G. -' '

Yakandawala et al.
Phylogenetic Relationships of
Chrysobalanaceae

■.■■,: !,.:,..■:■■■< I.
Flowering Plants. C. J kuilaium. \ iduum

. 1988. The Kvol mi Barrois, Paris.

Plants. Columbia University Press, New York. Kilching, 1. J., P. L. Forey, C. J. Humphries & D. M.

,:,,n and Practice of
classification of dicotyledones. Pp. 240 260 in k. Tan

■ ■. ■ ,\.;

■ ■.■■■ . .

SS, Edinburgh. Euphronia.

Davis, C. C. & M. W . il.ila. Svsl. Bol. 23:

j. Bot. 91: 262-273. Maddison, W. P 1993. Missing data veisus missing

: ■ i ' i

".. Kxplosive radiation of Malpighiales 576-581.

supports a mid-cretaceous origin ol 111...I. 111 liopual rain

de Souza, S. 1979. Chrysobalanus icaco Linn. (Chryso- lassaehusells.

:: ■!■:!:,.■■, '; : . •"

11 dala sels in die
105. tribe Trilieea

):'», : . . J '^ .1

I, II Mil ,111

Phytochem. Bull. 19: 11-15. balanaceae, Dichapetalaceae, Euphr

Duke, J. A. 1965. k

■■ ... . ' • ■ ■ . . : .

105-106 (183;

i',:', . I .,!;,■:,!■. ', >..!;■:,., ,,im.: 1/v- ■

systems and qu

study. Syst. Biol. 46: 112-124. among m. ,

Ki\. \l. f . ^ \l. S\\< us, n i\ I s I (raid 80: 631-660.

affinities of Medusagyne opposilifoi

2: 111-120. values and ell.

Felsenstein. J. 198:, . Seolt & J. D. Palmer.

Mil'' 1 ; i I im- '■-■ f.dch.ir.

Fernando, K. S.. P. I C. .1. Oninn. their major li \ sequences of rbcL.

Molec. Phylogen. Evol. 2: 344-350. ,\. of the Chnsobala-

^ ' ' ' . ' . . ' ' ' . ' ' ' '

. 1972. Chnsobalanaceae. Pp. 1-49 in Flora

20:406-416. Neolropioa Monographs 9. The New \i oik Botanical

M)l Carden, Bronx.

(1891). /,, H. C. , 1-263 in Flora

^ ' :!:;■ vi'V. i.'l

Leipzig. .aiden, Bronx.

Gutzvuller. M.-A. 1961. Die plnlogenetische Stellung \on & F. White. 1988. The genera of Chrysobalanaceae: A

Suriana maritima. Bot. Jahrb. Syst. 81: 1-49. study in practical and theoretical taxonomy an

i

11 1 I 1 I. i.'i 1 1 1

icli, Dresden. Vascular Plant Systematica Harper and Row, Inc., New York.

!',;:.! iVii..," : l-.ci, i,,:-.,:-; ;:.■:

MrBayes. Computer program distributed by the authors.
. 1923. Beilni ■

Dumorl. Beih. Bol. Centralbl. 39: 1-178.

. cessed 21 March 2010.

noideae africaines. Bull. Jard. Bot. Flat Bruxelles 21:

167-198.

llickey, L. J. 1979. A rew

ol. 3: 27-37.

architecture of dicholyledonous leaves. In C. R. Metcalf

, M. W. Ch.i

& L Chalk (editors), Anatomy of Dicotyledons. Clarendon

M. van der Bank, K. M. Cameron, S. A. Johnson, M. D.

Press, Oxford.

Lledo, J. C. Pintaud, M. Powell, M. C. Sheanan, D. F.

Soltis, P. S. Soltis & P. Weston. 2000. Phylogeny of the

606-609 in C. Bentham & J. D. Hooker (editors), Genera

Plantarum, Vol. 1. Reeve and Co., London.

rbcL gene sequences. Kew Bull. 55: 257-309.

(eudicot) phylogenetic relationships. Amor. J. Bol. 91:

in sequence-based phylogenetic analyses. Syst. Biol. 49:

1627-1644.

369-381.

Kuzoff. 1993. Molecular systematics of Saxifragaceae
sensu slricto. Amor. J. Hoi. 80: 1056-1081.

, P. S. SolLis, I). I. Niekrenl. I..

W. J. Halm, S. B. Hoot, J. A. Sweere, R. K. Kuxoff,

S.-M. Chaw, L. J. Gillespie, W. J. Kress & K. J. Sytsma!

ribosomal DNA sequences. Ann. Missouri Bol. Card. 84:
1-49.

Zaiiis. V. Savolainen. \\ . 11. llahn. S. B. Hoot. M. F. Fay,
M. Axtell, S. M. Swensen, L. M. Prince, W. J. Kress, K. C.

Soc. 133: 381^61.

—

- . \1. \
137-157.

Sun. ^ . 1) / Skinnc. G H. Liang & S. 1

.1 ,pa<ei oi niuleai

ael. 89: 26-32.

Swoflord, D. L. 2000. PA UP: Phylogeneli.

Parsimony, Vers. 4 beta3. Sinauer Associ

ates, Sunderland,

Dillenidac, Rosidae, Asteridae, and Lamiidae). Bot. Rev.
66: 441-647.

ceae sens. str. J. PI. Res. 119: 599-616.

.'.■■■
C. Fan. 2005. Phylo

Taxon Specimen

Voucher

rbcL

ITS

Family Balanopaceae
Family Cluysobalanace

Rio de Janeiro, Brazil, Prance 30841 (K]

Bogor, Indonesia. Morion 89 (*)

GQ424474

Guinea, West Africa, Col M. Saiden s.n..

1997 (K)

Bogor. Indonesia, Morion 64 (*)

GQ424476

1'rcnch Guiana. 1). Sabatier &

M. F. Prevosl 3125 (MO)

Reserva Floreslal l)u:

Forzza 305 (MO)

Lill & Chase, 1999

AF089757

Brazil. Hopkins & 1 /

Madagascar, Derleth 61 (K)

GQ424460

Litt & Chase, 1999

i. ..-i,;' .:■ i,,-,i ".■

6093 (MO)

Sarawak. Borneo. .1/,

GQ424484

Zaire. Africa, T. 13. t ,

Cameroon, Africa, A. J. M. Leeuwenberg

9572 (K)

Cameroon. Africa, J. J. Bos 7352 (K)

Senegal, Dakar, Gondii

GQ424488 GQ42'

Yakandawala et al.
Phylogenetic Relationships of
Chrysobalanaceae

avolainen et al., 1994

11 & Chase. 1999

owveld Botanical Garden

Africa, Prance 30831 (

avolainen et al., 2000

AJ402922

avis et al, 2005

GQ424470 GQ424452

aiiiniii h •

Famih Stylobasiaceae

S. spathulatum Desf.
Cadellia pentastylis

& E. Sanlos

Fernando et al., 1993

Rio de Janeiro, Brazil, Prance 30842 (K) GQ424472

Litt & Chase. 1999 AF089761

ay, JohorFRI 37727

Ivory Coasl |Cole d'lvoire], Oldeman 692
Venezuela, Cardozo 2536

yx Cuatrec.

C. uiii (Marl. & Zucc.) Benth. ex Hool

Dactyladenia gilletii (De \\ ild.) Prune,

I Trance & b. Win

hia) Prance & F. Whit.

) Prance & F. While

sarbalum (Ducke) Pram

rl. & Zucc.
H. tocantina Ducke
H. zanzibarlca Oliv.

#. minutiflora (Bak,

h, . I! - in

'i !

.»*• heteropetalus (So

tjpo/euca Benth.

Brazil, &Wes 308i

Guiana. LW/j 2627

Sierra Leone, Deighton 5104

Guyana, Maas 7601
Mauritius, Bosser 21872
Madagascar, Phillipson 1909
Guyana, Henkel 251

Brazil, Hurley 21649

Brazil, Conwtto 6703

' ,.</o 2/77-;

| Indonesia] Malay. Cockhum FtU 7966
Brunei, Coode 7708

Guiana, Clarke 532
Guiana, Jacobs 1981
Guiana, Mutuhnick 74
Guiana, Pi/jo/j 9640

Brazil, Kukle 78

Guiana, Ma«, 3 Oct. 1988

Brazil, Prance 29931

Brazil, Kibei.ro 11.68

caragua, Moreno 22875

FL

Yakandawala et al.
Phylogenetic Relationships of
Chrysobalanaceae

:..'■ . . ■' ■ . ■ .• ■.."■' :

M. butayei De Wild.
M. sapinii De Wild.

■■ .■ ■■. ■■
M. tessmannii (Engl.) Prance

i;. Tolmiella F. White

Maranthes corymbosa Blume

M.floribunda (Bak<

M. g/aira (Oliv.) Prance

M. kerstingii (Engl.) Prance ex F. White

<-) Prance ex F. White

P. versteeghii Merr. & L. M. Perry

Dichapetalum albidium A
D. angolense Chodat

Madagascar, Schatz 3329

l\or\ Coasl | Cole d"l

:/,■««« 4082
Sierra Leone, Deighton 5302
Singapore, Symington 35516

[Indonesia] Bogor, Kos

Brazil, Rabelo 3555

eone, Thomas 3173

D. timoriense (DC.) Boerl.

3 roon, Thomas 2470

i al. 10853
:, Van der Ben 1326
tame, Lindeman et al. 566

with 50 Lilian a ii. I
in, lu l-»! in t I . i

I , "cllicr have been scored as brads.
and White (1988) and arc in agreemenl with lh<

„ I HUH l "

majority of species of

d Licania subg. Afroli-

*14. Sepal sin |iial =1; unequal = 2.

stomata are confined to relatively alvx = 0; equaling the

„l = I. UoM '7. U.M-placle l.air*: Vb,enl = 0; present = 1.
species of hirinan

I han calw 0;
simple (I'ranc* :

arachnoid and hum i . Lhk, on ill ' leu exception-, (Maranlhes (onmbosa. Couepia

Th Ivl 1 ni the i ill

setose (Prance & White, 1988). Even though tl l0I P hic = 0; sli S htl y

present for this stud\ ^Oiik" a' l','-, - ■Vol onioipluc.

absent for the I kiiiiki Mildhill ~ " ' "' " n< ' l(alu " "' tllc

Wh't K Pran "ll

^iH^iTcdkf Nl-mucilaginous = 0; mucilaginous tW ° in Parastemon urophyllus to more than 300 in some

are ^^al^h^ S^wrdchhas^nly ave^few specTeTwithnine

" i: '" , l! ' :, ' ' ' ':'

feature was scored as „ () and 2 ^ an( ] iq an d

0; presenl 1.

, , I , Ii ,, .,, ., I„

die doner. In ihe case with the
Maranthes and some sp ,,

= or unilaterally
zenkeri Engl.. the) ai< sometimes up to 3 m

: .,,■■,,, ii,.

mt for the genus. According to de Souza filaments u
(1972), stipules are absent in Chrysoba- forms a c
•cording to Prance and White (1988), they Dactyladeru

Yakandawala et al.
Phylogenetic Relationships of
Chrysobalanaceae

lulls Prance, a dul

In L ,

phanerocotylar = 1 following Duke (1965, 1969).

1 1 II " li I ,11

.."'li ,; n,",';i !■. '

Style hairs: Absent =

Endocarp surface: Smooth = 0; tough =
Germination

il secondary veins

■■■,.■.

le another. For type
turn up and divide
the secondary veins t

■■ ■ .

www. mbgpr ess . org

CONTENTS

A Revision of Deschaiupsio. \renella. ami \aliIorfr iiinae) in South

America Jorge Chiapella & Fernando 0. Zuloaga 141

A Taxonomic Revision of Rhododendron subg. 77s//, alyx (Ericaceae)

Jin Mao I ■; De-Yuan 163

I j ■ ; ■ I | | ,- 1| J | ; ■ j

deae (Lamiaceae) Anne-Cathrim diksby, OlofRyding,

'Jndqrisl 191

biaceae) P. C. van Welzen 218

Origin, Diversii lication of the Australasian Genus Dr

(Richeeae, Ericaceae) .S7 rray I. Dawson, Stephanus Venter,

Jerome
Phylogenetic Relationships of the Chrysobalanaceae Inferred from Chloroplast. Nuclear,

and Morphological Data Dec; ■ 1/ Morion X

Ghillean T. Prance 259

%

of the
Missouri
Botanical
Garden

01(H!

Volume 97
Number

The Annals, published quarterly, contains papers, primarily in systematic botany,
contributed from the Missouri Botanical Garden, St. Louis. Papers originating outside
the Garden will also be accepted. All manuscripts are peer-reviewed by qualified, in-
dependent reviewers. Instructions to Authors are printed in the back of the last issue
of each volume and are also available online at www.mbgpress.org.

Editorial Committee

Victoria C. Hollowell
Scientific Editor,
Missouri Botanical Garden
Beth Parada
Managing Editor,
Missouri Botanical Garden
Allison M. Brock
Associate Editor,
Missouri Botanical Garden
Tammy Charron
Associate Editor,
Missouri Botanical Garden

Roy E. Gereau

Latin Editor,

Missouri Botanical Garden

Ihsan A. Al-Shehbaz

Missouri Botanical Garden

Missouri Botanical Garden
Peter Goldblatt
Missouri Botanical Garden
Gordon McPherson
Missouri Botanical Garden
Charlotte Taylor
Missouri Botanical Garden
Henk van der Werff
Missouri Botanical Garden

of the Missouri Botanical Garden, % Allen Mar-

P.O. Box 1897, Lawrence,

KS 66044-8897. Subscription price for 2010 is

$180 per volume U.S., $190 Canada & Mexico,

other countries. Four issues per volume.

price of the Annals.

;■''■

The Annals of the Missouri Botanical Garden
(ISSN 0026-6493) is published quarter!) b> the
arden, 2345 Tower Grove
Avenue, St. Louis. MO 63110. Periodicals post-
age paid at St. Louis, MO and additional mail-
ing offices. Postmaster: Send address changes to

Allen Marketing & Management, P.O. Box 1897,
Lawrence, KS 66044-8897.

The Annals are abs 1 OSIS®, CAB Ab-

stract/Global Health databases, ingenta, ISI® databases, JSTOR, Research Alert®, and Sci Search®.
The full-text of Annals of the Missouri Botanical Garden is avails BioOne™ (http://

i Botanical Garden Press 2010

m of the Missouri Botanical Garden is to dii

onment, in order to preserve and enrich life.

1 share knowledge about pla

r meets the requirements of ANSI/NISO Z39.48-1992 (Permanence of Paper).

The observation that white-sand soils in the

i i " i

has long been 08). White-sand

1 ' 1 ' M I III

.111'.. II i,l: ■;■■■
- " I III II | l III ,i ■ :

ty of the Amazon Basin,

white-sand forests have

ie for edaphic

■■■■■■ \

dophyta) in the

kit not limited to white sand) (Tuomisto et
al., 1995, 2003; Ruokolainen et al., 1997
nen & Tuomisto, 1998; Tuomisto & Poulsen, 2000;
Fine et al., 2005). Ruokolainen and Tuomisto (1998)

■
et al. (2003), in which the) attempted to classify

"•' • ■ , . ■.!(■•■. ;■■«■<■

. '.■■■',;■ I .■■r.H'l; isll

. I. I'>. I ).

modify standard samplir

: v eloped for TF
;ive samples of WS forests.

decades have been conduct*

nimum DBH cutoff of 10 cm. Th
allows research-: the reproductive

le t -\ t ee pecies. In WS

than 10 cm DBH (and in the e

:■; i ■ ..■ I
10 cm DBH), thus a smallei cutoff is ne.rsvin to
sample all reproductive adults. Another discrepancy

overcome the*..-

numbers of individuals as the TF plots. For varillales
ilso known as

' , J I I II "■ |f I ih Hi ■ ,

vimately 10-20 m (N = 13),

plot. Three of the WS plots (WS 6, 10. and 15 in
[Anderson, 1981]) and consi

-■if:- ! ' i.i n li i." ,i.

,.'

2.5 cm DBH.

HI i '

; (AMAZ) at the Universidad Nacional de

- i . i i, In

f White-sand Forests of Peru

1 Persons in parenthes
ultimately determined li

-■

-
-3.95056

-

-■

-

-73.06667

Pitman, R. Garcia, H

Pitman, I. Mesones, M. Rios
Ahuite, E. Valderrama

Rios, N. Davila

. Fine.

Fine, I. Mesones (R. Garcia)
Fine, I. Mesones (R. Garcia)
Fine, I. Mesones (R. Garcia)
Fine, I. Mesones, R. Garcia
Fine, I. Mesones, R. Garcia

Fine, I. Mesones (R. Garcia)
Fine, I. Mesones (R. Garcia)
Fine, I. Mesones (R. Garcia)

Fine, I. Mesones (R. Garcia)

i i i ■■

(MO). A very few sp: I ' soil types. These

Linens that TF plots conl and morphospecies

: .-..• : ■ :

morphospecies number (or if genus is unknown, the Two simil.

■i , ■ ; \

COMPARING \\ S PLOTS TO OTHER TF PLOTS the s P ecies onl y in

the neighboring plot, c' is the species only in the focal

from Loreto, Peru I man el al.. two numbers nnon et al, 2001).

x;xoxx 'in..; ■,■ ■ .':

Qgles, labeled TF 1 to 18) in northeastern Peru. Rivers a

e labeled m ilalic-. I)a-hed line approximates i

zonian lowlands (less than 500 m above sea level). While

oximately 25% of its area is covered by white-sand fores

s). See Table 1 fo, nan.es and coordinates of all plots.

and is a modified Sorenson's index that takes into

morphospeces are the same as "named" WS species

unt the differences in diversity between plots with

or WS morphospecies.

aim to decrease the influence that any local

To quantify the spatial component of beta diversity,

ilariU. The second

alculated as: between plots A and B = 2 E min

' . 1 ■•*■■.■, i. V\;-

n B )/ S (n A + n B ) where one chooses the smaller

i, i 1 i

ber of overlapping individuals between plot A and

doubles that number, and divides by the total

ber of individuals in the Iwo plots (Potts et al.,

i II i !

2). Because WS plots are generally composed of a

1 II 1 i i, i

afferent WS plots.
To compare WS plots to each other and to the non-

• .■ ■ ' ': ).' i.:

. Both the secon

led specimens f

herbarium (see Table 1),

i than a very few

significant result indicalo

in

: ii "■ „„ ,

sites and separately for WS and TF plots.

caling (NMS) ordina-

f White-sand Forests of Peru

WS01

WS08 WS10

TFFf$1

-iou rh-07

TF ^05

«2

WS09

WS14

TITWP3
TFfPie
TF02

^1

w ; 05

TF08

) NMDS Presence-Absence

5 -tW WSflfeng

| Tp01 WS1 &/S1% S14

1 § " ™^F04 WS12 '

T - ™ W307 ws WS0

WS06

TF03 rp

NMS ordinatioi

compos-it ion among all

id the Steinhaus a chamizal plot was at the Upper Nanay site, where all
idex) using the vejs; . •' s encountered in the chamizal

nt in the nearby varillal plot.

i a stable two-di

<■:•■ ii>: ■■ V,

ermutation procedure (MRPP) test to determine all stems encountered. The top 10 species in the WS

1 m . , ( • ,', , '< Ill 1 I

than expects
1). The MRPP t

in the WS plots; 89C
considering the top 10 e

WS plots and separated them into 221 species i
morphospecies (Appendix 1). The 13 varillal p.
contained an average of 222 individuals from 4
species (range. 26 to 71). The three chamizal p
contained an average of 248 in li
■■.■■.
• "(■;-:

ince data (Table 4). The NMS
separated WS and

was on a lisl <

m I,, r ||,|

HI I Ml I I I II

■ ■ i ■ mi:' 1 1 ■■.!■■:;

;i i ■' HI

in species composition among
: lee ted by the MRPP tests (P sim : A =
0.06989, P < 0.0001; Steinhaus: A = 0.0
0.0001).

:

'.:■; I. : !:'■' ■.:!■

sample of all of the non-WS

. : ;:\ io i ic

Ecuador, j0rgensen & Leon-Yanez, 1999).
een reported in Ecuador at the

nie. We found 81 of the 221

U , ■■ ;■■•<■( :•■.■■■:

There are an additional 21 species that we propose
occur more cumin.

■■.'Ill 1 v. :
' ■■., ,-: !■ :■

■ : J/; '.■■ I:'.
^ ^

! found in the WS plots, and 3110
individuals (83% of the total).

Spatial distance was correlated with species

-S. P < 0.001;

by NMDS, P < 0.001). This is not
;md TV plots

.: : ■'■» «i i.. : r>i

(Fig. 1). When correlating jusL the TF plots with
;; (P < 0.015 and 0.006, res

1023). The Mantel t

■ ■ 'i'"l, ■■ ■ : i > •■•',< = i ,:

compared to other TF forest plots. We foun

species out of 36 Hiring in the WS

.. .

f White-sand Forests of Peru

from Loreto

,'.'..■. ' ; '' . ■■' : ' ■ ' .; ilM.:>. ■.,.. , ., ..m ;!

included all stem- mo-t common 12 species from Yasuni and Manu even

;e, 114 to 210 species) (Gentry, 1988; "... the oligi rj from region to

filler, 2002). region, and ii lental heterogeneity

>ut the patches themselves may

<il ! I

estimating 25 species at 10 cm DBH per hectare near ture." In ina ia match Pitman et

. ill. i ,
forest had 35 specif i S patch harbors

■i; ! >:■■, .■:!.! .]<■;■. ,■-. :.

: irted in western

reports from near II I al., 2001). Unlike

(Gentry, 1986; Ruokolainen & Tuomisto, 1998: nol as p,<uliclable from sile lo >ile. for example, only
Phillips & Miller, 2002). We believe that this . is .(.Heeled at all

isects, and Ruokolainen and Tuomis
(1998) report percent sand in their soil analyses
only 80% from their "white-sand" plots near Iquit(

■ :i Mil-it ■■.■■

Mantel tests indicate significant
data from our WS \

ita. In other words,
dominant s|

liile the overall

L-ie WS plots had no

iiatial correlation is

flora may be largely

I .ii- bird dispersed,

le-ranging dispersal capabilities (Macedo &

species list for e,i ;

occur more than once, and eight of them occ

■:;■:■■-■ '

.mtrast to the clay

?<!■'■ I ■:.'■:■■ ■■

I are rare in the
main factor <li Amazon and are scattered across the region in

diversity. noncontiguoi en though many of

(I dispersers (and

' i ( II

' ' .: i Ii: '• ■; l.il ■

■ : ' . ' '

Is are small, those
i s are different than

Sapotaceae

Fabaceae Macrolobiun

■■ ■ . ■■'■"■'

Caraipa tereticatdis

Haploclathra cordata

Marlierea caudata

Bocageopsis canescens

Siparunaceae

.

Fabaceae Tnrhitml

Clusiaceae Tovomila rtil,

Fabaceae

Fabaceae

f White-sand Forests of Peru

,

I! Ill I I I ,11

al, 2006). In TF forests, common species tl
high densities are thought to suffer c

" , i, i

,11 I'll , ,111; ) III,'"

i nee in new WS

II

WS and TF plots are distinctive from one another.

: ii i •/, li iirliii

TF-TF

1998;
Duivenvoorden et al, 2001).

Tuomisto et al. (1995) suggest that the Peruvian

■ ; ;iirhii,i i" iiiini:jii

' .ni.-i Mi >, :

lie biotope model properly depicts Amazo-

II 1"'. I'<l '

7 species that were found across many WS
•hasize that our

significant differences wit!

more fertile --oils they
ir low diversity and the
species rather than just

:. - "iiics. These; 114

fair estimate, although it does include 33 n

... - ...

I 1 I I I M I ■ II

especially in WS forests distant from Ir

i.ll, V, , ■ .|..|;', .

decades (Vasque rcia-Villacorta &

Hammel, 2004). One of the collcclions from our

there could be quiLe a few cryptic

(Fabaceae), Dexter et al. (2010) found several
taxa that had previously been lumped toge

I 'I II I I mi

Pav.) Decne. &

species are poten I at did not occur in

!. M l; i i ■; iMI Ml

...

i II I il

itry, 1988), the Clusiaceae family does not

thing about WS

i.' ' i .

ilarity of Peruvian

to examine the s

central Amazonia

'.||i;'.:'iii ;' ;'.i; .
i . ! i .

. • I H" I i' ,.; (ir I
II I I".

' ■ of

with future inventor}

many WS specie

species) are shared
Peruvian WS forests and WS forests farther

na Wallace (Arecaceae) have been reported from
forests in Colombia. Brazil, and \ enezuela
lerson, 1981; Coomes & Grubb, 1996; Duiven-
den et al., 2001). On the other hand, even within

f White-sand Forests of Peru

characterization of

remains an avenue unon in the landscape

' -i. ■■ JliCc

::■■:■:■. i in I u-

BOTANICAL RESEARCH EFFORTS

: : ll'> ; ■ I ■ 1 1 1 ; ■ h

Articles reporting the results

" I I

'-i""\ <■■■ ■ ■

. I ii ■

I ii n; l ■ 1 ' !

1 ■ ' I 1 I I . i M , i , ' | I! II II

alreach been im. -sent, only two areas

languish as unidentified morphospecies, or just as in Peru tli.n , enjoy any legal

:

" ' ' • ; v\;n ■,,!< a ■ I

•ac have little Finally, WS j fragile. These soils

idea of the identities of the tree species?

. ■■ i ii I I .i| hi . I

i ii

oups are currently the focu.-
agram in any laboratory In

/ ^ , ' ■ :

CONSERVATION IMPORTANCE OF W S FORESTS We now ha\ C

can describe 1

. -.

should be given hii i ii\. First, the on TF. mostl plot-level diversity

^ ^ ' ^ , ^ i

expected the WS

ll! I I II ill ,| | II,

I, i I i

| In, species new

Alvarez & Whitney, 2003; Garcia- Villacorta & „ -.countered in WS

demic to WS forests,

found in Peru. Usii:

i

Idle their numbers

II . I i II I'M

i. In ■ '1 : : I Mi,!

■ ,:l ■.■ : ■ ,■■!■■.■:■'
I !' i ■ [ ' ■ ' '

thus may be restrid I u-n few species

: ^ '• ''

overlap in species composition between TF and WS

that are rare in WS plots but present in TF plots.

vegetation <;

.. Biotropica 13: 199-210.

V. Funk, C. Kelloff, M. Hull G Cremers & C.
Feuillet. 1997. Checklist of the Plants of the Guianas (Guyana,
Surinam, French Guiana). Biological Diversity of the Guianas

i < l

il ,:n . .in.! '. :.:,,. , ,■!:■„■. : i I

ot. Card. 45.
1 ,1. I.!.. ).., , . A. I ■>• .■ " T. I . II II "II in

checklists and collecting data Lo investigate plant

factors. Vegetatio 122: 167-191.

lexter, K. G., T. D. Pennii
Monogr. 80(2): 267-28(

S150-S162.

gradients. Ann. Missouri Bol. Gaid. 75: 1-34.

.!:■;:! .: ».:,::

and beta component-.

II I I

< lsevier, Amsterdam.

in mover and scale. J
966-979.
Macedo, M. & G. T. Prance. 1978. Notes o

, E. & E. Cut

3 r Res. 27: 209-220.

upper Rio Negro basin. Pp. 217-240 in J. Proctor (editor),

: .irkueU Scientific. Oxford.

.. ■' '
A Dislanee Fuiiclion

York.

package version 1.88. <http://vegan.r-forge.r-project.org/>,

U.< |

.1 -■-':

Garcia- Villacorta, J. Guevara, M. Ahuite, M. Aulestia, D.
Cardenas, C. E. Ceron, P.-A. Loizeau, D. Neill, P. Nunez,
W. A. Palacios, 0. L. Phillips, R. Spichiger, E.
Valderrama & R. Vasquez-VlartXnez. 2008. 'free commu-

525-5 K

..... V- ' ■
C. E. Ceron. \\ . A. Palacios & M. Aideslia. 2001.

f White-sand Forests of Peru

2002 Habilat palldiis in liopical umi lotesK A Houi. I). <

83: 2782-2797.

Nunez, H. Mogollon &

Conservation 12: 2255 2277.

■ '.•!: ', < ;',,,
■::■:■■■;;.!, I,,.,:,! -.:■■■.

Ecol. 13: 243-256.

■■: I. ' • ■ ■.::. ': i !■<:.■:■ r. , ;

de Iquitos. Pp. 2f, 260: 63-06.

" ■ '

Inlegrado en la Zona de Iquitos. Pe i i a 1 i on of Western Amazonian forests.

Press. Turku. 299: 241-244.

Singer, R. & 1. Aran f; Viae) del Peru. Ann.

litter decomposition

mica 9: 25-41. \iiensendmp

I & L. Rivera Chavez. 2006. Peru: Matses. Rapid Biological

ill linn. London.

A new species of
. ■

.7: 113-210.

-. . . . •' . ' ■ . . . " ' ' '

Tropenbos, Wageningen. Netherlands. Hubbell. J. La!

.. J. Chave, D. S. Dawes.

Sabalier. V. Due,,,

Spiring,. H. i brand cK K. L. de Lao. \1. Massa. C. IX . 1 1 1

444-447. diversih in i

i J 5

I 11 111111'

I g g e

ii mill

*"|J Ji l^ii^liiii'

lllfliii It stifi, «U Hi

1 #j 1 Ji uiiji 1 1! In

I 1 1 1 1 I 11 lllill 1 11 ill

§ § g g g 3 s § a a a a

I I »l I I I II II

% g IS & S & S & & S BfcSS gs& & &&

!i I

1 1 1

= i I
| 1 I)

r

II i iiiinii i i Jin in i ii

I

1 §HJ

■i i i ii i 111 s 35
I l llll ill I II

; 3 - 3 "3 '3

| | | || |

81 1
||| I

iili 1

::

!j 1 £§

Ml

ii iil iiiiiiiiiii i

fjj Jill III JfflJJJltJj ll I I

» s s s s § §

fit fJU Jij llllllM II I

• i & I f i „„

'P%'p'P%U ££ J ^

Jil _

nil I

iJlllJ Jl j

pi §

miii §

s s 1 s

1 ill? 1 =1+1 ll

l**!.li r

e 1 1 J J 11111111 J

S S HI 1 II 5,8,1] 11 1 miii I

i, '"■ ■ • : ; : ■■; -

I j |j j j j

fltt

fi s i f

■fJJJ|||||| ||

§ 6; ^ 6; 6; S §

1 11611:

iiliillil! " J

lltfllhllliill

•i -a -at 1 ls e 4ll 11-1

j, OJ D Oi <L> « <u <u £ o 8 8 S £ rt £ S * S S S

: - ; : = £ \ II I I I I 1

^ ^ ^ & ; s s s s

I I 111111

j J jj^j ^ J^J J

g g te - .g g .g .g .g .g * 2 .H S & ""g 'I 'g ~« g "g .S3

s

II i $ || Hill 111111 i

111" ^!! ! lll^llill^ 1 i llll^ — i-

i
i 3 f

II _ a 6 ||

I 5 I 11 § is I § 1 I 111

'= p =5 5 ^ is - =2-1 c i ^ :

Jill « s.Jlt

i inn iiiiiiifini i i^iiiis, ii

Iff S- 8- S- S- ll S S- 1 t S- -1 J 1:3 8- 111 1 '3 8-1

}

1 88s J ^JJillL I i ii-iiii.il J

111 1 llllllllll 1 I tJJ J33 J J ll

i yi I Iff Sf fill! I I IJIJJJll 11

JJJ J JJJaaas:

£^£^£

II i 1 1 1 1 1 1 1 1 :

II 111 I

I 1 I ll I 1

l 3j lfIiiSlI 3 S J L2fifL 3 !lS li 1

iiliJlJ I llilijllllllillil

Sllll I I g £.11.3.9.9.9*3 ,

llllllll | Hit: Jin |

SSSSS£S2 = i = i III

§§§§§§§§ 1 I 1 I 1 1 I 1 I I I

11 lllljlllll 111 1

ill ,4

v-m miitm^fiitii ttiiH-i

^1 | |-5'1 * s-l-ll 1 1 1 1 |\S S « ll «| -1.9

i iii jfiuiiiii! tnttt mi il

I lis ss|S s g|g§g^ = i i = i i go, « § l§

I 111 1 1 1 1 1 1 1 1 1 1 1 j j j j j j iiij jj

^ -5 §

m

i 1 ! 1 '1 i

I 1 1 i^

£ it ££h &

gEg?£2 | | s s

IIIIIkO I I

£ & &£ S j a

s h

I 111
a * 1 4A4li

*--| jffjfl

4 II Sl_.

ki JlJ

1 if ill! 1 I ! ! II

I II II 1 1 1 11
•| || mi Ill

1

ll 1

11 I

11 I
II I

1*1%

III

Fine

et al.

Study of White-sand Forests of Peru

■§

1

^ ^

il 1

ill t

;:.

V

||'| J

: :

;

1

|

i Sii

8

111 I'll

;

v

iitUI

s«is,g

3

snui

:■■•:

il!U*

i ^ <

;.;

jifii

:

i**$U

1 1

1 111

IHpI

•-11- I

. . , i ■ : . i, ni

mder, P. rosea subsp.

;.-■.-..■/■■. ..:..■:,: (I . , '

Galley & H. P. Lin. I I'. Linder, P. insela

(:■■■„:..!..)'.■ il ,)'..IL. ^ !l

..:■;■::;■:■■;„: ■; ! il -: .'

' ' ; -,;...! ' I', i; .,!,; ! ! ;

I. P. Linder. 7Wi«a/«

' I

,1 , ! .,1
, ! i , :

,-/„".',.■/.■ i ■■ ;.' ■ :

,, ..,„■■ I!

.HP!, i V : ■.■■',■:■

':. & 11. P. Linder. R.

■, & 11. P. Linder, R.

,,o,,inr,,M.s (L). J. i I hreys & H. P. Linder.

, ''' in

nl)., Danthoniac,

iules a small, well-

i ■ » : .*■;;■ i -. m-m! • . ■ ■.

1

m uliich thcy

ll!.; t 1,11-1 ;;;■::;

'•■: ."J- ^ if, ' :

■■ ■■:! I.! :; :.>■■■■ .1 - : t i '■:■:(

'■: > i - ■■•■:■ ' I'ii ■ ' !:■. ■

,;; ■■:■(■ .:- ■:■<■. i,.- i.i , .. ■
been remarkably unstable (Reimer & <',

in 1805 based o >. ,s 7 wata (L.) P.

'< 'I ■■=! ■ : I ' I : '

" I I II 1

P. Beauv. (lemni,

|J; ; •. . Uh ■:,;■.

i II mil) I <il

■'. ■ <!:■■;.. ■' ' '".'''

■.■ :.■-' (Il.v;":.

;.-■..•; ' ! ,, ?i v ■

(gynodioecious, glumes single-veined, florets pilose)
Poagrostis Stapf, a single-flowered specie

Lger, 1906) from South Amer-

> ' ' ..,:.':■. '..M r

•! Hi i

ill i

i i 1 'i

i i ling of this genus was pursued

■■

I ''"I I I II

to Steudel [1853-1854]), and Veldkai

ii "H i I

:

,ir.! hr I',-'. ..;

■ , ; . "i ii |.-. ; n

ill
The first species-level molecular phylogenetic

.'I [(!■■.■!( ..'■■!;■,

|M:«! , .III I!;'!!,:

" i , ■■ ..;

ii.:<; : .■■■■■■■.■:

ild he placed in a different sin
Chloridoideae (Barker et al., 2000, 2007).

■ '
1 'ii i

: : IMii-vi. , : I-!:
.. ''. =■ ■ ■ J ■ % n - 1 1 ,. i ;

all die new

ns in AD, B, BM, BOL, C,
CANB, CHB, CONC, GBA, HO, K, L, MEL, NBG,
NSW, NU, P, PBE, S, US, Z, and ZT over the past

cer, 1993, 1995,

1999; Linder, 1997, 1999, 2005; Linder & Davidse,

la 1 ley & Linder,

•.If".,''..). I 'I- - .

■ " i|.:.. I;',.. ' II ■

■. Ml !'::!! l.'lr

; ::■:!■ ill! ' -ii Ii:

glycerine and stained

Caryopsis data for African taxa were taken from

.86, 1994).
\natomical sections were collected o\er many
iid using diverse

the field in FAA, t

ii i in I
either free-hand or by

:dded in wa?

■

. . .:■■! !■■: :il

minology follows Ellis (1976, 1979).

• > ■' l '■>'■. i ■■!!

I I li II, ,

4; Gould, 1958;
9; Bow den, I960: Brock & Brown, 1961

Bowden &

Borgmann, 1964; Packer, 1964; Schwartz & Baessh
1964; Mehra & Kalia, 1975: Moore el al., 197
Reeder, 1977; Sokolovskaya & Probatova, 197
Faruqi & Quraish, 1979; Beuzenberg & Hair, 1983;

i .11 I ' >
Spies & Koodl, 2001: llilu, 2004; Murra> el al.,

■ .;■ ■.■;■..; '

(Philipson & Connor, 1984; Verboom et al., 1994).

: . ; ■■ I- ■: ■ - ■■■. ' II ; ■ ■ ■■ .".HI v.: ;

compiled in the software DELTA (Da

IHI./.iiy <

INTKEY inLeracLive key. This will also include llic

full nomenclatural informati

including the synonymy.

Phylogenetic results presented here are based on

ing 81% of the danthonioid species reeog

nrDNA) was constructed (available on TreeBase,

accession number S10417), assembled from new

jl I " I , II I Jut III I III " V ,

:■, (I ■■: H! <■■!■ '.'

al, 1995, 2000, 2003, 2007

Galley & Linder, PACCAD (Pani-

nl'l i ■ ni

.■;■■■!':. :■.;■>.!: ■■

lain reaction (PCR), and
described in the above
studies and in Pirie et al. (2008). The following

HI.! ''v. ,',

; .;!■ ..'r„ )/•■■■?■ ;: ' . . .

-'.'I'"''!

(BS). Where no such coi

I I II II ! ■ !

II •; ;' • !■ ■':.

'.::". II- -ii< '■■:; -I . .

missing data, lli by nrDNA only,

■ I ' ■ . .' . .'

■ar or C. pilosa
;r ; n (in total 11 species,

( 1 p t ng a separate

. . . " I! iH I I Jl , I

"■ ■ I:': I.

li .■ :', I! Ill ill Si! i:

m (Nees) H. P. Linder & Da

II Hi II HI III! ! I

and nrDNA analys*

Parsimom analyses (hematic ^eaich and boot-

PAUP* 4.0bl0 (Swofford, 2002), and II

\ ^ . . ,

& Huelsenbeck, 2003). For details, see Pirie et al.

(2008).

of cpDNA and more than 1800 bp of i ,

• - ■ .

A novel "laxon duplication*' method was used to

I Ml III." ■■, :,
I i I

I". ■ lvl; ■■■.(

(thus which clades should be rani

. • . :iM' II! ■-ill!" !■!'!!« ■.;

■ i 1 , , II ! :

I, 1 1 ill 1 ill <
correct clades those species tli

i .■ *.ll"lf T II

molecular study second situation

:■■'! ■■'.■.; i-:--, ;.

;,!: N;':'.i ;'.-;.;»> ;:■ ;

ice that a species

lade renders that clade
In most cases we used
lies that if a species was

t clade only if there was
ce from the molecular data that its
I result in a paraphyletic or polyphy-

clatural changes. This means that we did not sink
I 1 Ll I

, , i

■ . i ( ,'■■;,-:

and geographic ally homogeneous. Ideally, the dis-
parity within a ge I 11 I e /e 1 (e g

number of continents occupied, habitat range,
morphological variance). However, in many cases
this has been \ei\ dil i

nomenclatural criteria generally coincide, as in

.!, : '•■■■■!!■ ■■■-! ..

: 'Si- •'

possible to construct a simple key to the genera,
based on characters that are readily observed on

i ill in i

2000; Pine et ab, 2008). We largely accepted that
it will not be possible to key out the genera

not encounter similar

' Hi' i t ii ! i

The number of monotypic genera should be

i|||"i" I! ■ ii-:' !,:;.:■

in their "clade." If this aberrance is due to a long
evolutionary history, then they could be regarded
as distinct, by definiti

■go L. Monotypic
genera could also be established to indicate
phylogenetic uncertainty, either due to conflict
between the genome par Li Lions or due Lo lack of
basal resolution, as was the case in the genus
Caulipsolon Klak (Klak & Linder, 1998). The latter

I I; I I i i I ll II I

that need more research. If these topological^

III i I I, ILJiJlll -

to those of Lhe more inclusive genera. However,
this does have lhe advantage of minimizing the

i I i i,i' '■! Mi >

the elades.

iiHia as the smallest

. . i-i. hi : ' nil - lln-i <■ (;'..'.' • "■■■ :

iilir-ii'l Mi ;' .-.'..
'.I'H nil: * ' •

Rksui.ts am) Discussion

gruence. The .
showed no significan

Ml ' II' I II i,

conflict between cpDNA and nrDNA, resulted
strong supporL for die alternative positions of

support with respect to the nrDNA tree (Fig.

Parsimony bootstrap support values for some elude;-

ised in comparison to

values obtained from analysis of cpDNA 01

his can, at least in p;

!■'■■■'. i. ' r

inference to the lui

,". il i I '.

genus in the subfa A (Fig. 1A). The

popular, with th r\ large genera,

isa P. J. Bergius

Veronica L.

«i L. f. (Mast &

Thiele, 2007), Moraea Mill. (Goldblatt et al, 2002),

■ ..' .

llcted more than 20 years ago,
and the segregates have becoi

ruli a [Mallett &
Orchard, 2002]; New Zealand [Edgar & Connor,
iny of the segregate genera are i

■■ill' I I II I M I . Ill li io II . ill I lull |. Illllll I

! "i . ii

genera occup) a particular < <

\, node B) is ecogeo-
the genus can be recognized by the syna •:

■ ' ' "I: ■.,!'•!,

There ai

clade; only one of the four species i

The second basal segregate (Fig. 1A. node Cii) is
almost impossible to define morphologii

two large caespitose grasses (W. arundinacea, M.

Barker; Barker & Ellis, 1991). We are

i •"'■ fi ii.,. ■

, i i i II i i '

' ■■;■■.:■■■

... 1. 1 1 iii r i

laining three species, and this

• .i'ii

i I ii i

]_iMer

Merxmuellera stereophylla

are discerned with v

in:; !■• ii .■;;.: !'•:'.'

. 'VpDNV'fl

■; • ■ ■■ >■■ ■■■

I lie cladogrum.

Cortaderia nitida cpDNA
Cortaderiajubata cpDNA
Cortaderia rudiuscula cpDNA
- Cortaderia selloana cpDNA

1 q r Cortaderia splendens

loo r c . c

..r«

, 1.00

L 98/ 98/99-

<0.50

--&

rf

Danthonia parryi
Danthonia spicata
Danthonia unispia

Danthonia alpina MDP481

_ ' — I- Danthonia secundiflora

O [rDanthonn .

11° See Fig. 1d ^T ^" ™£* c/?

H- Danthonia californica var. e

The clade of geophytic grasses is e

II i I ii

grasses) unusual fire biology, flowering

;enus Geochloa to

clade (Fig. IB, node Di) includes til
& Linder, 2007]), as well as l\, .

: :: i

Prionanthium is morphologically unique, with
forked multicellular glands and an acute lemma

lophyletic, it is

«::■■! Ih.it" I ,1

(itose grasses that

lie. It has lew

■■ IP-' ;' ;■.',■'.

",,'.■'.: ","'.\\'.,'

Indeed, if u,

recognized as a segregate genii
arundinacea differs somewhi

(1841) placed all 1

i , i, „

:

praecox H. P. Linder, Fig. IB, node Dii) with

'

i'lPi:'; III'' V, li '" 'Mill \:-\.

' i,'l -]::''..' !" II

: plastid genome derived from a now ex
ae, while the nucl u

The argument for combining the two genera is that

I 1 ,: ■.. I'll ■. '-. "■ ■ .'nil . . ' ■ 'li' t . Up.

mountains of soul gotrophic soils, in

I; i"i I ' i li in <

II; ,l ;■,:■■ !<; r ■, ;

(.','■■:. I i<- <• " . ■■

■sir' , ;..'■',".. :: :;.■- III,!:

not been for this, there would not have bora

.■■ >/' ' ! ;■■■■.-■■■■ ■■ '•!'..
. :.".. ill :■. : I:'..'!

genus Pentaschistis.
are not well known a

i 'i "

.. ' > ■■■;."/,-,"■/,'/:■■>.■■■•

;enies based on the nuclear and the

in a separate paper
pting to conserve (Pirie et al, 2009).

since these genera The monophyly of Danthonia s. str. is not

challenged (I

I, . 1,1,1,1 II ! |

the distinction, though,

This could be used as

i key for separating

i 1 1

I 1. 1 :'.;■,:.■( Ik:'. ::.■■.

logically and also has strong molecula

In ii II i I 'I |

■ ' - nra.H !,■; (Hi

eris clade.

'< , I U,l; r: ( .i-l ■.

(!.-,,■[.>, ra

(2008). Morphologically, the
by the very long, acute, almost

IT roll: -si U i :

These two genera are kept separate becaus

■-.■. ■■■■■■i-i-
■

along the much

' ..i| Hi

support this split. However, tl

\ , ■:■! ,.

I II I I; III, I I; II

"1 1 Mil: ! :■;"

The position of the \e^v Guinean Cortdderia

logically intermediate betv

(Clayton & Rem lolecular data set

I

II I ill '

geographical disjunction is not an
generic rank. Cor

■ncture is very

with three (or rarely fi the lemma in some

are broad and soi

lemma lobes mostly as long as the

The inflorescence in !alc ihe Now Zealand species.

spikelets, and a It I

lizable by the long lemma awns, it is
spikelets and tei \ cd as monophyletic by either genome partition,

somewhat more compact. Cortaderia archbola n „ I / imp ro thyrsus would force a

'• ■■ ' ' '>

also found in Cor/a. Ilel characters with

I << j!„ ■<

, position of the

• ,.-,■/,.:.:•. 11:,:

partition (Fig. 1C)
places it next to Notochloe, in the surprising
The small easte:

'r . : ! i ill.

partitions. In agree.. rL lhe monop hyly of

'. pilosa. while the plastid
.|.h>ly of Cortaderia
ihe inclusion of C.
L) and Plinthanthesi

result of hybridiza-

data) and nuclear the situation in

micllera <,

■ '■' ' '■'■■■' ■

both taxa are found in pyrophytic heath\ \ egt- i ( ( ^ tner sunDort

.1 : .'"

the two genera i ipecies oi nilc l e ir dita set neither

I M II II I II II

no good reason for upsetting a

Cortaderia presents a number of problems. The

. ■■ {ill V -MM ,11

since the reciprocal
Zealand dadejTn.sT. u (rf ( ^.^ ^ Cortaderia is not

ii", i i in i..

first reported by Barker

.'."::■.; : •' I"'

'.III'::, C: ■■ II , :■:■■ : .■:■

.. ' '. ' I I'll I.'' .'■■-, ell -'M

"I nil I 111 I

poorly developed

*

.

11 f 1/ /'

1 Ml 1 1

1 C 1 A •

I . .. '

adequate for the re;

; ...', :' ' -ill ,'

III 111 II

; : III .• I !.:■,.

ically diverse (e nd without awns,

". / :>-,■'.. uli l.:"ll

" '.■■ ■■ •< !.':■■:■ If IM.

'' ■■■); ■.:■ ;i !<■',■.

.I I! I .1

: i

■!•■■■■■■' ;.:' :

:: :'! in '/"

. . . '

node U) includes

■
omogeneous, and do not force

.: . • . ' i n-ni,;

but it would still be morphoh

I ii , >-:c'Vv;y., i nli i 1 1! i II 1 1 1

of genera with fe Consequently, we

,, ,, ' ' ■- - ~. -■- 1- 1 -"* 1 1 :-.- - i in'

, . ■:■ -'HI'

There have been numerous and different delimita-

i i :■ i ■ ■ ■ .»

Joycea by Linder and Verboom (1996). This was based
I [he relative sizes of the callus

ules that bear resemblence to

!'• , I

i in i i i I In ;

(K\.... Ml:' .-■:;! '

|; III

Taxonomic Treatment

We list the species we accept under each genus

"■ ■'■:■■ ;ii

■Merxmuellera
■Capeochloa
-Geochloa
-Pentomeris

5 9 16

■Chionochloa

-Chaetobromus
-Pseudopentameris
■ Tenaxia
■Schismus

-Rytidosperma
■ Tribolium
-Austroderia

-Notochloe
■Plinthanthesis
Cortaderia

-Danthonia
Chimaerochloa

he character numbers

. . .......

I i .! II. II ill .ill I ill

,...'..: ' ' ' I ' ' ■ ■ . .

indicate the coin ^

attributes that fit). The reason f<»

the genera unique ies, 2a " GWs ™~ *»» *™ ^ " ^ Pseudopmtam

' , , n

account would soon be a key to the species. with mull in

010100(01)0021100(01)10(01)100

010100100111000011101

11011010121100010(01) (01)00

110102110210001(01)01(01)00

110111100210001(01)0(01) (01)00

0(01) 010010021100000 (01) -01

011100100211000101100

110110100210000001000

01012000021120(01)00(01)100

010100110211301001101

010(01)0010020101000(01) (01)0(01)

010100110211000000101

01010010020101001(01)1-0

010100100211(01)00(01)0(01) (Ol)l(C

010100100(12)11200(01)0(01)011

010100(01)002112000010(01)0

010100100(02)1100(01) (01)0(01) (01)

',1 '1,1 .

on pedicel; basal florets same

as

a^sinate

JJLtoi

nu oblique; cary-

nmas dorsally with

dumenlum X

lemmas dorsally

native lo America or Europe XI I II.

I II III ! |, II ill! ,1,11

Spikelels with lull

to Africa I. Merxmuellem

lo Ihe Pacific basin; lelraploid or

lial . \\

plants 0.12-0.9 m

Included species. We include sex en species in

■.-;■■■

1975b, 1987) and as treated by Barker (Gibbs
al., 1990).

Merxinuellera grandiflora (Hochst. ex A.
Rich.) H. P. Linder, comb. nov. Basionym:

Danthonia grandiflora Hochst. ex A. Rich.,
Tent. Fl. Abyss. 2: 418. 1851. Pentameris
grandiflora (Hochst. ex A. Rich.) A. Nelson &

Rich.) S. M. Phil
74. 1995. TYPE:

(holotype, P not s<
S!, TCD!, Z!).

iopia & Eritrea 7:
in monte Silke ad
1840, W. G. Sch
ten; isotypes, BM!, GOET!, K!,

Merxmuellera i

Senckenberg. Bio

(Stapf) Conert,
1970.

(J. G. Anderson)

7. MerxmueUera tsaratananensis (A. Camus)
Conert, Senckenberg. Biol. 51: 133. 1970.

II. Geochloa H. P. Linder & N. P. Barker, gen. nov.
TYPE: Geochloa lupulina (L. f.) H. P. Linder &
N. P. Barker (= Avenc

111. 323. 1841. 1'YPE: Daiuhonia rufa Nees
(= Geochloa rufa (Nees) N. P. Barker & H. P. Linder)
, designated here).

..:;; :■.!■.. I ■.!■(. v.
'I I .1

[ I 1111,1 I Mini

Spikelets with 2 to 7 florets,

I I ■ i! J

;.: . ih- «»l! :

scattered dorsal

i ' ; 'n-

become shorter toward the It.

•< im

column, straight or corkscrewed many times; paleae

'I ■:■:■ \ ! .i'.

I li'ill I I

,1 >; : i:;. ll- II III, II 1 II II Ml 1 1 I III

of caryopsis length.

included in section

Pentaschistis. This concept of the -
ii Bentham and Hooker (li

' ■..■!.-.; : : ill. I,.
.'.

rather than as subgenera.

■rs) \. |». Itarker & H. P.

Linder (Du Pressis.

ribs variously de live, separated by

inversely anchor-shaped girders associated
rder vascular bundles; leaves s\

Distribution and habitat. All three Geochloa

.:■!■" 'i.!'- ii,

lil ! i 1 i

;>m(tnmmata'\nn..

Mem. Acad. Imp. Sci. St.-Petersbourg, Ser. 6, Sci.

However, it can be s. Math. 1: 70. 1831. TYPE: [South Africa.] Cape of

The plants are ,<;

;'i :.li<-.- '■ '!■-. I.- ' •• : "'. ■'..'.;.

^ Ml.' I"'. I'M:

of the Cape plai

unb.) Galley & H. P. Linder by the 2-

1 ■ ■■!<»:<■

closeh related »,

N. P. Barker & I . • r " iie( ' u,,n as l«-tot\|ie.

basal sheaths. In two of the three species, the

\ Barker & H. P.
structure; only mi

ng anthesis. Nees, Fl. Air. Austral,

.,..,. , /.■•.-,; .

fers to the geoj
,r,t« in thic ^nus. This habit is unusual

. . . ' '

— r _ticularly characteristic of
ecies in Geochloa.

''',.,,. ° , Miiiu TYPE: [South Afric

■ ■ .'■ I ;■. 'I "

PRE!)

(Stapf, 1899; Chippendall, 1955). Tl.ev

al., 1990). (holotype, GOET 2322!).

Danlhonm marmrcphala Slapf. Fl. Cap. (Hanev) 7: 522.
1899. TU 1 .,<. | probably from

1. Geochloa decora (Nees) N. P. Barker & H. P. Caledon, 'I l)ivision|, s.d., Thorn

Linder, com!). a s - n - (holotype, K!).

Nees, Fl. Afr. Austral. 111. 332. 1841. Merxmuel-

ot. Staats- in. Capeochloa H. P. Linder & N. P. B,
YPE: South nov . TYPE: Capeochloa cincta (Nees) N. P.

Africa, s. loc, s.d., J. F. Drege 5651 (holotype, B Barker & H. P. Linder

Danthoniazeyheriana Sleud.. Swi. PI. Glumac. 1: 244. 1854. Genus novum quod a Merxmuellera Conert indumenlo

. basalibus glabratis recedit.
Danthonia zeyherianu ,i\« Slapf, Fl.

02 (lc'toUpe. designed ()r ()f whhe s | |in

, i?:,.,; ■

panded or inrolled, sometimes adaxially with a
•\e I lie ligule, some-

up to 200 spun

►chloa lupulina (L. f.) N. P. Barker & H. P. with 2 to 4 fertile and bisexual florets; glumes at

ider, comb. nov. Basin ' 23 mm, upper and

Suppl. PL: 113. 1781 nlar, with 1 vein; (-alius blunt,

P. Beauv. ex Roem. i III i internode; lemma

' '! .li;.!' i [■■ II;";.

rg i n a row across the lemma backs; len
lobes acute to acuminate, sometimes with setae
5 mm; lemma awn 5.5-17 mm, geniculate, with a
4.5 mm, ± twisted <

ill.
I'.aiomy. T--

. •' ■ ■ ■<■;■<■:■ l , .

Bergius) N. P. Barker & H. P. Linder is also found on

renosterveld veg< c species seems

"ill i i n

; ■■ ;■■■ v,>v.hTI
1 1 II I i I 1 1, I ii
is • : '

tufts, while the rest of the lemma is »

.■■f ;■:■'; ;(.;■■ :

II in ■;; i ill «■ || I i,' in i mi in , . r

almost all species.

Etymology. The name refers to the geographical
center for the genus, as chara<

Included species. The four ta\a, including three

al., 1990).

3 of tertiary vascu
vascular bundles. They all se

Bergius) N. P.

Capeochloa arundii

Barker & H. P. Tinder, comb. nov. Basionym:
Andropogon arundinaceus P. J. Bergius, Descr.
PI. Cap. 356. 1767, non Andropogon arundina-
ceus Scop., Fl. Carniol, ed. 2, 2: 274. 1772, nom.
illeg. Andropogon bergii Roem. & Schultes, Syst.
Veg. ed. 15 bis (Roemer & Schultes) 2: 813.
1817, nom superfl. Danthonia arundinacea (P. J.
Bergius) Schweick.. Notizbl. Bot. Gart. Berlin-
Dahlem 14: 1938, non Danthonia arundinacea
Steud., Nomencl. Bot., ed. 2. 1: 482. 1840.

Senckenberg. Biol. 51: 132. 1970. TYPE: [South
Africa.] s. loc, s.d., s. coll. (holotype, SBT!).

; :

111. 334. 1841. T\rt'

litre. LPS 2593!).

■■■■>■'■ " :■'■ ; .■.■■■■

ium: UPS 25 ( >:;

s selected as lectotype, as it is
a better specimen.

2. Capeochloa cincta (Nees) N. P. Barker & H. P.

Nees, Fl. Afr. Auslm

/era cincta (Nees) Conert, Senckenberg. Biol. 51:

132. 1970. TYPE: [South Africa.] "In Promotorio

s.n. (lectotype, designated by Conert [1970: 132],

2b. Capeoclilo P. Barker & H. P.

Linder subsp. sericea (N. P. Barker) N. P.

:

Barker & H. P. Linder,
Merxmuellera cincta (Nees) Conert subsp. sericea
N. P. Barker, S. African J. Bot. 65: 105. 1999.
TYPE: South Africa. Eastern Cape: Rufanes river
mouth, 9 Nov. 1997, N. P. Barker 1545
(holotype, GRA!; isotypes, BOL!, K!, MO!,
NBG!, PRE!).

3. Capeochloa setacea (N. P. Barker) N. P. Barker
& H. P. Linder. comb. nov. Basionym: Merx-
muellera setacea N. P. Barker, Bothalia 21: 27.
1991. TYPE: South Africa. Western Cape: Groot
Winterhoek Wilderness Area, s.d., R. P. Ellis
5500 (holotype, PRE!).

18, fig. viii. 1812. Danthonia DC. sect. Penta-
meris (P. Beauv.) Steud., Syn. PL Glumac. 1: 238.
1855. TYPE: Pentameris thuarii P. Beauv.

.
& H. P. Linder).
Chondrolaena Nees, Fl. \fr. Auslral. 111. 13.°.. 1841,

ees) Galley & H.

Sees, Index Semi

Afr. Austral. 111.

280. 1841.

doules (Thunl).) Gallic

designated by Phillips [1951: 121]).

ro.s7i.s- Slapf, Fl. Cap. (Harvey) 7: 760. 1900. TYPE:

•riu Miinn. ex Benth. & Hook, f. Gen. PL 3: 1158.
1883, non Achneria P. Beaux., Kss. Agrostogr. 72, 146.
1812. [frachneria Sprague. J. Bot. 60: 138. 1922,
: •
JAPE: Achneria microphylla (Nees) T.
Durand «\ Seliin/. (

= I'enlameris microphylla (Nees) Galley & H. P.
. designated here).

■ . . I id! !■ mI

'■ ■' : ■■ ■ " i • ■, 1 1 ■: ■■ l * : -.

;.i : ; ,.,,

".

•Ic-, iMii ; i

i I; lii I I illliinlii

tufts of hair on the palea margins, these not infolded,

.'n "'!■'. - ■:. in

I in, :i i i
rarely punctate, up to 6/10 of the caryopsis length.

i he name in the

:-.h ::■■:,■■
. IN ; .: ..I,,!-.',,; i 1..1 "

I '■■.''. : ■;■ : '!!■'

interpret the name at sectional rank. The 1

III:.' ':■( ":. I' 'J':

1 Ml

(1841) had grou ine R. Br. into

Dii an incorrect

er (1883) recognized that ll:

. i

refore recognized

Munro ex Benth. & Hook. f. i

species in Kriaclme but did not list them. Here we

Cytology. 2n = 14, 24, 26, 28, 40, 42, .

,11 ..],■!

Spies et ah, 1990; du Plessis & Spies, 1992).

Anatomy. The leaves are orthophyllous or scler-

inversely anchor-shaped girders associated

1- and 3-ordc-r

)(); Galley el ah,

of the Afrotemperate fl<
2007), wit
Floristic :

introduced into \ have become

species of Pentameris are found in the Ca]

(Hedberg, 1964; Lind & Morrison. 1974), and in the
noon, where P.
grassland on the mountain summit (Maitland, 1932).
Discussion. This large clade of 83 species is very

, lii ill II

ll' I M< I.-;'. 'I ii' ' ■

species with m< is per spikelet);

Galley & Linder. 2007). an immense variation in

■( i.- (Linder & Ellis, 1990b);
iivimial species; hairy ovary

(II & Linder, 2007); and cytologic^ \arialion,
The genus has been studied from various aspects

i, „ ill:- r.V
lnli'

typical of the genus), but it also has the vil

1 1 i. Ii i ' '

naea 7: 314. 1832.

2. Pentameris glacialis N. P. Barker, B<

44. 1993.

3. Pentameris hirtiglumis N. P. Barker, Bothalia

■■hi. PaviLlistumn-b Unic;.^- . . '

ophila N. P. Barke

Herb. 12: 95. 1990. TYPE: South Africa. Natal,
Natl. Park area. Inner Tower Ravine, 17 July
1963, E. E. Esterhuysen 30242 (holotype,
BOL!).

Galley & H. P.

trsonii Stapf, Fl. Cap. (Harvey) 7: 493. 1899.
TYPE: South Africa. Natal, Mt. Currie, 1 Jan.
1883, W. Tyson 1312 (holotype, K!; isotypes,
BOL!, SAM!).

IVc. Pentameris P. Beauv. sect. Pentaschistis

(Nees) H. P. Linder & Galley, comb. nov.

Fl. Afr. Austr. 111. 280. 1841.

.■ri :■■■: : : ■ " ■: ; ■: '

and the plants often have multicellular glands.

Included species. This section includes 72 species,

; Ml :■.. ii •■>.•(<■.

acinosa (Stapf) Galley & H. P.
Linder, comb. nov. Basionyni: Pentaschistis
acinosa Stapf, Fl. Cap. (Harvey) 7: 495. 1899.
TYPE: South Africa. Cape Province: Appelskraal
:inde), s.d., K. L. P.
Zeyher 4539 (lectotype, designated by Linder &
Ellis [1990a: 99], K!; isotypes, B!, H!, P!, S!,
SAM!).

. P. Barker, Bothalia 23:

H. P. Linder & Galley, sect. nov. TYPE:
Pentameris tysonii (Stapf) Galley & H. P. Linder

inmculala (Nees) Slapf, Fl. Cap. (Harvey) 7: 496.
1899. TYPE: South Africa, s. loc, s.d., /. F. Drege

•■ ,',-.,.. ■. : I-!).

tameride 2. Pentan

Included species. Only two species ;

Pentameris praecox (H. P. Linder) Galley &
H. P. Linder, comb. nov. Basionym: Pen-
taschistis praecox H. P. Linder, Contr. Bolus

2b„ II . H I 'Hi i i L I ;

(Stapf) Galley & H. P. Linder. comb. nov.

..: ; IIO \, ill / cr; :■■■■■■

(Harvey) 7: 504. 1899. Pentaschistis airoides
(Nees) Stapf subsp. jugorum (Stapf) H. P. Linder,
Contr. Bolus Herb. 12: 48. 1990. TYPE: South

;■!■• l"-''U.lU

P. Linder, comb. nov. Basionym: Pentaschistis
alticola H. P. Linder, Contr. Bolus Herb. 12: 79.
1990. TYPE: South Africa. Cape Province:
Ceres, Milner Vlakte in Hex River Mtns., 20
Nov. 1987, H. P. Linder 4486 (holotype, BOL!;
isotype, S!).

4. Pentameris ampla (Nees) Galley & H. P. Linder,

I '-i

Afr. Austral. 111. 277. 1841. Achneria ampla
(Nees) T. Durand & Schinz, Consp. Fl. Afr. (T. A.
Durand & H. Schinz) 5: 836. 1894. Pentaschistis
ampla (Nees) McClean, S. African J. Sci. 23: 282.

African Bot. 5: 53. 1939. TYPE: South Africa.
Cape Province: betw. Paarlberg & Du Toits Kloof,
s.d., /. F. Drege 76/
Linder & Ellis [1990a: 59], B!).

Friachne pallida \ees, Fl. Afr. 4us

pallida (Nees) T. Durand & Schinz, Consp. Fl. Air. (T. A.

Durand & H. Schinz) 5: 836. 1894. TYPE: South Africa.
Avarlkopsriver, s.d., C. F. Ecklon s.n,

(holotype, B!).
Eriachne aurea (Steud.) Nees var. virens Nr

Austral. 111. 276. 1841. Achneria aurea (Sleud.) T.

Durand & Schinz \ar. rirens (.Nees) Slapf. Fl. Cap.

(Harvey) 7: 459. 1899. TYPE: South Africa. Cape

Province: Du Toils Kloof, s.d., /. F. Drege s.n.
!; isotype, K!).

: ' ■

& H. P. Linder, comb. nov. Basionym: Pen-

■'. ', .■:■■■'

Bot. France 74: 689. 1927. TYPE: Madagascar.

•'..:,; f ,■,-.' I "/■ :!.■■'

:)a: 104], P!).

6. Pentameris argentea (Stapf) Galley & H. P.

■!■ . ■ ■.■.■:■■■■.

argeniea Slupf. Fl. Cap. (Harvey) 7: 487.
1899. TYPE: South Africa. Cape Province:

. .ij . ',..■:.. '", /('..

Wolley-Dod 3342 (lectotypc, designated by
Linder & Ellis [1990a: 68], K!; isotype, K
fragm. at PRE!).

7. Pentameris aristidoides (Thunb.) Galley & H. P.

Linder, comb. nov.

Thunb., Prodr. PI. Cap. 22. 1794. Danthonia

triclwtoma Nees, Fl. Air. Austral. 111. 318. 1841,

Stapf. I I Cap. (Harvey) 7: 485. 1899. TYPE:

There are two collections in the Thunberg Herbar-

. -81. It is not clear

'■>■■■ ' i: ''

8. Pentameris aristifolia (Schweick.) Galley & H.

aristifolia Schweick., Repert. Spec. Nov. Regni
Veg. 43: 89. 1938. TYPE: South Africa. Cape
Province: 10 mi. SF of Williston, s.d., J.
Hutchinson 981 (holotype, K!).

9. Pentameris Galley & H. P.

Thunb., Prodr. PL Cap. 20. 1794. Sorghum
asperum (Thunb.) Roem. t^ Scliult.. S\-l. \ eg.
ed. 15 (bis) (Roemer & Schultes) 2: 839. 1817.
aspera (Thunb.) Stapf, Fl. Cap.
(Harvey) 7: 500. 1899. TYPE: [South Africa.
Cape Province:] "V

n t -bis," C. P. Thunberg in herb.

Thunb. 21841 (holotype, LPS! [microfiche
BOL!]).

10. Pentameri Galley & H. P.

■•>'■;■■ ' . >) ': ■]

Flora 12: 470. 1829. Airopsis aurea (Steud.)
Nees, Linnaea 7: 317. 1832. Eriachne aurea
(Sleud.) Nees, Fl. Afr. Austral. 111. 276. 1841.
Achneria aurea (Steud.) T. Durand & Schinz,
Consp. Fl. Afr. (T. A. Durand & H. Schinz) 5:

lit ;;<iii:^i

J. S. African Bot. 5: 53. 1939. Pentaschistis aurea
(Steud.) McClean, S. African J. Sci. 23: 282.

Galley & H. P.

aurea (Steud.) Galley & H. P.

H. P. Linder, comb. nov. Basionym: Pentaschistis

1926. Pentaschistis aurea (Steud.) McClean
subsp. pilosogluma (McClean) H. P. Linder,
Contr. Bolus Herb. 12: 76. 1990, replacement

i (McClean;

H. P. Linder, comb. nov. Basionym: Pentaschistis
bachmannii McClean, S. African J. Sci. 23: 282.
1926, replacement name, pro Agrostis curvifolia
Hack., Bull. Herb. Boissier 3: 384. 1895.
Achneria curvifolia (Hack.) Stapf, Fl. Cap.
(Harvey) 7: 458. 1899. TYPE: South Africa.
Cape Province: near Hopefield, s.d., F. E.

Linder, Contr. Bolus Herb. 12: 31. 1990. TYPE:

• ' . .11, ;(1!: ■!■!!!■

Reserve, 2 Jan. 1970, P. van tier Merwe 1765
(holotypc, STE!).

i (Stapf) Galley & H. P.

torum Stapf, Bull. Misc. Inform. Kew 1914: 20.
1914. TYPE: Lesotho. Leribe, s.d., A. Dieterlen
222 (holotype, K!; isotypes, BM!, P!, SAM!, STE!).

mil.) Galley & H.

borussica K. Schum.. Pflanzenw. Ost- \frikas C:
109. 1895. Pentaschistis borussica (K. Schum.)
Pilg., Notizbl. Bot. Gait. Berlin-Dahlem 9: 517.

BM!, E!, HBG!, K!).

1 ,1

Pentaschistis expansa (Pilg.) C. E. Hubb., Fl. Trap. Afr.

E. Fries & R. E. Fries 1200b (holotype, B not seen;

1854, nom. superfl. Achneria ecklonii (Nees) T. Durand

& Schinz, Consp. Fl. Afr. (T. A. Durand & H. Schinz) 5:

836. 1894. Achneria assimilis (Sleiul.) T. Durand &

Schinz, Consp. Fl. Air. :

836. 1894, nom. ill.-. Afrachneria ecklonii (Nees)

Adamson, J. S. African

ecklor, (r>e ) McClean, S. African J. Sci. 23: 282.

1926. TYPE: South Africa. Cape Province: Klein

Diakenslein al I he LJeigmei. s.d.. ./. F. Drege 1660

(1. t t p 1 ? nated by Linder & Ellis [1990a: 52],

B!; isotypes, BM!, E!, K!).

I'"" ■■ ■'■>■ .■■:':

:
1936. TYPE: Tanzania. Arusha Distr., Mt. Meru, s.d.,
B. D. Burtt 4062 (holotype, K!).

500. 1936. TYPE: Uganda. Tore Distr., Ml. Ruwenzori,

s calcicola (H. P. Linder) Galley &
H. P. Linder, comb. nov. Basionym: Pentaschistis
calcicola H. P. Linder, Contr. Bolus Herb. 12:
81. 1990. TYPE: South Africa. Cape Province:
BrecUdorp, farm Wydgelee, 20 Oct. 1987, H. P.
Linder 4365 (holotype;, BOL!; isotypes, K!,
PRE!).

(H. P. Linder) Galley &

P. Linder) Galley &
H. P. Linder var. hirsuta (H. P. Linder) Galley &

calcicola H. P. Linder var. hirsuta H. P. Linder,
Contr. Bolus Herb. 12: 83. 1990. TYPE: South
Africa. Cape Pn b I ! p f a Wyd-

•I JL " I

BOL!; isotype, K!).

. Pentameris capensis (Nees) Galley & H. P.

biinlei. comb, i

Nees, Fl. Afr. Austral. 111. 271. 1841. Danthonia

radicans Steud., Syn. PL Glumac. 1: 243. 1854,

I

Fl. Cap. (Harvey) 7: 494. 1899. TYPE: South
Africa. Cape Province: Du Toits Kloof, s.d., J. F.
Drege s.n. (holotype, B!; isotypes, BM!, II!, K!,
P!, S!, SAM!).

. Pentameris capillars (Thunb.) Galley & H. P.
Linder. comb. nov. Basionym: Holcus capillaris
Thunb., Prod. PL Cap. 20. 1794. Sorghum
I Koem. cK Schult.. S\st. \ eg..
ed. 15 bis (Roemer & Schultes) 2: 840. 1817.

. . ,i. i |.](i.| .- '. I. ;■■!

Br.) P. Beauv., Ess. Agrostogr. 73. 1812. Pen-
McClean, S. African

18. Pentaineris caulescens (II. P. Lint!

& H. P. Under, comb. nov. Rasionym: Pen-
ta.schist.Ls caulescent H. P. Linder, Contr. Bolus
Herb. 12: 99. 1990. TYPE: South Africa. Cape
Province: Ceres, Buffelshoek Peak in the Hex-
river Mtns., 8 Oct. 1956, E. E. Esterhuysen
type, BOL!).

19. Pentami-ri II. P. Linder)

Galley & H. P. Linder, comb. nov. Basionym:

,1 I": i : . ■■ - S » I I ■

Bolus Herb. 12: 92. 1990. TYPE: South Africa.
Transvaal, Dullstroom, 10 Feb. 1988, H. P.
Linder 4711 (holotype, BOL!; isotypes, K!, M!,
MO!, NBG!, PRE!, S!).

* (K. Schum.) Galley &
H. P. Linder, com])

chrysurus K. Schum., Pflanzenw. Ost-Afrikas C:
110. 1895. Pentaschistis chrysurus (K. Schum.)
Peter, Repert. Spec

40(1): 303. 1931. TYPE: Tanzania. Mt. Kiliman-
jaro, 14 Feb. 1894, G. Volkens 1826a (holotype,

, Pentameris clavata (Galley) Galley & H. P.

, il'I'V ■: • '

clavata Galley, Bothalia 36: 159. 2006. TYPE:
South Africa. Western Cape Province: Koue
Bokkeveld S of Hex Berg, 7 Nov. 2004, C. A.
Galley 567 (holotype, Z!; isotypes, BOL!, E!, G!,
K!, MO!, NBG!, NSW!, NY!, PRE!, S!, UPS!, W!).

colorata (Steud.) Galley & H. P.

Steud., Flora 12: 481. 1829. Pent*

ala (Steud.) Stapf, Fl. Cap. (Harvey) 7: 491.
1899. TYPE: South Africa. Cape Province: Cape
Town, Table Mtn., s.d., C. F. Ecklon 931
(holotype, P not seen; isotypes, B!, E!, K!, S!).

Pentameris dentata (L. f.) Galley & H. P.

L. f., Suppl. PL 106. 1782. Phleum dentatum (L.
f.) Pers., Syn. PL (Persoon) 1: 79. 1805.
Chilochloa dentata (L. f.) Trim, Sp. Gram.

(Trinius) 168. 1<°>2

Desv., Opusc. Sci. Phys. Nat. 65. 1831. Lasio-
Trin. ex Pritz., Sp. Gram.
(Trinius), corrigenda et emendanda, 1(7), tab.
73. 1836, nom. super

Prionachne dentata (L. f.) Nees, FL Afr. Austral.
111. 134. 1841. Pric

Henrard, Blumea 4: 530. 1941. TYPE: [South
Africa.] Cape, Bockland, 1773, C. P. Thunberg
s.n. (holotype, UPS 1773!).

27. Pentameris dolichochaeta (S. M. Phillips)
Galley & H. P. Linder, comb. nov. Basionym:

Bull. 50: 615. 1995. TYPE: Ethiopia. Showa,
Ancobere, 3000 m, s.d., G. Selassie 887
(holotype, ETH!, ETH photo at K!).

28. Pentameris ecklonii (Nees) Galley & II. P.

I in i mil i, n I! i urn, -t: Pnonachn:' , , •
nil Nees, Nat. Syst. Bot. 448. 1836. Chondro-

' . :\r-A II I"
1841, nom. supeifl

Nees var. dentata Nees, Fl. Afr. Austral. 111. 134.
1841, nom. llleg. Prwnanthium ecklonii (Nees)
Stapf, FL Cap. (Harvey) 7: 456. 1899. TYPE:
South Africa, "ad Olifantsrivier fluviam alt. I,
Clanwilliam," s.d., C. F. Ecklon s.n. (lectotype,
designated by Davidse [1988: 151], MO not seen;
isotypes, BM, BM fragm. at PRE!, US not seen,
Z!).

inder, Contr. Rolus
Herb. 12: 92. 1990. TYPE: South Africa.

'•st Reserve, Organ
Pipes Pass, 4 Feb. 1988, H. P. Linder 4685
(holotype, BOL!).

, Pentameris galpinii (Stapf) Galley & H. P.
Linder, comb. nov. Basionym: Achneria galpinii
Stapf, Bull. Misc. Inform. Kew 1910: 59. 1910.
i' -hi
J. Sci. 23: 282. 1926. TYPE: South Africa. Cape
Province: Barkly East. Ben Macdhui, 11 Mar.
1904, E. E. Galpin 6915 (holotype, K!; isotypes,
B!, BOL!, GRA!, SAM!).

s microphylla (Nees) Galley & H. P.

Hinder, comb. nov.

phylla Nees. Fl. \fi Austral III 277, 1841.

Consp. Fl. Afr. (T. A. Durand & H. Schinz) 5:
836. 1894. Pentaschistis microphylla (Nees)
McClean, S. African J. Sci. 23: 282. 1926.
TYPE: South Africa. Cape Province: "in monte

( ' ! I

bri in anthesi," s.d., J. F. Drege 3891 (holotype,
B!; isotypes, BM!, K!, SAM!).

, Pentameris minor (Ballard & C. E. Hubb.)
Galley & H. P. Linder, comb. nov. Basionym:

Pentaschistis horussica (K. Schum.) Pilg. var.
minor Ballard & C. E. Hubb., Bull. Misc. Inform.

-

121. 1930. Per

(Ballard & C. E. Hubb.) Ballard & C. E. Hubb.,
Fl. Trop. Afr. (Oliver et al.) 10: 132. 1937.

(Ballard & C. E. Hubb.) S. M. Phillips, Froc. XIII
Plen. Meet. AETFAT [Association pour l'Etude

Zomba Malawi 371. 1994. TYPE: Tanzania. Mt.
Kilimanjaro, near Peters Hut, s.d.,

■.. I- 1 .'!.

Pentameris montana (H. P. Linder) Galley &
II. P. Linder, comb.

montana H. P. Linder, Contr. Bolus Herb. 12:

83. 1990. TYPE: South Africa. Cape Province:

Worcester, Keeromsberg, 7 Nov. 1987, H. P.

olotype, BOL!).

lensis (Stapf) Galley & H. P.
Linder, com).). no\

lensis Stapf, Fl. Cap. (Harvey) 7: 493. 1899. TYPE:
South Africa. Natal, Riet Vlei, s.d., /. Buchanan
283 (holotype, K!; isotypes, B!, BOL!).

11 ! I! mil mi |< II ii < in! i > i ■/ ■ .

oreodoxa Schweick., Repert. Spec. Nov. Regni
Veg. 43: 90. 1938. TYPE: South Africa. Natal,

■;■,■>;■ 1.11" ■.■I..,

mtn., s.d., A. J. W. Bayer & A. P. D. McClean 273

Thunb., Prod. PL

pallida (Thunb.) Roem. & Schult., Syst. Veg. 2:
657. 1817, nom. illeg., non Danthonia pallida R.
Br., Prodr. Fl. Nov. Holland. 177. 1810.
i 1 i I I ii I ,
Contr. Bolus Herb. 12: 36. 1990. TYPE: South
Africa. Cape Province: Verkeerde Vlei, s.d., C.

' .!:■•: ». II ,1 il-ilT ■'

Ellis [1990a: 36], UPS 2610!).

Ihorua anguslifolia -Nees. Fl. Afr. Austral. 111. 302. 1841.

(Steudel), ed. 2, 2: 298. 1841. /
gustifolia (Nees) Stapf, Fl. Cap. (Harvey) 7: 502.
1899. TYPE: South Africa. Cape Province: on fields al
ZwarlkopMlei and al Vdou. s.d.. C. F. Ecklon HH9
(lectotype, designated by Linder & Ellis [1990a: 37],

Bot. (Steudel), ed.

52. Pentameris pholiuroides (Stapf) Galley & H.
P. Linder. comb. tio\ . Basionym: Prionanthium

7

lips, Intr. S. African Grass. 6, t. 63. 1931. TYPE:
South Africa. Fish Iloek valley, damp hollow,
Nov. 1897, A. H. Wolley-Dod 3394 (holotype, K
not seen; isotypes, BM not seen, BOL!, MO not
seen, PRE!).

1 ; 3 " I'i, iUriiiiiei"

Finder, comb, nov

Steud., Syn. PL Glumac. 1: 221. 1854. Dantho-

. . ' ■■:■:! .'.'; : ,:

1855, nom. illeg. superfl. Pentaschistis picti-

glurna (Steud.) Pilg., Notizbl. Bot. Gart. Berlin-

Dahlem 9: 517. 1926. TYPE: Ethiopia, s.d., W.

lolotype, P not seen).

I i !

is still most unsai leal evaluation of

i i in ii I in

mill I

53a. Pen!

.

b. Pentameris pictigluma (Steud.) Galley & H.
P. Linder var. gracilis (S. M. Phillips) Galley &

II I II " I ■ i

gracilis S. M. Phillips, Kew Bull. 41: 1028. 1986.

His (S. M. Phillips) S. M. Phillips, Proc. XIII
Plen. Meet. AETFAT [Association pour l'Etude

i . M I |

Zomba Malawi 372. 1994. TYPE: Ethiopia. Shoa

.type, K!).

I Galley & H.
P. Linder var. inamiii (Slapf ex C. E. Hubb.)
Galley & H. P. Linder, comb. no\ . Basiomm:
Pentaschislis rnannii Slapf ex C. E. Hubb., Bull.
Mis( Inform Kc w 19 56 501. 1936. TYPE:
Cameroun. Mt. Cameroun, s.d., G Mann 1351
(holotype, K!).

pseudopallescens (H. P. Linder)
Galley & H. P. Linder. comb. nov. Basionym:
Pentaschistis pseudopallescens H. P. Linder,
Contr. Bolus Herb. 12: 72. 1990. TYPE: South
Africa. Cape Province: Ceres, Milner Vlakte,
Hex River Mtns., 20 Nov. 1987, H. P. Linder
type, BOL!).

i pungens (H. P. Lin

pungens II. P. Linder, Contr. Bolus Herb. 12: 97.
1990. TYPE: South Africa. Cape Province:
Clanwilliam Distr., Uitkyk Peak, Cedarberg, 12
Oct. 1975, E. E. Esterhuysen 34010 (holotype,
s. K!, PRE!).

11a (Nees) Galley & H. P.
linder, comb. nov. Basionym: Colpodium pusil-
lum Nees, Fl. Mr. \uslral. III. 149. 1841.
Poagrostis pusilla (Nees) Stapf, Fl. Cap. (Harvey)
7: 760. 1900. Agrostis umbellata Trin., Graminea
Agrostidea. II. Calln

1841, nom. illeg., non Agrostis umbellata Colla,
Herb. Pedem. 6: 18. 1836. Pentaschistis pusilla
(Nees) H. P. Linder, Contr. Bolus Herb. 12: 89.
1990. TYPE: South Africa. Cape Province: Table
Mtn., s.d., J. F. Drege s.n. (holotype, B not seen;

■ , :,■■■: :■:■■■':■■

pyrophila H. P. Linder, Contr. Bolus Herb. 12:
81. 1990. TYPE: South Africa. Cape Province:
Ceres, Milner Peak. Hex River Mtns., 20 Nov.
1987, H. P. Linder 4477 (holotype, BOL!).

reflexa H. P. Linder, Contr. Bolus Herb. 12: 53.
1990. TYPE: South Africa. Cape Province:

.,,.. , , | : ;,.

6 Dec. 1987, H. P. Linder 4531 (holotype, BOL!;
isotypes, K!, MO!, PRE!, STE!).

. Pentameris rigidissima (Pilg. ex H. P. Linder)
Galley & H. P. binder, comb. nov. Basionym:
Pentaschistis rigidissima Pilg. ex H. P. Linder,
Contr. Bolus Herb. 12: 85. 1990. TYPE: South

j

Hex River Mtns., 18 Dec. 1948, E. E. Esterhuy-
sen 14903 (holotype, BOL!; isotypes, NBG!,
PRE!, SAM!).

. Pentameris rosea (H. P. Linder) Galley & H. P.

H. P. Linder, Contr. Bolus Herb. 12: 70. 1990.
TYPE: South Africa. Cape Province: Porterville
Mtns., Groot Winterhoek Forest Reserve, Suurv-
lakte, 14 Oct. 1988, H. P. Linder 4777 (holotype,

i (H. P. Linder) (

60b. Pentamei i i I I I ndei) Galley & H.

:

Galley & H. P. Linder, comb. nov. Basionym:

ascens H. P. Linder, Contr. Bolus Herb. 12: 72.
1990. TYPE: South Africa. Cape Province:
Ceres Distr., Milner Vlakte, Hexriver Mtns.,
24 Oct. 1987, H. P. Linder 4403 (holotype,

(Nees) Steud., Nomencl.

ora 12: 484. 1829, non Schrad.,

Goll. Gel. Air

Fl. Air. Austral. 111.. 287. 1811. replacement name.
>

(Steudel). ed. 2. 2:

Stapl. Fl. Cap. (Hanexl 7: 407. 1809. num. supeiil.

II in -In i ,nii

Bolus Herb. 12: 32. 1000, nom. illeg. TYPE: South
Africa. Cape Piounee: (.ape town, "intei sa\a in
summilale monlis labularis. Kl. Novbr.," C. F. Ecklon
pes, E!, K!).

.■■■■. Til: l,

1698 (lectotype, designated by Linder

H. P. Linder, comb. nov. Basionym: Pentaschistis
scandens H. P. Linder, Contr. Bolus Herb. 12:
101. 1990. TYPE: South Africa. Cape Province:
Bredasdorp, Bontebok Park, 25 Aug. 1962, J. P.

\

64. Pentameris setifolia (Thunb.) Galley & H. P.
Linder. comb. nm. B.i

Thunb., Fl. Cap. (Thunberg, ed. 2), 1: 413. 1813.
Achneria setifolia (Thunb.) Stapf, Fl. Cap.
(Harvey) 7: 462. 1899. Pentaschistis setifolia
(Thunb.) McClean, S. African J. Sci. 23: 282.
1926. TYPE: [South Africa.] s. loc, s.d.,
Thunberg s.n. in herb. C. P. Thunb. 23857
(holotype, UPS!).

ca Nees, Fl. Ah. Austral. 111. 281. 1841.
I'enhimrris mitliu, (N<<s) Mend.. Nomenel. Bol.
(Steudel), ed. 2. 2: 299. 1841. TYPE: Soulh Africa.
Cape Province: Los-Tafelberg, s.d., J. F. Drege 3892
(holotype, B!; isotype, B fragm. al PRE!).

Pentameris porosu (Nees) Sleud., Nomenel. Bol.
(Steudel), ed. 2, 2: 299. 1841. TYPE: South Alrica.
Cape Province: betw. Windvogelberg & Swartkei River,

111. 283. 1841. Danlhoma circinnala Sleud., Svn. PL
Glumac. 1: 239. 1854. TYPE: Soulh Africa. Cape

■'■!■,< h :.,-

not seen: isohpes. I!M!. k!. ()\t!. PKC!. 13 liajtm. al
PRE!, TCD!).

Consp. Fl. Afr. (T. A. Durand & H. Schinz) 5: 836.
1894. TYPE: Soulh Africa. Cape Province: Witteberge,

.' ' i (.:•.'. ^ I I/:-.!,:

at PRE!, K!).

11a (Stapf) Galley & H. P.

: !'.'i. ■' , h

tomentella Stapf, Fl. Cap. (Harvey) 7: 502.
1899. TYPE: South Africa. Cape Province:
Namaqualand, Modderfonteinsbcrg. s.d.. ,/. F.

lap. (Harvey) 7: 507.

land, betw. Pedros Kloof & Lilyfontein, i

Galley, Bothalia 36: 157. 2006. TYPE: South
Africa. Western Cape Province, Ceres, Baviaans-
berg, 11 Nov. 2004, C. A. Galley 577 (holotype, Z!;

' .'i:. /,!l.

68. Pentameris triseta (Thunb.) Callcy & H. P.
Linder, comb. nov. Basionym: Arena triseta
Thunb., Prodr. PI. Cap. 22. 1794. Trisetum
villosum Pers., Syn. PL (Persoon) 1: 97. 1805,
nom. superfl. Pent a;

Linnaea 7: 310. 1832. nom. illcg. Danthonia
rillosa (Pers.) Tun , M( m Ac ad Imp ^c i St.-
Petersbourg, Sci. Math, Seconde Pt. 33. 1836,

-

Pentaschistis thunbergii (Kunth) Stapf, Fl. Cap.
(Harvey) 7: 507. 1899, nom. illeg. Danthonia
collinita Nees, FL Afr. Austral. 111. 315. 1841,

■ ; r!

Fl. Cap. (Harvey) 7: 495. 1899. TYPE: [South
Africa.] s. loc, s.d., C. P. Thunberg s.n.
(1 1 I I UPS 2632!).
These names all cite Arena triseta, and so include
its type. Hence they are all homotypic. Ho

i II i

'■y».. IV !■■

Galley & H. P. Linder, comb. nov. Basionym:
Danthonia Irisetoides Hochst. ex Steud., Syn. PL
Glumac. 1: 244. 18

(IIochsL. ox Sleud.) Pilg., XoLizbl. Bot. Gart.
Berlin-Dahlem 9: 516. 1926. TYPE: Ethiopia.
Near Debra Eski, s.d., W. G. Schimper 109
. isotype, K!).

70. Pentameris velutina (H. P. Linder) Galley &
H. P. Linder, comb. nov. Basionym: Pentaschistis
velutina H. P. Linder, Contr. Bolus Herb. 12: 66.
1990. TYPE: South Africa. Western Cape Prov.,
Porterville Mtns., on ridge on Berghof farm, 14
Oct. 1988, H. P. Linder 4791 (holotype, BOL!;

7 1 . Pentameris i

P. Linder, comb. nov. Basionym: Pentaschistis
veneta II. P. Linder, Contr. Bolus Herb. 12: 29.
1990. TYPE: South Africa. Cape Province:
Cedarberg, Blaauwberg, s.d., J. F. Drege 1682b
(holotype, K!).

• .' I I'll,

; in i >■■■;:■ '/

■ i i: |.'-.||iV.

1 1 1 i I 1 1 1 1 ■ I ii

'■ ' .■■> ;.■ t.r.. : |;\'
in i ii I 111 i i In i

Cytology. 2n = 42 (Abele, 1959; Brock & Brown,
1961; Beuzenberg & Hair, 1983; Dawson, 1989;
Connor & Lloyd, 2004; Murray et al., 2005).

I

1 i ill I Ii i

■I. —I!. h-mm.i I

i Zotov, New Zealand J. Bot. 1: 87.
1963. TYPE: Chionochloa rigida (Raoul) Zotov

i > :;■. ,.■:■■ in.'. ^

i.i"i,iih.'i,iiiir<>

;

i I i i

•s ± paniculate, open to
i more than 2 florets, all

1 ii |; II 1 , 1 II II

i the chlorenchyma

I " ' 1 1 1 1 i I 1 1 1

absent.

Twenty-two of the 24

species are found in

Howe Island, and

endemic to the Mt.

are found on the var

ous off-shore islands around New

the mountains of So

species are cliff spe

rocks. The; ecology

of the species has re

attention due to th

lit) to binning and

grazing and their

especially in the n

lie South Island of

New Zealand (Conn

or, 1967).

'I i, iii I mi in

.■„■■; II; I"- : i

massive, grasses.

,:.'::;" ,.ir,

1 1 1 1 ili'

occurs in many other genera, it is usually uncommon.

<l,v - '■;(■<.«»* . ■ :

occluded by the de

I i hi i I i

due to hybridization (Connor,

- i. i | I! i 'III in mI In hi i i. ii

Included species. This genus of 25 species was
(1991), whose

Chionochloa beddiei Zotov, New Zealand J

'

(G. Forst.) Zotov

• ■ ' . .,-.'; II; )• p..

Bot. 25: 164. 1987.

Zotov, New Zealand J.

s Zotov subsp. flaves-

Bot. 1: 97. 1963.
Chionochloa flav,

Chionochloa fla \

5.
3. Chionochloa howensis S. W. L. Jacobs,

•!.•,. ( i JlriUMM ■■■v\\\ :■■:■ ■ ■■ .

.locliloa lanea Connor, New 2
Bot. 25: 165. 1987.

■hb.

Bot. 8: 91. 1970.

Bot. 1: 104. 1963.
20. Chionochloa pallens

22a. Chionochloa rubra Zotov subsp. rubra.
22a(i). Chionochloa rubra Zotov var. rubra.

22c. Chionochloa rubra Zotov

23. Chionochloa spiralis Zotov, New

25. Chionochloa ^

Milt. Hot. Staats-
i 10: 303. 1971. TYPE: Pseudo-
mtha (Schrad. ex Schult.) Con-

■ ,. :. -. !ll !l I

Plants forming perennial tussocks, suffrutescences,

<■'-< \: 'in ■■■■!.■ ■■■:■'■■:! ■■■■<■■ ■'

" ill; in I- ni.-ir:ir u\ iin-
;
exceeding trie lemma Lobe

In!

:.■-.

hilum 7/8 as long as fruit.

Cytology. Unknown.

Anatomy. The leaves are mostly sclerophyllous,
laxial ribs various!) develo|

inversely anchor ociated with both

Distribution and Ir
three species grow on sandstone or granite substrates,

■■■'■ ' ,;.!i

fynbos after fire (Verboom & Linder, 1998).

Discussion. Althou;

... \s. 2-25 inn)

,

leris brachyphylla (Stapf) Con-

ulley, Nat. Syst. Bot.,
ed. 2, 449. 18.H6. Danthonia l)(.. sect. Chaeto-
bromus (Nees) SLeud.. Syn. PI. (;lumac. 1: 238.
1854. TYPE: Chaetobromus involucralus (Schrad.)

• <■:,■:].) I ll-Nlh:' ".'■■

Plants forming perennial tussocks or mats, culms

indistinct veins, dorsall

developed from the ape
awn exceeding the lemr

Anatomy. The leaves are orthophyllous, expand-

>-iV ;h , : ,

'. !:'."Uil;iir n,n ■

Distribution and habitat. The genus include-- a

ill In | II ii I I mi

ibilals. Chaetobromus involuci
sericeus occurs on Quaternary coastal sands

substrates in the more mesic southwest, and subspe-

' " • ■ ;■!:»:. ■■!■-> .' -n ■■■■■■.\

Discussion. Although molecular data indicate that

i I i, ii II

liimlii i ,

i ■ I :■.■!: i' ■::■

I I.: III.!-"

■ ' :■■ ; ■: 1 ' ' I ■
' ■•..|<l.':i;\

Included species. Various classifications have

-■ ■".. ' i !' : I ■
I _ I I

We follow the latl species, but with

and Linder (1998).

s (Schrad.) Ne<

ves: I I). Cliji

Cortaderia hapalotricha (Pilg.) Conert, Sysl
102. 1961.

I : >,■..■-■■,■ ■ ■■■■

lemmas and long lemma hai

e only a single \
,ped and in many species sc

rcely visible, except in
eluded in Lamprothyr-

.■■■;!.■ ■■■: :■■

mo I I | 1 1 However, Cortaderia is para-

:. , ■■ '■■■/ ■.?■.■:■■,■■< y .

sections in Cortaderia.

Villa. Cortaderia Stapf sect. Cortaderia.

Cortaderia hieronymi (Kuntze) N. P. Barker &
H. P. Linder, comb. nov. Basionym: Triraphis

ii. PI. 3: 373. 1898.

I Hack, ex Stuck-

ert, Anal. Mus. Buenos Aires, Ser. Ill: 4: 484.

"' : "."i ■■'.:<■:.■■>■■..■..

Bot. Jahrb. Syst. 37, Beibl. 85: 58. 1906. TYPE:
Argentina. "Cordoba, pr. urbem," 6 Nov. 1881,

Mag. t.

9. Cortaderia modesta (Doll) Hack, ex Dusen,

Cortaderia peruviana (Hitchc.) N. P. Barker &

sus peruvianas Hitchc, Proc. Biol. Soc. Wash.
36: 195. 1923. TYPE: Peru. Yanahuanca, 16-22
June 1922, J. F. Macbride & W. Featherstone
K not seen).

)5. 1961. TYPE: Con:

Included species. Although several species of

■■.■■:,;,.'.V;..< •

species-level rex i the genus. More-

) Pilg., Bot. Jahrb.
$74. 1906.

3. Cortaderia bifida Pilg. J

1906.

4. Cortaderia boliviensis Lyle, Novon 6

5. Cortaderia «•

114'., (CiHi-isin! 'i ■

Notizbl. Konigl. Bot. Gart. Berlin 6: 112. 1914.

16. Cortaderia selloana (Schult. & Sch
2: 325. 1900.

17

Cortaderia series

U.S. Natl. Herb. 24: 348. 1927.

Hitchc.

Conn.

18

Cortaderia

Chron., ser.

S

19

Cortaderia

vaginata

SelW

■ 1: 9.

i

SxsL. Anal. Arundineae 117. 1961. TYPE:
Cortaderia pilosa (d'Urv.) Hack, ex Dusen
(= Arundo pilosa d'Urv.). Figure 11.

.

cells in the

Plants gynodioecioiis, forming tough, perennial

: . ' '

1. Cortaderia pilosa (d'Urv.) Hack

ex Dusen,

-'Hi':- :

id. Magellanslandt

rna (1895-

1897) 3, pt. 5: 222. 1900.

i i;. hi ' in, -1

la. Cortaderia pilosa (d'Urv.) Hack.

,ar. pilosa.

lb. Cortaderia pilosa (d'U

(Conert) Nicora, Darwiniana 18: 80

var minima

generally witli i male spikelets

. 1973.

IX. Austroderia N. P. Barker & H. P

I..:!. ' h:HM'" •

• I ii ill LnillliJ ,

Distribution and habitat. Austroderia is restricted
to New Zealand, where it occupies divers

single vein. The plants are massive, and the

i is.inh i ■•..

ii I I i

Cortaderia, and there seem to be no clear morpho-

1. Austroderia ) N. P. Barker &

[ 1,1 I , i I i
fulvida Buchanan, Trans. & Proc. New Zealand

fulrida (Buchanan) Kirk. Trans. & Proc. New
Zealand Inst. 10: app. xliii. 1879. Cortaderia

II l< :

84. 1963. TYPE: New Zealand. Wellington, s.d.,
J. Buchanan s.n. (holotype, WELT not seen).

2. Austroderia f. P. Barker & H.

ii]>. nov. Basionym: Arundo richar-

;itt i'.M.I... '•• III. ■■

Rich., Voy. L' Astrolabe 121. 1832, non Arundo
australis Cav., Anales Hist. Nat. 1: 100. 1799.
Arundo kakao Sleud.. Svn. PL Glumac. 1: 194.
1854, nom. illeg. Cortaderia richardu (Endl.)
Zotov, New Zealand J. Bot. 1: 84. 1963. TYPE:
New Zealand. Havre de l'Astrolabe, Nelle
Zelande, s.d., Herb. Rich. no. 29 (holotype, P
not seen; isotype, CHR 236584 not seen).

3. Austroderia ) N. P. Barker &

H. P. hinder, com!.

splendent Connor, New Zealand J. Bot. 9: 519.
1971. TYPE: New Zealand. Ruapuke Beach, 20
Dec. 1967, Bell s.n. (holotype, CHR 184354 not

4. Austroderia toetoe (Zotov) N. P. Barker & H. P.

Linder, comb. nov. Basionym: Cortaderia toetoe
Zotov, New Zealand J. Bot. 1: 85. 1963. TYPE:
New Zealand. Wainui-o-mata Valley, s.d., V. D.
Zotov s.n. (holotype, CHR 95457 not seen).

5. Austroderia 1 N. V. Barker &

H. P. Linder. comb. nov. Basionym: Cortaderia
lurbaria Connor, Yew Zealand J. Bot. 25: 167.
1987. TYPE: New Zealand. Chatham Island,
Rakeinui, s.d., D. R. Given 13899 (holotype,
CHR 417471 not seen).

. Sleud.. ;
1853. TYPE: Plinthanthesis urvillei Steud. (lectc

I i '■ ■: ■■ I' l: i: ■ 3 ( - ? '" '

. Sheaths persistent, shiny and white; ligule ciliate;

j lions, persistent on the sheaths.

lorcMcncc paniculate, open. Spikelels generally

■: ■■::■!;■:■;:<:■■; ,;,;"

1 1 1 I - in II " ill

Discussion. Plinthanthesis is closely related to

.I i'vik hi; i;ii..

a short callus wil nt to the rachilla,

very short awns, ryopsis. However,

ii, I i i
■ 1 1; ■■ : ■■ a : ■■ ilium : r<-

:• >: I ' '■■ ■

Included species. Three species arc included in

South Wales (Jacobs, 1994) and Australi
2005).

florets, 5-9.5 mm. uith 1 to 7 nene-. ill!
i i I nil II i I

,,'IM 'I ■ ill. I

ill J ,1 I II I U i

g as die caryopsis.
Nomenclatural note. Veldkamp (1980, 1981)

J gar (1981) and
:obs (1982).
Cytology. Unknown.

XL Notochloe Domin, Repert. Spec

Veg. 10: 117. 1911. TYPE: Notochloe microdon
(Benth.) Domin (= Triraphis microdon Benth.).
Figure 13.

Plants forming perennial tussocks with diverging

I, I i i : « |.lli III, in,

v with 7 to 9
florets; glumes shorter than the fiord;

.■■. ■':■!.'.,■!■.■ l , '

less Lhan 1/2 the length of the rachilla internode;

1 in ill in
except foi the seabrid I

'•ii i-l ill- : • I I -■=!:■ : 1,'i,.'

drib flanked l>\ adaxial

■ 1 1 1 1 ■

Discussion. Notochloe i

I i |"i II

II II i I i II

:

:\\W:: ,ic-. ;( ; ;

rge, empty cells

I • i i i II ,

mi;. 1 1- w:
ill ml i II i i I i

;;i in v, mini
was used in L 1 1 1-
explicitly permissable under A

ii ii i

[Ms is to be

l\ dues not constitute a

Included species.

Notochloe microdot

:. Chimaerochloa H. P. Linder, gen. nov. TYPE:
Chimaerochloa archboldii (Hitchc.) Pirie & H. P.

I II M I

ure 14.

ideria Stapf lobis lemn

ligule ciliate; leaf blades sclerophyllous

iflorcscences paniculate, open

J to 7 florets, all similar;

' I I ' I II i i II M, i II

i, I • III I ill r Ill II II Ii! Millill III II ,'j

ill'.;- II; i i;i :.,'.■
c. :■>. -rt.) I I.'; i.

a flat, corkscrewed base and a

Etymology. The species takes on the appearance

Ipine Flora .

\:;r •'.'■■

72 (Borgmann, 1964).

OrjijmtLai-od:ilosa;r.L->::]:iliolkli!;i f ^ a' .

archbohlii Hitchc, Brittonia 2: 114. 1936.

II ! ' ', I'M

Taxon 23: 596. 1974. Chionochloa archboldii
(Hitchc.) Conert, Senckenberg. Biol. 56: 156.
1975. TYPE: New Guinea. Central Division:
Wharton Range, Murray Pass, 2800 m, 12 June
1933, L. J. Brass 4194 (holotype, US not seen).

3, 3: 32. 1805, nom. cons. Merathrepta Raf., Bull.

Bot. (Geneva) 1: 221. 1830, nom. superfl. TYPE:

ieauv. ex Roem. &

. ■ ■ s; . ;■ i.>: ;■ " ■ ■■,

uiik Mil: r iru,
form cells.

: '.'■<.,■:■,...:,
'■ '.'HI'.' '

11 '' I " I I Hi I I I

',.'■■. .'.■!!" n-<i ip. nth."
■'■■■' ''. I ml' :■■'■'•

. ■. . Hi i..'-ij!';

I I, i 1 ,! I

leaves. Sheaths white or brown, p< tei t

. '' '

.■Ml: "1 '.'.■■■:

Infl< t i It

ill 2 to 10 simila

' ' I : ' >

acute, shorter to longer than tl!

nil i! i )

corkscrewed basi irlike apical part;

1 i ,1 lull

= ■ •■:l,ilm..[l;'.;.

.Hum ca. 1/10 to

Cytology. 2n = 18, 24, 36, 48, 72, 98 (Stebbins &
vtlen, 1960; Love

■; : , i I",, i

Distribution and habitat. Dantlumia is wide-

'.f-irnKi ii i mi \<r. ..■■■en

mesic meadows, coastal meadows,

Discussion. The genus Danthonia is related Lo

■■;.■.. ■. i;'..i i ■

1 1 ! I III ill '

li IK!:', fi-|;il , .: II.

wide in comparison to their length.

i I

'• ' 'I nu'; ; <■-■

i Vest, Mora 4: 145.

Vasey, Bull. Torrey

192. 1902.
6. Danthonia <•;

Proc. Calif. Acad.

54: 308, fig. 5. 1975.

Davidse, Novon 2(2):

i (Steud.) Pilg., Notizbl.
10: 759. 1929.

. Presl & C. Presl

22b. Danthonia secundiflora J. Presl

subsp. charruana (Swallen) Roseng., B. R.
Arrill. & Izag., Gram. Urug. 55. 1970.

1mm

Lodicules. Drawn by Jas

IVesl 25. Danthonia uiiis|i

subsp. mattheii C. M. Baeza, Sendtnera 3: 55. Canad. PL Endogens 2: 215. 1888.

1996 ' XIV. Tenaxia N. P. Barker & H. P. Linder, ge
23. Danthonia sericea Nutt., Gen. N. Amer. PL TYPE: !chrad -) N " R Ba

(Nuttall) 1: 71. 1818.

Schult., Syst. Veg., ed. 15 bis (Roemer
690. 1817.

the apical portion

emma lobes; paleae

or ell

iptical, ± glabrous

with

bristles as well as

i nutlet or caryopsis,

1/2 and the linear,

, 36, 56 (De Wet, 1954; !

Anatomy. Leaves sclerophyllous, expanded or

■■■■ •■■■. ;r''. m-

iima sinus, as is
can be separated from Pentameris as they

species of Tenaxia

Distribution and habitat.
are typical mm

is the domimml
permanent bogs.

; .';■. f '■.'-■■■;■: II !l

' if I'll :■. .■

, I II ! ' i i

IC.'I. : ■' : ft- ■ : .
' I -, ,■,

hi ! 1 1 1

indumentum is o to tufts, but this

i;; i i" i i ill I i Hi I !n i i

li , in * I

i ,.. i iiisivv..
"orm tough tussocks capable of

:' '-Ill In: 'I

harsh habitats.

Included species. The eight species included in
tins Tenaxia were previously cl

several regional treatments,

Barker & H. P. Linder, comb. nov. Basionym:
Danthonia aureocephala J. G. Anderson, Botha-
lia 8: 170. 1964. Merxmuellera aureocephala (J.
G. Anderson) Conert, Senckenberg. Biol. 51:

i (Jaub. & Spach) N. P.

Tenaxia .
Barker & H.

. <\:-: ."in l . i |

Orient. 4: 46, pi. 331. 1851. TYPE: India, "ad

\ . I i

type, P not seen).
Tenaxia cumminsii (Hook, f.) N. P. Barker & H.

India (J. D. Hooker)
7: 282. 1896. Danthonia jacquemontii Bor, Kew
1952, nom. superfl. TYPE: India.

Fl. Brit. India (J. D. Hooker) 7: 282.

jaa/uenionlii \ ar. mm:

1952. nom. imal. T\PE: India. "Alpine Himalaya.

Garwhal to Sikkim," s.d., herb. Strachey & Winterbot-

lom 2 (holotype, K!; isolype, BM!).

.:;■:,:<:,:<

,.: ■ , i, ii

an der Siidsiete der Berge bei Lichiang, 4200 m.," Sep.

1914, C. Schneider 2:<

04 not seen).

Bor (1952) proposed Danthonia jacquemontii as a
nana Hook, f.,

■I i ii

M i i 'I '

. P. Barker & H. P.
Linder, comb. nov. Basionym: Danthonia dis-
ticha Nees, Fl. Afr. Vustral. 111. 335. 1841.

Uerxmuelteru disticha (Nees) Conert, Sencken-

(Nees) Cope, Fl. Zambes. 10, 2: 9. 1999. TYPE:

" • "'"•'' l i ■ ■ ■

5000-5500'," J. F. Drege (lectotype, designated

.. i,:.n;,l |i'- . ' '

Tenaxia dura (Stapf) N. P. Barker & H. P.

Linder. comb. tiov. Basionym: Danthonia dura
Stapf, Fl. Cap. (Harvey) 7: 527. 1899. Merx-
(Stapf) Conert, Senckenberg. Biol.
51: 132. 1970. TYPE: South Africa. Little
Namaqualand, Kamiesbergen, betw. Pedros
Kloof & Lily Fontein, s.d., J. F. Drege s.n.
(holotype, K not seei

•• '■ ..:. •

TYPE: South Africa. Calvinia, "Sucdosl Ha,

:

■■■ <■ ■■'. i; «>

56: 145. 1975. TYPE: Lesotho. Butha-Butha,

■ t I I; II ■■,.•! i;li -:■ : I. ■

2320 (holotype, BUH!; isotype, FB not seen).

Tenaxia stricta (Schrad.) N. P. Barker & H. P.

i i < >

Schrad., Mant. 2 (Schultes), 383. 1824. Penta-
meru stricta (Schrad.) Nees, Linnaea 7: 310, 313.
1832. Chaelohromus slriclus (Schrad.) Nees, Fl.
Afr. Austral. 111. 341. 1841. Merxi
(Schrad.) Conert, Senckenberg. Biol. 51: 133.
1970. TYPE: South Africa. Cape Town, s.d., C. H.

Tenaxia subulata (A. Bich.) N. P. Barker & H. P.
Linder. comb. nov. Basionym: Danthonia sub-
ulata A. Rich., Tcnl. Fl. Abyss. 2: 420. 1851.
Rytidosperma subulatum (A. Rich.) Cope, Kew
Bull. 39: 835. 1984. TYPE: Ethiopia, "crescit in
montosis provinciae Ouodgerate," s.d., A. Petit s.n.
(holotype, P not seen; isotype, P fragm. at K!).

244. 1854. TYPE: Ethiopia. Debra Eski, 9000', Nov.,
IP. G. Schimper s.n. (holohpe. P nol seen: isolxpes. P
fragm. al ER!, P fragm. al K!).

XV. Schismus P. Beauv., Ess. Agrostogr. 73, PI. w.
fig. iv. 1812. Electra Panz., Ideen Rev. Graser
49. 1813; Denkschr. Konigl. Akad. Wiss.
Miinchen 4(3): 299. 1814, nom. superfl. TYPE:

, ■■ .'. ' ;.■•;■■■'■.■ , ■.:■ :•■.■■■.

) (lectotype, designated by Niles &
Chase [1925: 181]). Figure 17.

:

Plants small, tufted, softly herbaceous, annual or
perennial, without stolons; culms 0.05-0

-. mm, with 3 t
unded, villous, she:

- r II i i<li in i ii

lobes,

on the margins;

! I I I I ' i | l

about 1/5 as long as

Cytology. In = 12, 24, 36, 48, 72 (Gould, 1958;
1962;Faruqi&

: . in

Anatomy. Leaf oil! in

M.l |

Discussion. Schismus is linked to the Rytido-

hilurn and [he s omi. Within this

i I I i I'

■•; ..- ,i , i<>, i I Hi i

Included species. V

I I";-: ! I. : !- .

the Conert and Turp(

1

Schismus arabicus Nees, Fl. Air. Austral. 111.

422. 1841.

Schismus barbatus (L.) Thell., Bull. Herb.

Boissier, ser. 2, 7: 391. 1907.

Schismus biennis (Stapf) C. E. Hubb., Fl. Trop.

■•. -.•:?>■;.

4

Schismus scaberrimus Nees, Fl. Air. Austral.

111. 423. 1841.

schismoides Stapf ex Conert, Scnckenberg. Biol.

46: 180. 1965. Karroochloa schismoides (Stapf ex

Conert) Conert & Tiirpe, Senckenberg. Biol. 50:

299. 1969. TYPE: South Africa. Great Buschman-

land, Wortel, s.d., R. Schlechter s.n. (holotype, K

~s, E!, L not seen, Z!).

1831. TYPE: Tribolium hispidum (Thunb.) Desv.

southern European genus, with a remarkable ti

shores of the Mediterranean, a second specie
disjunct between South Africa and the nort
margins of the Sahara, and the remaining sp<

i. nud., nom. superfl. TYPE: Lasiochloa
longifolia (Schrad.) Kunth (= Dactylis longifolia

. ,:■.! ' ■.. :

nom. anal . , rclunatum (Thunb.)

B lf D

WffL

Figure 18. Tribolium echinatum. —A. Sp — B. G ;. — C a back. — D. Palea. Drawn

us. expanded or s

1969, syn. nov. TYPE: Karroochloa aura (j\ees) Conerl

■ ■: ,■■.■■.)

Plants small, tufted, herbaceous, annual or peren-
ial, culms 0.03-0.6 m tall, glabrous or MiriousU

.TYPE: SP 7 Le "

and open

lorter to longer than the florets, 2-7.5 mm, with 3

in "

dlus rounded, villous, shorter or longer than t
chilla internode; lemmas with 7 or 9 veins; lcmr

apically acute, tride
rounded or acuLe 01
apical setae; lemma c

lobed; lemma lobes
ate, rarely wilh short
ns poorly developed as

structur

paleae obovate to lorate, apically
, emarginate or bilobed; keels scabrid, often

.' ..'■■■ ■ I- ; I I:

the caryopsis length.

Nomenclatural note. Karroochloa has to be in-

eny (Verboom el al., 2006). The fourth

Cytology. 2r,
:: -i<r. /:■ -11 '
1994c, d, e; Baeza, 1996b).

i ■■■■<■

his genus of small-

of the western and

• I i • m

acute lemmas. Finally, the

Ml 'i Ill

XVIa. Tribolium Desv. sect. Tribolium.

Ili i

often with large cushi

Included species. ( )nh fn e species are included in

• i ''';'■■ !,!.. i). :

798. 1985.

hispidum (Thunb.) Desv., Opm
64. 1831.

. y : ' ' ■ ; ■ n: . .

Visser & Spies ex H. P. Linder & Davidse, Bot.
Jahrb. 119: 477. 1997. TYPE: Tribolium acuti-
florum (Nccs) Renvoize (= Brizopyrum acuti-
florum Nees).

Discussion. Tribolium is clearly a member of the

ili'

I i In i •
ui in '" i I is ' . ■

hi ;ti mill ii m ;

were previously described ii

idse(1997).

rboom & H. P.
Linder. comb. nov. Basionym: Danthonia curva
Nees, Fl. Air. Austral. Ill 328. 1841. Karro-

berg. Biol. 50: 295. 1969. TYPE: [South Africa.]
artkopsrivier, Thai und angren-

^ ' ^ ];!:.' : ,: \

50-500 ft. (loc 2)," Nov., C. F Ecklon 4529b
inert & Tiirpe [1969:

.■ >.:.;T!i..

Included species. Onh two species are included
m this section, and these were also <(.
hinder and Dav

(logically by Visser and Spies

XVII. Rytidosperma Steud., Syn. PL Glu
425. 1854. T^i
Figure 19.

Tribolium pleuropogon (Stapf) Verboom & H.

.'■'... .
pleuropogon Stapf, Bull. Misc. Inform. Kew
1916: 234. 1916. TYPE: South Africa. Damp
places near Riversdale, s.d., R. Schlechter 1759

■ ■■ ■ . ii ... ."" .

L, Suppl. PL 112. 1781. Danthonm purpurea
(Thunb.) P. Beauv., Ess. Agrostogr. 160. 1812.
Karroochloa purpurea (L. f.) Conerl & Tiirpe,
Senckenberg. Biol. 50: 303. 1969. TYPE: South
Africa, s.d., C. P. Thunberg (holotype, UPS
2620!; isotype, S!).
Conert and Tiirpe (1969) indicate that the origin of

noted by Willdenow (1797: 450), the place of

«;':■ ill. ■'■ ■•■ ■■=■ ■'

Uum (Nees) Verboom & H. P.
hinder, comb. no\ .
Nees, Fl. Mr. Vustral. III. 324. 1841. Karro-

berg. Biol. 50: 308. 1969. TYPE: South Africa,

I ' : ..' I!' ' M^il-

tein in elice ah aquis relic La inter praerupla
montium," 2000 ft., Aug., /. F. Drege s.n.
(holotype, B not seen; isotypes, HBG!, S!).
XVIc. Tribolium Desv. sect. Uniolae N. C. Visser &
Spies ex H. P. Linder & Davidse, Bot. Jahrb.
119: 471. 1997. TYPE: Tribolium uniolae (L. f.)

:

Yd cenirolepidoides Men.

.:■;:<.::■::<:>,, ...

TYPK: \olnd(tnthonia unarede (Raoul) Zotov

TYPE: Enih

{= Triodia australis Pelrie).

nder. Telopea 6: 612. 1996. TYPJi

i ± P. Linder (= Dan

rarely present. Ligule ci
lous oi sclerophyllous, p

1 t „ f n th h tl

1 , 1 1 . II II I II

than to longer than the lemma

ij ii nil Mil'

■ I. .

: 'I .S-., ■...!] ■. lie ,:..!

R g 1964; Connor & Dawson, 1993; Baeza,

1996b; Murray et al., 2005).
Anatomy. Lea\ es v

I i I

strands, girders, r-shaped girders;

■

!■>;.-. , ■ »<v ..■:■

over a wide habitat range: from v\

■ ;■■■ i, id i ; is-

i woodland or forest; fi

Discussion. Typically, the specie-
re are a few species that form spiny vegetable

" I ' i" I

i,:;i l;;|. 'I.:'. , liv
:u : Hi" "I'

ii 1 i

■Mi!M»ll;'1l -

molecular signal is strong.

Included species. Here we include 73 species in

and Verboom (1996). It is sim

• linn -mX.- I

M 'I i 111 i

Ill II I
Connor, 2000]). America under

rSvifcloapcnria ddknZln (,''■..■
Edgar, New Zealand J. Bot. 17: 332. 1979.

Rytidosperma i

Zealand J. Bot. 17: 331. 1979.

Rytidosperma alpicola (Vickery) Connor &
Zealand J. Bot. 17: 331. 1979.

Rytidosperma auriculatum (J. M. Black) Connor
& Edgar, New Zealand J. Bot. 17: 322. 1979.

Rytidosperma australe (Petrie) Clayton &
Renvoize ex Connor & Edgar, New Zealand J.

Z, i,'": i I ■!. il ■■! ■■:. " |i ■ : I i' II - VI,

Humphreys & H. P. Einder, comb. nov.

: Link, Hort. Berol.
( I , it!, | ! : II l„',
(Link) H. P. Linder, Telopea 7: 270. 1997.

■.num. PL (Kunth) 1:
'■■ , '.""/:;, ::,:■,:;
(Kunth) Connor & Edgar, New Z
17: 332. 1979, nom. illeg. \otodanthonia
linkii (Kunth) Veldkamp, Taxon 29: 296.
1980, nom. illeg. TYPE Australia NSW,
9 mi. [14.4 km] WNW of Newcastle NSW,
27 Apr. 1960. R. Story 7220 (neotype,

' , ■■.'., .ii; in.', ii.-i

id despite repeated searches 1

16. Rytidospe. (I). I. Morris) A.

M. Humphreys & H. P. Linder, comb. nov.

■ ;■■ I ' I. '!l,.iri;

Muellera 7: 153. 1990. Notodanthoiua diernenica
(D. I. Morris) H. P. Linder, Telopea 6: 616. 1996.

Linder, Telopea 7: 271. 1997. TYPE: Australia.

Tasmania: Ouse River, Wild Dog Plains, s.d., A.

2 (holotype, HO 65782!).

(Vickery) A. M. Hum-
phreys & H. P. Linder. comb. nov. Basionym:

New South Wales Natl. Herb. 1: 299. 1950.

& Edgar, New Zealand J. Bot. 17: 332. 1979.

. ,;■!.">! : ';,HI . Ml

fulva (Vickery) Veldkamp, Taxon 29: 296. 1980.
Notodanthonia fulva (Vickery) H. P. Linder,
Telopea 6: 616. 1996. Austmd
(Vickery) H. P. Linder, Telopea 7: 271. 1997.
TYPE: Australia. New South Wales: Flemington,
31 Mar. 1929, G. B. Vickery (holotype, NSW
] , ' i, i

(J. M. Black)

H. P. Linder, Telopea 6

(Ohwi ex Veldkamp)

Rytidosperma lechleri Steud., Syn. PL Glu-

M. Humphreys & H. P. Linder, comb, nov

\ .. V\ ,1 ;■■ I.

Muellera 7: 384. 1991. Joycea lepidopoda (N. G
Walsh) H. P. Linder, Telopea 6: 612. 1996.
TYPE: Australia. Victoria: Bullens Land, Court-
neys Rd., N of Ash Reserve, 15 Jan. 1987, N. G
Walsh 1709 (holotype, MEL!; isotypes, BRI!

!)

46. Rytidospn lii.l A. M. Hum-

phreys & H. P. Linder. comb. nov. Basionym:
Danthonia pallida R Bi . Prodr. Fl. Nov.
Holland. 177. 1810. Avena brownii Spreng., Syst.
Veg., ed. 16 (Sprengel) 1: 336. 1825. Noto-
, eldkamp, Taxon 29:
297. 1980. Danthonia penicillaUi (Lubill.) P.
Beauv. var. pallida (R. Br.) Rodway, Tasman. Fl.
267. 1903. Cfiumochloa pallida (R. Br.) S. W. L.
Jacobs, Taxon 31: 742. 1982. Joyt
Br.) H. P. Linder, Telopea 6: 611. 1996. TYPE:
Australia. New South Wales: Port Jackson, s.d.,
R. Brown 6232 (holotype, BM not seen; isotype,
EC noL seen, K fragm. at PERTH!).

>pea 6: 614. 1996.

51b. Rytidosperma pictum (No
Nicora var. bimuc
18(1, 2): 91. 1973.

.um (R. Br.

LI. u .■

Humphreys & H. P. Linder, com
da popinensis D. I.
leria 7: 157. 1989.

I. Morris) H. P. Linder, Telopea 6: 616. 1996.

(I). I. Morris) H. P.

Linder, Telopea 7: 273. 1997. TYPE: Australia.

Tasmania: 0.5 km N of Kempton, 16 Jan. 1987,

Rytidosperma pu'J

Edgar, New Zealand J. Bot. 17: 321

1979.

69. Rytidospen ilg.) Connor &
Edgar, New Zealand J. Bot. 17: 332. 1979.

Rytidosperma pumilum (Kirk)
Edgar, New Zealand J. Bot. 25: 166

1987.

70. Rytidosperma vickeryae M. Gray & H. P.
Linder, Austral. Syst. Bot. 12(5): 744. 1999.

S6

a quirihuense C.
Novon 12: 31. 2002.

M. Baeza,

Darwiniana 18: 91. 1973.

Rytidosperma racemosum (R. Br

Edgar, New Zealand J. Bot. 17: 327

1979.

72. Rytidosperma virescens (E. Desv.) N'icora,
Darwiniana 18: 93. 1973.

72a. Rytidosperma

,i>Tb„ '!!;vi:Vr!l(iKV| 1 F!:iniiiJii ]'/«€arirrc)!V.Liji:r f u, ^ \ '. , .

Mi . !' I ■ r
New Zealand J. Bot. 17: 332. 1979.

58. Rytidosperma remotum (D. I. Morris) A. M.
Humphreys & H. P. Linder, comb. nov.
Basionym: Danthonia remota D. I. Morris,
Muellera 7: 160. 1989. Notodanthonia remota
(D. I. Morris) II. P. Linder, Telopea 6: 617.
1996. Austrodanthonia remota (D. I. Morris) H.
P. Linder, Telopea 7: 273. 1997. TYPE:

■:■'.:;■!!■ ! ;!■■■(

3 Feb. 1980, A. M. Buchanan 2878 (holotype,
HO 91392!).

'-U li'-imi! M ;l T III TT TM i I

95. 1973.

Trans. Fun. Soe. South Australia 82: 163-173.
Chile. Gayana, Bot. 47: 83-84.

I-^',:i

11-93.

. 1 WOl,. l,i

53: :',2<)-333.

,!,,,, an.l ullraslructure of the
canopsis ol Pen/amrris and l\vudopcnlamvns sp^.-i^s
(Arundinoideae, Poaceae). Bolhalia 16: 65-69.

undineae, Poaceae). Bolhalia 23: 25-47.
. 1994. External fruit morphology of soul I

Arundineae (Arundinoideae: Poaceae). Bothalia 24: 55-66.
. 1995. A s>,

tameris (Arundinoideae: Poaceae). Bothalia 25: 141-148.
. 1999. Met:

■'■•: k y :. ,

(Arundineae, Poaceael from South Africa. Bolhalia 21:
27-31.

I i<

, 20: 423-435.

, ( . M. Mellon & H. P. Linder.

Danlhonieae: Generic composition and relationships.
Pp. 221-230 in S. W. L. Jacobs & J. Everett (editors),

Linder. 2007. The phylogeny of the austral grass si

• i 1 1 1 1 I

264: 135-156.
ienlliam. G. cK J. I). Hooker. 1 883. Genera Planlarun

, ! I

aneous species. New Zealand J. Bot. 21: 13-20.
ke, S. T. 1972. Plinthanthesis and Danlhonia and a
eview of the Australian species of Leptochloa (Grami-
hieensland Herb. 14: 1-19.

-: 1. Danlhonia DC.

(Poaceae: Amndinoideae: Danlhonieae). Abh. Seneken-

berg. Naturf. Ges. 532: 1-81.

nnor, H. E. 1967. Interspecific hybrids in Chionochloa

v :\ ;,

. 1970. Gynodioecism in Danlhonia archboldii.

Austral. J. Bot. 18: 23

(Gramineae ) II Taxon 32: 633-634.

.. I- . :

29: 219-282.

II' ' n II ' i

Stapf (Gramineae). Taxon 23: 595-605".
& . cudel (Notodantho-

Brooker, M. I. H. 2000. 1

-
Lamprothyrsus (Arundineae. Gramineae). Ann. Missouri
50: 512-517.

.'■: i-.. .

axon 29: 41^16.
& T. A. Pa i de to the DELTA

79-148.

definitions. 3id ed. (MRU Australian Division of

I,. 1 i, h II i

Entomology Report 13: 1-106.

molecular phylogeny for the large African on

Darbyshire, S. J. 2003. Danlhonia

Disa. Molec. Phylogen. Evol. 43: 75-90.

Poaceae, part 2. Oxford University Press, New York.

1-9.

:

',i l< 1

Monet de Lamarck & A. P. de Candolle, Flore Francaise,

.■■:;.',

behavior, and notes on some glasses horn Central America

and the West Indies. Canad. J. Bot. 50: 1441-1452.

in South Africa. Pp. 1-527 in C. Meredith (editor), The

T. ■

Grasses and Pastures of South Africa. Central News

of polyploidy in the grass flora of Zimbabwe. S. African J.

Grasses of the World. Her Majesty's Stationery Office,

i | ,

( onerl. H. 1 !

Zealand J. Bot. 27: 163-165.

Gramineen. Senckenberg. Biol. 51: 129-133.

;,. i.

polyploids. Cytologia 18: 229-234.

..■'..;».■..

. 1954. Tlv

Amer. J. Bot. 41: 204-211.

Neuguinea. Senckenberg Bio] 56 L53 L64

(Gramineae: Amndinoideae). Senckenberg. Biol. 56:

Bot. 47: 44^19.

145-152.

; -:■ :.,.■.

t. 10: 117-120.

Vrmidinoideae. Pp. 23 ( )-250 in T. B. Soderslrom, K. W.

.

Hilu, C. S. Campbell & M. L. Barkworth (editors), Grass

Is. 8. Bothalia 18: 119-122.

Washington, D.C.

& A. M. Turpe. 1969. Karroochloa, eine neue

:

. 1979. A procedure for standardizing <

leaf anatomy in the Poaeeae. il. The epidermis as seen in
surface view. Bolhalia 12: 641-671.

.:■ is ! .

Pentaschistis. Mem. Bot. Surv. South Africa 60: 1-314.
Faruqi. S. A. & I

Schismus arabkus and S. barbatus in Libya. Pakistan J.
Bot. 11: 167-172.

Compositae. Taxon 34: 72-80.

Rytidosperma Steud. s.l. (Po£
55: 911-928.

\\. L. 1982. C

31: 737-743.

, ■'■■■!. ■

Klak,C.& H.P.Lin. I

& . 2007.

(Danthonioideae, Poacea

, B. Byte!

ier, D. U. Bellsted

1. P. Linder. 2007.

The Cape elerr

535-543.

'., D. Albach &

. Hebe, and sect.

Labiatoides. Ts

E., L. Watson, M.

Koekemoer, L. Smook,

N. P. Barker,

M.

.. 1

'. d.|

Missouri Bot. Gard. 65: 369^36.

i , *, . i : :

G. Beeves. J. C. Manning. T. G. Barraclough & M. W.

Chase. 2002. Radiation in the Cape flora and the

four plastid DNA regions. Molec. Plnlogen. E\ol. 25:
341-360.

Schneider, J. Shoshani, G Gunnell & C. P. Groves. 1998.
Toward a phylogenetic classification of primates based on
DNA evidence complemented by fossil evidence. Molec.
'): 585-508.

Missouri Bot. Gard. 88: 373^57.

Lir ! li. •■:

Zealand J. Bot. 4: 255 266.

i ' II II 'II III! I.' ■, -

revision. Symb. Bot. Upsal. 15: 1-411.

Phytogeogr. Suec. 49: 1-144.

i -. Iniversily of
Illinois Press, Urbana.

010. A chloroplast tree
it on Proposal 520:

classilication ol the Eucahpls. Austral. Syst. Bot. 13:
149-152.

ecology. Pp. 135-174 in It. M. Cowling (editor), The

iginan, London.
Linder. H. P. II iship between the

regions of Africa. Mitt. Bot. Mus. Hamburg 23b: 777-790.

spcima complex (Danthonieae, Poaeeae). Telopea 7:
269-274.

grass from Kosciuszko (New South Wales, \usluha):
.2005. Dan,

& R. P. Ellis. 1990a. A revision o!

(Arundineae: Poaeeae). Contr. Bolus Herb. 12: 1-124.

;

Bothalia 20: 91-103.
& G. A. Tic limits in the

. :-:■.!:■ , 1 ..■!..;:„■:; ,;■.

& G. Davidse. 1997.

Desv. (Danthonieae: Poac

lalics of Tribolium
Jahrb. Syst. 119:

, J. F. Thompson, R. I

■::■'•■■■ ■'}:<■<■>■■ ; ■■.'.

ii , 1 1 1 -. i ii ■: - , ..;..■■

and northwest European plant species. Opera Bot. 5:

ill. 9: 417-425.

based on molecular evidence, including new combinations
Austral. Syst. Bot. 16: 1-18.

63-71.

Hawksworth, K. Marhold, D. H. JNicolson, J. Prado, P. C.
Silva, .1. K. Skog, J. H. \\ iersema & N. J. Turland (editors).
2006. International Code oi Botanical Nomenclature
liegnum Veg. 146.

■ ■..,.,„.,..,,[.,■:■
I
I - ' , I I

Philipp. J. Sci., C 5: 287-404.
Moore. R. J.. \\

II

< l! , ' Ml| II

Powrie, L. Scott, K. G. T. Camp, S. S. Cilliers, H.
Bezuidenhout, T. H. Moslerl, S. J. Sieberl, P. J. D. Winter,
J. E. Burrows, L. Dobson, R. A. Ward, M. Stalmans, E. G.
H. Oliver, F. Sieberl. E. Schmidt, K. Kobisi & L. Kose.
2006. Grassland biome. Pp. 239-436 in L. Mucina & M.
C. Rutherford (editors). The Vegetation of South Africa,
Lesotho arid Swaziland. South African National Biodiver-

n \\. H.Hjah
ican Plants, ed. 2.
a. Cape Town.
<;.. P. J. De Lange & A. R. Per-

Bol. Rev. (Lancaster)

mulua commulalionc oll'erl Hortus Holanicus \ raiisla-
:5. Breslau.

. Ili'ill '

Mies, C. I). & A. Chase. 1925. A bibliographic study of
Herb. 24: 135-214.

Oliver. E. G. Ill

review. Conlr. Bolus Herb. 13: 158-208.

Bot. 42: 473-494.

agrostographie. De Fain, Paris.

in danthonioid grasses. Bot. Gaz. 145: 78-82.

Hedberg & S. V. Edwards (editors), Flora of Ethiopia and
Eritrea. The National Herbarium, Addis Ababa University,
Addis Ababa.

rl). Syst. 85: 58-67.

i I ihi I

M. Negritto, L. Ruiz. J. 11. S. Cola. E. Reimer & H. P. Under.

II II ,,-

1119.

, , IN. P. Barker & II. P. Lin

Biol. 58: 612-628.
, K. Lloyd, W. Lee & II. P. Lin

Diversification of Chionochloa (Poaceae) and biogeogra-

oller, D., T. Eriksson,
Smedmark, D. R. Morg;
Arscnaull. T. A. Die'ki

R. C. Eva

ns, S. Oh, J. E. E.
. K. R. Robertson. M.
S. Campbell. 2007.

266: 5^13.

','

cK \1. C. Rutherford (editors). The \egctation ol South
Africa, Lesotho and Swaziland. South African National

nl'.ers in western

.' II;.

Ronquist, F. & J

Bayesian phylogenetic inference undei mixed models.
Bioinformatics 1<>: 1572-1571.

oekologisclier Divergenz. Oesterr. Bot. Z. Ill: 193-207.

i,i, S. II ; ! ( '^ ;;., II , , i .

,1 . , I

" II :,■■■, O, ;,',,; . ■. ■

!!:■■■ • : ;!<■.■:!■ i .. . . ■

■>.: 275-287. = 2.

Madagascar. Mot. Mag. (Tokxo) 78: 306-311.' 1; pre,<-ni

II ii I i I I ■ , , I

Werger (editor), Miogeograpln and Kcologv (.1

Africa. Dr. W. Junk, The Hague. = 1.

Tsvelev, N.N. 1984,

Hollerdam. lapping = 1.

, ■;.-.■ ;; .;■[-,■■■
■w Guinea. J. glumes = 1; above glumes = 2.

. 1980. Cm

= 1.

, 29: 293-298.

!<;■;..!

30: 477-478.

MM

= 3.

rt. 18:57-77.

c apical part 0; not

1601-1610.

. Ii. ' i .- :

ph\logen\ oi Africa Rylidosperma-affiliated danthonioid

(). inro Hed = 1.

tion in spikelet morphology. Taxon 55: 337-348.

:

genus Tribolium (Poaceae: Danlhonieae). 1. A laxonomic

: , I," II

blades sclerophyllous = 0; orlhop

—

Tribolium (Poaceae: Danthonieae). II. A report on embryo

■■■: ' ■ ,! i., :i,i.

of apomixis in diploid specimens. S. African J. Mot. 60:

22-26.

■

a. Merxmuellera basal grade

//era Conerl

_J X— — ' i idles in the genus

11. Geochloa H. P. Under & N. P. Mark*

III. Capeochloa H. P. Linder & N. P. Ma

related genera, and conclusions. S. African J. Bot. 60:

b. Pentameris clade

IV. Pentameris P. Meauv.

Tribolium (Poaceae: Danthonieae). IV. Sec Hon L niolac. S.

V. Chionochloa Zotov

Nauk, Merlin.

oto\. \. 1). 1963. Sxnopsi-, of the grass subfamily

e.Danthonia clade

Arundinoideae in New Zealand. New Zealand J. Mot. 1:

78-136.

VIII. Cortaderia Stapf

IX. Austroderia N. P. Marker & H. P. Lir
X. Plinthanthesis Steud.
Moe Domin

.PPEND.X 1. Morpholo gl cal characters and character states for

vchloa H. P. Linder

XIII. Danlhonia DC.

. Plants reproductive organization: flowers bisexual, her-

f. Rxndosperma clade

;. , 1 . 1 ■.:!-■ .

Jisent = 1.

tus P. Meauv.

XVII. Rytidosperma Steud.

REVISION TAXONOMICA DE LAS Nataly O'Leary- Maria Ema Mulgura 2

ESPECIES DEL GENERO 0svaldo Morrone2

VERBENA (VERBENACEAE).
II: SERIE VERBENA 1

. II. I .III I ,'l I

(Cham.) Herter var. sw liana (L. M. Perry) N. O'Leary; nine

:■:■■.■:■■/.: ■:'

lasiostavlus Link. I . nn I !. xulha Lehm.

I . <■■;■!■:.■■:■■■. ) . ,-■,■'.■■■■ ..■.■■..
'■■■■•• rr <■ ;i !■ ; . . ...

auer (O'Leary et al.,
del mundo. 2007) y la i tratada. La serie

:

dos a ocho scuvi

pubescencia, (

;aracteres anatomic es y frutos densa-

■;■- i -I- V. ■ ' ' :

Willemse (L), entre otros. Tambien s(

i. Ik'var a cal.o csla
im< stii.d< ion. \ los sub ( t\ (N 6825-00 y N" 7792-05).
Mnstilulo de liol.ii

doi: 10.3417/2007070

Ann. Missouri Bot. Gard. 97: 365-424. Published on 10 October 2010.

l paniculas
En el presente trabajo se aborda el estudio de las

genero Verbena,

Pachystachyae (O'Leary <

, '■» [. ■;,!,. I" ;■■■:■..

arios ARIZ, BA, BAF, C, CAS,

-II ! ,

i ><,;■■ !,!!• ;,:;

1 y2.

Para la descripcion morfologica se siguio la
i;i propuesta por Lindley (1951), Hickey

tie Argiieso ovulo

Tratamiento Taxonomico

Verbena L., Sp. PL 1: 18. 1753. TIPO: Verbena
Brown [1913: 94]).

'Ins. Hist. Nal. 1:

:,>.,■;.
Rozier.

, i ,

TIPO: Billardiera explanata Moench.

I,-/-.-,-.-,',- :'■ ■

! i I i , '
chamaedryfolia Juss.]

7: 278. 1840. TIPO: Uwarowia chnsa
Bunge.

■ i oil. i ■>::.;;.
TIPO: Venerea quadranguk

Hierbas anuales o perennes, o sufrutices, muchas

jI - 'ImI

i?" <■ : - ; '

florescencias cilindricas densas o

' i -i I •!'■ 'i ; ii I

r loeulo inserto en el borde del carpelo; estilo

'.■{•I ill In i I

da, de igual longitud o algo me

Las especies de la serie Verbena

a de cordones de

ii

:

, II I I ,|,

a y Polinesia (Munir, 2002),

segunda. mile" plan [a

rexes que el caliz,

•i -' -:i . ■ i ■
enteras o divididas.

j i III

division de la lamina Inliar \ Lipn de i i

: '

! ,

.>, mi ■■■'. .;,!- ■•■■;■:■■■ ::. ;■■; h; '. ■

disposicion en inflorescencias. Grupo Has

las florescencias, el li

norfologia de la id

ser. Verbena tratadas

de todas las especii
en este trabajo, inc

respectivos grupos

informales, se re

caroliniaaa Miclix., V. cloverae Moldenke, V.

■ .

reunidas en para

■■:■!.:■ ill ;■. i.;. ; I

rienece a la serie
.. '
glandulares en las piezas floralei

■.:.■■:■■..; ■:.!: : /v,v;;.. \ i
' ■' - •,-,■,■ ,i

(Oiolino sin pelos alandulaies en las picas

mismas luerl.as o sufnltmes postrados o a veces ^ "pa^ndo'en bngi'ud

. ■ :i M ;h;i:t..

Poseen floresi ■•

■ . A . ,. . ,

no; hojas

> 1 111-11 T/ / / • 3 '" Plal,i

Moldenke se inclu

liano de disposicion contmua. f lila • 25 - K "rtiqM

Ml , ,< ,1 M , ' ■■ ■

. '■■■.. :" " '

f , , , , n °( /| )- ^"i :;

'"

bracteas mucho i ders hispidas, hojas generalmente s<

...

1 • • . n ■ i „ , , ,., $ • bupc

II., I' III. > >i

longitud al caliz:

Carolina L. que aqu i. / s ; ', 1 ' \ , iC °

J & F i liable, la lamina

•i a o IriparLida en
ser. Verbena l as i 1( ,j as |,

• flf
frutos remotos; sinflorescencia pankulosa o no, nunca profundament.

sobrepasandoenl, o; sin pelos

profundamente inciso serrado o dentado

nunca fili-

! ■ i "

Holies damente inciso-dentado, las apicales de lamina

sublineai a lineai; planlas -dabias o alt;o

puberulas hacia el apice con pelos adpresos

piezas florales. breves; lubo corolino de 0.4-0.65 cm

.. ■ : ■

10(9). Plantas con hojas enten
10'. Planlas ,•„,

II i I'M II II II

rili.rcsccncias dc 10-20
8-1 cm. bruclcas [loralos siempiv nolor-

■ I > i i : M i' i : s- ■

Hordes

piezas florales (excepto en V. xutha)

i i ill i

Frutc

, hipotagma desarrollado

pubescencia adpre
alas de pubescencii

■ju-leata Lag. & Rodr., Anales
Nat. 4 (12): 260. 1801. TIPO: [s. loc] "Verb*

■, . . :■,.(!.. ' c,
f.i':;-kMip«i, ,.\<.\ hi dr ; :.V»;ikS(lo.. VI V 34.163V i.:o \'u
7 foto SI!).

V

1803. Zapania bracteosa (Michx.) Poir. en Lam.,
Encycl. 8: 843. 1808. TIPO: E.E. II. U. Tennessee:
Nashwlle. St. \ incenl. s.d.. s. coll. n" 5 (holotipo, P
00307084 no vislo, P 00307084 foto SI!; isolipo, SI!).

■-.. ■/.■■:.■/,■■ i ■-.'■:,;■.■ i

Eggerl. Torrexa 2: 1

; ■ ■ 1 .ill. ..-'Li I,;.

iv,- iiiivv :. ,

i

..' .1". i ■!:■; .1 II

00135428 no visto, GH 00135428 foto SI!).

TIPO: Mexico. Durango: from the Sierra Madre W of
Durango, 8100 fl.. Sep.-OcL. 1881, A. Forrer ,.,,.

ihoioiipo. (;n id \isi

. US iolo SI!).

U.l. f\ew Mexico: Dona Ana Co., San Juan Mtns., 30

;»<»s. G no vislo. MO no
vislo, N Y no vislo, N Y iolo Si!, US no visto, US foto SI!).

■ .' :■.■ !■''.*■: . II ■ ■ .. I.
Colorado: Archuleta Co., Arboles, 18 June 1899, C. F.
Baker 564 (holotipo, NDG 43339 no vislo, .NDG 43339
Iolo SI!: isolipos. i no vislo. ( T no v isto. MO no visto.
NDG 43340 no visto, NDG 43340 foto SI!, N Y no visto,
NY foto SI!, P no vislo, P Iolo SI!. SI!. US no vislo. US
foto SI!).
>ena imbricala \\ colon & Standi., Conlr. I .S. Nail. Herb.
16: 166. 1913. \rrln

. ..'• I-..-- :'!l-.:i :

Hierba o sufrutice hasta 60 cm de altura, raiz

:■■!.•! ;> '..I

a pice agudo, base cuneado-

i tierra alrededoi

cm, alargandose en la

fructtficcK ion, pedur
pi a b la la

0.7(-1.2)
maduracion, apice agudo, pubescencia

. ,li I ' !:

j corolino. Clusas

■■■■■■ .-■

,3}. El habito

estilo es |>re\e \ el tubo corolino poco c

i < I 1 1 1 1 'i ii

13, figs. 18, 19).

i Glandularia (Pen

een las bracteas

li .ir.llr; .'.:;,;

'-"■ 1 ' II ■

I I ' 1 1 I I

son acrescentes hacia la base pero nunca de aspecto

>. Mi-

diferencia de I

.:!■■■■ ,-.: ■."hi I
'■,vv?"/('^/.'? ■■■<■■

informal

acteata se baso en una planta

. l-l rlli ..Ml :,..';'

albiflora, tratada Moldenke (1946:

biografia de los

ii ■•' 1 i in i i I

n|MM' II, l; |MI" i ■■ ■
■

como BM, COLO, K, NY, RM, US. Sin em:

; y no se ha

I 'I

Cockerell.
(1847), Perry (1933) y Moldenke (1962:

• ;. - ii'Oi-i

< niiH! :-i -u'mi ■ :; (■;: !■• /mm •draia, HI v]v

(.■.:■; ■■■<■ hi.illl

Ml. 11 !

A pesar de que la mayorfa de los tipos de Greene

. . : ' \,\\ !!■:.■;

isotipos en NY y US.

Material adicional examinado. E.E. U.U. Arizona:

II. '„,, ' i I ',1 ,| Co... II I, II I , ^V-,..,.-.,, >

(SI 3341). Nevada reek, Clokey 8096

Soil,, ig 2907 (SI) n i I , i o. N\\ oJ Munlc

' ^ ' ,-■:■( -:l.

I I. .ill III

■' I L 'M.I
II , MI,M

C.l . California: 'I,

Sep. 1938, R. F. Hoover 3870 (holotipo, UC no

visto, UC foto SI!; isotipos, NY no visto, NY foto

SI!, US no visto).

Hierba hasta de 75 cm de altura, habito erecto, con

os ca. 1 mm y

ill i, i

reunidas en paracladios

i .I"'

!.■'.■.:■,■-' .Ml Ml : .: .ill il( llfM II
Mil |; 111 I I

II

el fruto; ambas piezas cc
con abundantes pelos

olino ca. 0.7 cm, angosto

fori t bo (

Iconografia. Wilken (1993: 1093).

Ob.servacioiies. \ t
menazada (<http://www.fws.gov/er

x'iiwb '

facilmente del icslo ue ias es

M ; , !■.(...■ IlIMM „ ,,

las florescencias largas con

este ultimo aspecto se asemejaria a Verben

y de margen finamente serrado

I i i

1L11 ' ■ Iim.-

nip. Hoover 3613 (PO ); Tuolumne Co., Chinese Camp,
Uenke 25758 (MO).

3. Verbena canescens Kunth, Nov. Gen. Sp.

(quarto ed.) 2: 274, t. 136. 1817 [1818]. TIPO:

'■■:-.'i >■■'. ■ )■■

grado, alt. 1000-1250 hex", fl. Sep., A. Bonpland
s.n. (holotipo, P 00108609 no visto, P 00108609

Iconografia. Kunth (1818: t. 136); Diggs (1999:

: :

Distribution } ecologia. Se distribuye desde el

E.E. LJ.U. Texas: Comal Co.. 1 mi. \\ New liruunfels.
21 Apr. 1946, B. II
designado, NY!).

no wslo: isolipos. N\

I

Tejeda 3940 (holotipo, US no visto, US fol

iramosa desde la base, p

ciolo ensanchado,

L'lrl.i: ,1..' ■ -■.■■■.

II'-. Il

las venas prominentes, en la cara adaxial pi

base bulbosa,
algunos pelos glan<
sa, formada por parac

' I ■:■ !:■; i..

eas florales ovado-angostas, de 0.3-
ii tic a lo largo de la
3 agudo, pubescencia

s. margen ciliado;

le menor o igual longitud, de 0.2-0.35 cm, con 5

-ia velutino-villosa,

[gunos pelos glandulares; corola do color a/nl.

i" 1 I nillli i iii.,. ...I

) en la garganta; estambres insertos hacia la
nedia del tubo corolino. Clusas de 2-2.5 mm con

de Texas, hasta Colombia (R;

Obserruciones. Verbena canescens se caracteriza

, .i I i..

■ '

8971, US).

Este taxon se diferencia de Verbena gracilis porque

i ■ i I

pubescencia estrigos

Verbena neomexicana es la especie mas faeilmente
confundida con

. , . ',';' :"',: ),.; ' \

..'!■.:■( I, i:'... II.!.

redondeada, pec

V. plicata, pero
o, cara abaxial

sn la madurez. Pern
sstaria estrechamente
y V. plicata, pero qi

-i hi;.,; .. i .,
'.■'.v.'.':..., ,■■,..,....■

■ ■

esta variedad. A partir del

teas de casi 0.7

(Hill & Taller 3993, NY). Perry (193.=

in 'i o hi ;'.; Hi ill in a 1 1

Por lo tanto la variedad roemeriana se In

Este taxon se incluye en el grupo informal

zar el ejemplar tipo de Verbena roe

protologo: "Auf steinger Prairie ]

u lto a TEX porque V.
menc lonado^ heibaiios >,e pudo localizar el material

citada en el proto i plenamente con

de ellos como neotipo.

Troncoso (1962: 529) examine el material tipo de
eei (Moldenke, 1947: 241) dep<

i .in

'■!'■■ 'I; >'<':' : <<

y que se trat;i /

corresponde a V.

Ik. i. ... Mji. 1908, Apollinaire

Galeana, Hac. San Jose

Sodas. Conzalli 4194 (US). Puebla: Tc f
Arsene 48 (BAF); Esperanza, Balls 526t

eerro tie los An,

(MO).

. Verbena car. ed. 10, 2: 852.

1759. TIPO: Ilustracion en Dillenius, Hort.
Eltham.: 407, t. 301, fig. 388, 1732 (lectotipo,
aqui designado, Dillenius [1732: t. 301, fig.
388]).

275. 1818, sphalm. "veronicaefolia" . TIPO: Mexico.

'^ ' • •■.:.■<; •■/V.).

:■■■■. ,«:. . hi ■:■>:
!,,■ ■„ I I ,

volcan Xorullo. s.d.. .

i. Distrito Federal: s.d., F. W.
Iiolotipo. P no vislo, P

■ .■/■,■■.■..■ ,■..■;■■.

Sci. Bruxelles 11(2): 324. 1844. TIPO: Mexico.

Ursula (M. Martens & Galeotti) Moldenke, Phytologia

V
Mexico. Veracruz: Xalapa, June-Ocl. 1840, H. Galeolli
qui designado. PR no vislo. P>K lolo
SI!).

Verbena mollis M. Martens

Bruxelles 11(2): 323.

mollis RaL Atlantic

Oaxaca: San Felipe.

, Apr. 1840, H.

(holotipo. BR no visto

, BR folo SI!).

Sci. Bruxelles 11(2)

: 323. 1844, syn

Galeotti 791 (holotipo BR no visto,

isotipos, P no visto, F

Verbena gentry! Moldenke,

TIPO: Me i

Platano, 13 Mar. 1941

■ : . ; .

NY no visto, NY fol

is, MICH no visto,

MICH foto SI!, MO!,

' I,,,' l'i

Verbena curUsii Moldenke,

Phytologia 2: 147

E.E. U.U. Carolina, s.

: . |..:).

TIPO: Ecuador, Oal

Island, Sta. Cruz, 15 Feb. 1953, R. /. Bowman 81

l ■-.'■■• I. '. ' '

near Cerro Zempoallepell, 2900 m, 7 Aug. 1950, B.

; Moldenke, Phytologia 13:

36: 51. 1977, syn. nov. TIPO: Ecuador. rSapo: Term.
>alacios 4188 (holotipo, TEX no vislo.

. Tlli' ■■,.(:■ :;

Tamaulipas: Gomez K

Richardson 1234 (holotipo, TEX no vislo, TEX i'olo SI!;

Hierba erecta, de 0.3-1 m, tallo solitano o

. ■ . ■ ■ . , ' ■ , ■

- i 1 S r - ■ . 1 ■ ■ : .!■■■■ .. .

1

il, .;■-';■.■ '"-; :

>.3 cm, pubescencia adpreso-

:^u ■■■■:.!■ ill

on; corola de color violeta, lila,

< <-l<r.|.;' ■ '•'■',;■',

II i II l 1

Tnamente pubescente, pelos

' I ■ '

: ■■,■■■..,.., I ; if
' ,.■ .(■'. I ,!!:'! :

de I mm (ej.. Balls 4667. US; Bourgeau 119, US;

nl

breves en caliz y raquis (ej., Rueda 12931, MO),
bo mas frecuente es que en Verbena Carolina las

, , ■

■■■.,',,:.:■ •

este caracter poco

la pubescencia es escabrosa.

Martens \ Galeotti (1844) fundan Verbena long-

1

agudo y margen serra

I 'J ii i >l i, i |

!'■ :-•■ ■ ■ ; : ■ ■ : ■!,

in, • •■! ,.|, ■ i 1 i
sinonimiza V. <,

enteras no divididas; el analisis del mate

;■ • i i i

1 1 1 li I i

- ■ • i • i ^ I'

T.T. • T 1 C-

. .

.■ ; , >r< v.

I , I

incluyc en la sinonimia de la misma.

Moldenke (1977) funda Verbena litoralis f. magn

in, 1 1 ii

i II I; II > i II ,

O'Leary et al, 200 7

jem- ""-""—" •-— — ■— — v- >~y — — v— " , ->">"'

plar tipo de la lor se * *

t t • t ii- ...

Stewart (1911: l-Mt ,

pecioladas. Kl <ii

:,,!,, ; I ..

1 . .,.:. i '-'1.. US). Morula:

7, ■ ■ "

» ::il; '' ' :,: '-' ;1 '-

s partes \ei-

rios BM-LINN y UPS (cor
Hjerts.

rvis, del Linnaean

la

: Mi' al '.■ II: '.

nnos de \. Carolina.

:■..';

:):

San Marcos: San Rafael. Kellermun 6310 ,

I! , ' ..„i

..'.■' ...,,r ...:,., , .' ■ ,

.■,■... ,'w. ,■■■■'<<:■■■■ i ' , ' .

1 km N dcl t:cnlro >

;,--■■;. .■,-.■,:;.- ' ,

•' ' I;'". 'I ; ■ ' . ' ■■■■■■■,

ii : betw. Zimapan & Jacala, LuradeM & Lundell 12391
Vile de Mexico a Tizapan, Bourgeau
que posee hojas

. 3291 (\\)

:::<■,::■. ■'■;■■■ '

■ruz: Los Molinos,

':-..■ • •

Tomabu, Rueda et al. 12:

(Michaux) 2: 14. 1803. TIPO: E.E. U.U. "Hab.

in Carolina", s.d., A. Michaux s.n. (holotipo, P

arrosetado, alargand i

hirsuta de pelos breves y algunos pelos glandula:

a lo largo de toe

■■■.:■'.■!■ ,ii:ii:;; ' .

principalmente sobre las venas en la eara ab

(Medik.) Moldenke (Moldei

^ ' , ^ ■:■■.■'. '; ■■■;■!::■!>.■:

(1847) y Perry (1933) eomo taxon valido

se trata, Moldei 1 1 sle taxon bajo el

lodon Raf.

para el mismo.

Material adicional examinado. E.E. U.U. Alabama:

......

■'.■-.■/ ; ; M

Verbena cloverae Moldenke, Amer. Midi. Nat-
uralist 24(3): 751. 1940, sphalm. "cloveri". TIPO:
E.E. U.U. Texas: Starr Co., Rio
1934, E. U. Clover 1618 (holotipo, NY no visto,

;m, margen pik>M>; caliz i\c 0.4-0.5 cm, con 5

is triangulares evidentes de 1 mm. subconni-

icacioii: ambas piezas de pu-

lla de color bianco

la garganta pubescente, limbo desarrollado

, o.r, ,

separa tardiamente

media del tubo core

III 1 I! I

im: IT'' ■■ ' ...

:

.■:■:::,: ;

Obserraciones. Ua separacion tardia del fruto

generos generalmente monotfpicos, fiindados ad hoc:

1941. TIPO: E.E. U.U. Texas: Ua Salic Co., near
Millett, 9 Apr. 1941, C. L. Lundell & A. A. Lundell
10142 (holotipo, NY no \isio. >h lolo SI!; isoiipos.
MICH no visto, MICH lolo SI!, TEX no visto, TEX foto
SI!).

::; , ■■[!'■..: !■.. .

Zapata, 31 Mar. 1958, C. I, Lundell & A. A. Lundell

;m reduciendose

rugosa, con pelos escabrosos sobre

rial, con algunos pelos glandulares, cara

. lormada por florescencias

). 15 (in. apice agudo v margen ciliado; (
).35-0.5 cm, con 5 dientes agudos dc

, '■■■■■ mmm;
endemica del estado de Texas, Estados Unidos

Observaciones. Verbena cloverae se caracteriza j
con cipice suboblu

I „l;' i ■»!;■; ; ■: ■■ I i II i ■. '

ocurre en V. plt<
plicata las bra

poseen una notoria

Moldenke (1941a) funda

' ; :■ n: im ■<■■: I

florescencias so] en paracladios

, 'i. II , I I

J.3-7 cm en la

5-1 mm en la

I ml '

I Mill i | II II ii, in ;.m.m ; i 5 In . -

Moldenke (196
variedad bajo la varied ad tipo. e\| b

Lundell que se r poseer flores

I M:M (1,1 Hi-
ll i liillll: M ;■ .■

(McNeill et al, 2006) debe ser "cloverae".
Material adicional examinado. E.E. U.LI. II

II ,, n,

1945, W. H. Cam.

visto, NY foto SI!; isotipos, SI!, US no visto,

foto SI!, W no visto). Figura 3.

TIPO: Ecuador. Pichincha: La Rev<-nla/6ii. ciaK-r

Pulul „i 2 5 J ii 1977, S. 1 6 P e,

(hololipo. TK\ no visio. I'K\ [oK, SI!; is,,ti,,„. Sl!|.

Hierlja de habito postrado, ramas sublefiosas y

> ■ ? i: I. ■■ ::-■■■-.. :■ ' • ' ' '

M Ml MMMMMM Ml!

escasa con algunc breves. Hojas de

I I I I X

icha de la lamina

cordones de esc Is

mico del centra de Ecuador, crece en
de Azuay y Cafiar.
Observaciones. I ei

8. Verbena ehrenbergiana Schauer, Prodr.

548. 1847. TIPO: Mexico. Veracruz: Prov.

II i i
C. Ehrenberg 153 (neotipo, aqui designado, P no
to SI!). Figura 4.

I 1 1 . i i ■ i I

■ :; i :■:■■;
standose hacia un

e aspecto paniculoide, mayor

tenso que el caliz, c

:'■■ ''hi!,!-. UNI

git i ■ I i ■ i ■ i li ,i

Observaciones. \erbc

I i I

iidos de America.

;■■!■: i: ■■...■■! ■■•■'

El tipo de Verbena

es, Ekrenberg 713"

. El dato "Los

:ndo en Me

■: i , ! I !. K ,

os (BM, G, GH, ILL, JEPS, K,

KIEL, MICH, P, STR, US, W) no se

I!' I <!<>

27 km SE

o. Hondo, Ventura 3571 (XAL).

Sudamer. Bot. 4: 186. 19

officinalis L. \ ar. ,t

254. 1832. TIPO: Brasil. s.d., F. Sellow 1840

; '■ : ^ '■!■■,..:■!.:■■ ■

Hierbas de aspecto gracil, erectas de 0.2-1 m, a

. ,, : ' ' ' ' / '

' '• ' : .

:

inrvivv : '(

. .' ' ' ! I ;:■..■;■ I I. i •!■

:;■;■■•;■ )■ ;v. " ■

. ' i:f.i.. "i; f, 'vn

z de 0.16-0.24 cm, apenas pubt

■v..:' '. 'VII • "

laceo, lila o bianco.
breve ca. 0.3-0.55 .

— [

Distribucinn i ccologia. Verbena gracilescens se

»■ la enciientra
creciendo en pasturas y a lo largo de caminos.

Observaciones. Verbena gracilescens es facilmente

;vi»li ■: ,; -II j

por el cual Chami lero una variedad

" ' "■■:■ ;■ i :■■.:■. '-■■;■

: :; v: :■.:.■:

' ...;... ; ..... ....

iiero (2004: 286)

Maria, yerba amarga".

Este taxon se incluye en el grupo informal Verbena

gracdescens var. swijliana. — E. Aspecto general de la

j207m).

• in II C ii xi '.in mi ill I, ■

■■■■; \;i \.r>. ■:■
\
i ' In I <

(Hi.- "ill. I', "I

:

.. • ' "

icilescens, pero no se sabe de quien

ill'. I , ■:■■!■. • . '

. . . M .„ .■,.

1 1 I 1 1 II 'I

!■.-■■■■::. !■.■ '■■

I I In

florales de 0.1-0.15 cm. Caliz de 0.16-0.2 cm long.,

. ? :'

Troncoso (1979: 234, fig. 105).

i w-iriedad se dislri-
Paraguay, Uruguay y sur de Brasil. Se la encuentra en

..■..■;■■

I in I I! i hi

A--, ,,■,,..: r ' . '

' ' ' ". . " '• • ' :' ' • ::■'

1 .,,:.,.. . .-;:,

J lliMi'. : I'mIo.

Zuloaga & Deginani 3404 (SI); I

' ■ : ' ! I

/..■.■A.,-,- - ' , .

■?:,■:,•) iii I'n < , ii", i, o,,,...

:■■■:.'./■.■.'. /-■:.■ :■ '

:

1

■■..

:: .V, ,M ,,

■■■■■:■■;. ' '

¥/■( : ,

; r:

;.-.„■, Jl. ,;,-:: i'.l '. ' ' . '• . '

& Zuloaga 32414 (SI).

,< ; .!.. l<> "■II '

II- ::,■:.!,■(■ iM.

sc. 1: 160. 1829.
jentina. "In Pampas ad urbe Bon

es & Hook, ex Hook. (Bot.Mii;
1829. TIPO: Argentina. "Apud Rio Sa

Mendozae". . . neca

denke) N. O'Leary, comb. nov. Basonimo:

1948. TIPO: Argentina. Misiones: San [gnacio,

19 Sep. 1946, G. J. Schwarz 3402 (holotipo, S no

visto, S foto SI!; isotipos, NY no visto, NY foto

-ura 5E, F.

Hierba hasta de 30 cm, muchas veces tie base

subafilo. Hojas pequenas ca.

angosta y margen

entero, base subp< ias hasta de 5 cm

0.2 cm. Caliz de 0.2-0.24 cm; tubo corolino de 0.45-

Distribaridti v ecologia. Esla variedad presenta

La variedad swi
cia de la variedad tip
hojas mas pequei

es de aspecto suba

Moldenke (1948) describe 1

I ■ aspecto gracil,

s mas grandes y las
poco desarrollada,

notas. El analisis d

;

, i • .I i i

;I*H;'. : !:>Vi

Material adicional examinado. ARGENTINA. Mi-
siones: Dpto. Capital, Posadas, Rodriguez 69 (SI); Posadas,

Espana, G. Schwarz »<',. G. Schwarz 4811

'JO, Vcrbaiiy -i;:y.c:iii^ .■:-:.■" ' ' ^

3: 393. 1829. TIPO: "Verbena gracilis herb
pans", s.d., s. toll, (holotipo, Fl no visto, I I f'oto
SI!, FI foto P!). Figura 6.

(holotipo. K no xisto. K folo SI!; isotipos. (; no x isto. N\

m. l:i , I.I.

foto SI!, SI!).

'r. -/■.•,'.■ .■.■:,■■■■-.

II. ■.;..,. ■,>,, i .,'. ,■

907. TIPO: E.E. U.U.

Hierba o sufrutice hasta de 4C

rificada

! I

la base, general-

in i ;■' ■

mas glabros. Hojas de 1-3 X

!:■■ ■■!-■ Ii< !;■■::■■■

cara adaxial con pubescencia escabrosa uniforme, con

dares, con 5 dientes
antes en la fructifica-
a o rosa, infundibuli-
cm, angosto, glabra
i garganta, limbo poco
s hacia la zona media

Tipifwaciones y nomenclature!. Segun Perry
(1933: 300) Verbena gracilis fue dr;

. . i! ,!(!■::. t-t ■. II
"Jardin des Plantes de Paris" \ pi

•' ; :■ :■ ,',,li:|- :■ lir. [ - 1 1 < ■ < I ;

es publico su especie. Rzedowski y Rze-

:

: .-J ,-r I: ' ■ . ' :

■■!;■!.''! '::: ■ I ' • • • •

"il i il '. ■.

Pedregal, Pringle 6539 (MO, I

.:■' .v;, ■■■.■ ' ; ;.'. ,

a Nvo. \ alio. C:

on de los Capulines,
92 (MO). San Luis Potosi: Sal in

i,i .

'h

ico y sudoeste de Estados Unidos c

America, en los estados d

Ohserraciones. Verbena gracilis muchas veces
posee uno o dos nudos con I

is flora]

, Verbena halei Small, Bull. Torrey Bot. Club 25:

■jlis subsp. halei
(Small) S. C. Barber, Syst. Bot. 7(4): 454. 1982.

Adelaide Bot. Gard. 20: 93. 2002. TIPO: E.E.
U.U. Louisiana: s. loc, s.d., ./. Hale 245
Moldenke [1963c:
162], NY no visto, NY foto SI!). Figura 7.

(vease observaciones bajo I

A-C de Nee & Tc

de pubescencia del tallo.

iriPO: Australia. New South Wales:

'■.•->■■. .l.i:'. ....

(hololipo, G no visto, G foto SI!).

sMi no\ \rrbawhaleii roseijlora (Benke) Moldenke,

• K !■,. I . I'.,.,,

Mia el este de

:

■.■■;.■■, ■;>■■ I.;:

s, mas marcada

. .i. I

' . ;■!(!■. : ■.■■ ■..»!,!■. l.-r. !: '

con dientes de apice agudo, base a
peciolo de 1.5-3 cm; hojas apic
ublinear a linear. Sinflorescencia f

pseudo-arrosetada \ la ii

i , i In <i
r ejemplo en McAtee 1953, US
y Hardin 531, VS.

Verbena ha lei es morfologicamente afin a V.

por la morfologia foliar siendo en V. halei las hojas

;i;:'h.<T ■:■ ! II "/,/i.i :' '

isiderancomoespecies

rue F. W« „

o posee pelos glandu-

intivode V. officinalis.

de Verbena leucanthe-

jrme, tubo corolino

936; Lewis & Oli

;. Michael (19

II I I
Texas, Brooks Co.

Briquet (1907) define Verbena officinalis var.

I i ,ii ii

|m Ml i

mo V. gaudichaudii. Munir (2002) la

I"

ambas variedad< officinalis por la

ti'llh; ■.:< ;■ is 1,: .

,ena paniculata Poir. en Lam., Encycl. 8: 548. 1
Verbena hastala var. paint ulala (Poir.) Furu.. J

1900. TIPO: E.E. U.U. Amerique septentrional n°

. . . ' ■!!■'». !'..!■' II .11

, .1. i mi
(liololipo, UC no visto, UC foto SP).

i-:>i -i. ■ '

Essex Co., Amherstburg, 28 Aug. 1964, H. N. Moldenke

1043 (hololipo, TEX no visto, TEX foto SP).

Hierba perenne, erecta, hasta de 1.5 m de altura,

ramificada en II ,

H-4) cm, ovado-

I: IKHI'hi-

; • .!■■■!■■ ■'

. . -'>.l.-,l!r.-=. ■;,::

Hempstead Co., rd. betw. US 67 & 1-30 al Fulton Exil, Thomas

!.,,>:,. CV, ; \ .
;■/.',/,■',';:::

■ : ■
Cameron, McAtee 1953 (US); Parish Webster, Hef

. :. ..„ :■

:

'■.■.-;!,!.
i I n II < , I I ii

. ' . .' ..!l!il:, :,.;■

La Vigueta, Nee & Taylor 26747 (NY).

, Verbena hastata L., Sp. PL 1: 20. 1753. TIPO:

[America.] Roy: Lugdb. 327 (lectotipo, aqui
designado, L 0141996 no visto, L 0141996 foto

cencia escabros; eces con algunos

■

laxos. hipotagma desarrollado, las

.. ' ' . .1 ■■■■,;■ '.-'.- ii.: ,-|;'.

densas, de 5-10(-15) X 0.4-0.5 cm,

" I >;■■> !■■;:■
II;-: i in. i ii

II i i i I j i I II
:'ii.| h :■;■ '.,■■■■

bianco, infundil s

■ ■:■■'■; :ti../ :i i:*-

pelos moniliformes en la garganta, Ii
ado, cara comisi

tifida Lam., Tabl. Eik

nnatifida (Lam.) Pur

(Purer.) 2: 416. 1811. TIPO: K.K

SP; isotipos, Pno visto

Jconografia. Britto
(1943: 381, fig. 419);

Distribution y ecologia. El area con mayor
numero de representantes de

■: ■■ h I- • f ^ i : - " s !■ '!' :

i i" , I

Observacioiics. Sr> i

ii i I! ii I i , ii I ii i ■ , -

existencia de categorias taxonomicas infra<

Moldenke (1940b, 1964e) describe las formas

ii • i . . i

En 1874 Coleman describe Verbena hastata var.
rosea Coleman para el eatalogo de la pei

cual en los herba 10 PH y LINN no

Moldenke (1963d) funda la variedad scabra dife-
gidas, conspicua-

nw\ :■:■ v.--. ;

e Verbena hastata, siendo la pubescencia

I i

iclatura. Linnaeus n

. ' '' :" I II,'! ."'. !.-:

: : .--.

ni I II ■ l II I i ! ' i II

: ,

• '■ • -il ».',,:■■

Herb. A. van l{.

! 1,1

considera mas c< del ejemplar de

, ,, ■.■■■■■ :,m (.'■ ,

','", -• I,IV-,.

Material adicional examinado. CANADA. Ontario:

^ ■ v :

. ■ ; - .■ ■ ■ "■

V .--.■„',<,■; ■-.■ -',■' '

■ ■. . . . :

:

, ■. ■ : .

Scarboro, Moldenke 18898 (SI).

■' i II .„ I !

Grant & Longbottom 9702881 (N

II ' II

:.).. 5 1/2 mi. N Warrensburg,

Merrimack, Moldenke 19024 (SI)

Co., Watchung, Mol w Mexico: Socorro

Co., Mulecreek, Cra jly 1900, Wooton s. n.

: ' : •

c i i, I »;:,,■,.. ■ '

:, , ,. '.

I , inlllll ' ■ ' <

Alt. 2: 122. 1822. TIPO: E.E. U.U. Califc
Lake Co., Mt. Sanhedrin, 19 July 1902, ,

Verbena robusta Greene, Pillonia 3: 309. 1898, syn.
TIPO: E.E. II. I ... Villi

i .-■,.',.■.■,',: .-,...;.-■■■.-,.

',. 1940, syn. nov. Verbena lasiost

■■■;■■. ;ir:> v..-.. . . .

1917. .S. B. Parish 11 •

folo SI!; isolipo, UC no visto).

,'- .,•

'2. C. C. Epllng 5445
(hololipo. LA no visto, LA folo SI!).
Verbena lasiostachys f. albiflora Moldenke, Phytologia 9(7):

Maleo Co., 2 June 1914. L. R. Abrams 5109 (holotipo,

Hierba erecta o algo decumbente on la base,

)ice, de aspecto robusto, con pubescencia hispida,

2-4(-6) cm. de lamina trilobada con dos lobulos
isales } lobulo central elfptico. margen irregular-

apice subobtuso, base cuneada, pecfolo ,

. ■;. ill '! i i

|'i| i ' I * 'i I

. ; ■ |. ;i;'. <]•■

0.3-0.45 cm con 5 dientes agudos de 1 mm,

I.-: i i

■ ■';■■' " "''•

0.5-0.7 cm, limbo 03-0.5 cm lat., con |

!"

estriado, cara comisural papil

'i'Oin I | ill " " I

|

■:■.<■■:■■■:;■:.■■;'.■■■
en los estados de Oreg

Perry (1933) diferencia Verbena robusta de V.

■ ■ ■ ■. ..,,., (,■. , i ■ :

Moldenke (1940b) funda la

lii

de 0.3-0.4 cm, pero estas dime

las variaciones que puede presentar la vari<

■ : ■

especffico. En 1964, Moldenke funda

^ ■ I ; ■ ■ ■ i ■ » I , I I ; ■ ■ ■.

olor de la corola un car
i (Moldenke, 1964a).
Jepson (1913) funda Verbena la

•
Perry (vease bajo observacion

Tipificaciones y nomenclatura. Schauer (1847) y

lores en tratar

1822 y V. prostrata R. Br.

(in. i II 'l

■ . , li i I ;

' ■ I ■ I i . I - .. I

■ ■■ ; i l! "I':

geografica, que con

scripcion del protok

Schauer (1847)

Russian River, Heller 5785 (BAF).
Oregon: Dryden, Piper 6160 (US).

1 ( ' i i!

■■.■: I: I .■;.■:■.;:.

A. Goldman 7425 (hololipo, MO no visto, MO Colo S

1 I 'i i. I, ii
424. 1948, mil nov. TIPO: E.E. U.U. Colorad

i: Ii ..M, ii..
i .■■>■■ ;.:■,. ..'/.
visto, NY foto la
visto, GH foto bracteas flora

i i < . I i .i < i I;:

pubescencia de las piezas florales no glandular o a

I '<"',' .: .|,

lar conspicua en V. macdougalii.

I".. > .:-■■■

sas, pubescencia hispido-estrigosa en la cara adaxial

■:... : .. !!,.!■

1 mm. con algunos pelos glandular

i I" ' ' i I | I 1 i "

I - » -■ ■■ ■■■ I ■ Ml i

\s ■■■■;■, ii :

nente imbricadas e
remotos en la fruclificacion. Braclea II or;

y< • '.hi ■:,:■

II I

i j

pubescencia de en la garganta,

I I "

961; Ward & Sp<
Distribution v ecologia.

Vpache Co

aminado. E.E. U.l

:

Barker 565 (MO).. i .... 1 mi. \\ lie

'Hi '

Co.. 5.0 mi. M\

■ .■;■ '.;;. i :
• ■.■.■■,■',,(•"'■.'.

i : ). V'V , i 11,1
(MO).

II ii. Veti-benu unemillli'iiiKn.;;.. " .. '

1839, sphalm. "menthaefolia" . TIPO: Mexico.
Leon, 1839, K. T. Hartw I (holotit K
visto, K foto SI!; isotipos, NY no visto, NY foto
SI!, P no visto, P foto SI!, SI!). Figura 9.

cerca de Real del Monte, del Sabino v de Izmiquilpan.

visto, NY foto SI!; isotipos, M no visto, US 00940047 no

visto, US 00940047 foto SI!. \\ 1 1 no \ islo, \\ LI folo SI!).

,,., |: 439-440. 1940.

no visto, NY foto Si!;
isotipos, Gil no visto, MICH no visto, MICH foto SI!,

Idenke, Phytologia 18: 343. 1969,

Moldenke & A. H. Moldenke 2922 (hololipo, TKX no
visto, TEX foto SI!).

1976, syn. nov. TIPO: Republica Dominicana. Peder-

nales. near Canole. c;.j

M., 1400 in. 9 Nov. I960. A. II. Liogier 16846
(h 1 lp NY no visto. N\ foto Si!; isotipo. US no
visto, US foto SI!).

■lolipo. NYnovislo.NY
,i<> U.K.. SI!. | S Ull

de 60-140 cm, ramif

Perry (1933)

31a ve 11 Ilia adj

sinonimo de V.

el apice. Hojas de la

I f ii

de 3-8 X 0.4-

i ' ' I

agudos, base cum ;os breves y poco

bracteosa, formada por paracL

! I J II "HI I,, I

if. !.■■. >.;. -■..- .•'.'..

caliz de 0.2-0.3 cm. cm. ."> dic.itcs triangulares

I i 1 1 m i i | I

II r ■..■■ !,■ ;: ■

.. . . ' . ' . '

III ' 'Ill I III

'

us hacia la zona

longitudinalmente estriado, cara com
Anatomia caulinar con parentjuima

dones de esclerenquima.

'i I I 1 , i In

0.3-0.45

!■'■■■■ '■ ■■■;■■

longitud (0.4-0. ir> cm en V.

002) y Munir (2002) tratan V. se

posee pelos glai

..:■. i' ,ii> .: ■■■!■!■ ii,ii
•i ii..- f ■■ny,< l ;

Tipificatm

en el protologo de 1

■■/■.■■,-.■,

I null J l |il ;,(- in in hi , (- I, (ii, I -«-

Material adiuonal examinado. E.E. U.U. Arizona:

Elias rl al. K

Durango: 9 mi

hw>. to El 1

'6998 (MO, NY, SI).
[\K Durango, near rio Mesquital, Gentry
-uanajuato: 20 km E San Luis do la Paz,

,,.</.-/ el al. 2392 (NY).
.. N Zimapan, Barkley 17M147 (NY);
V Tulancingo, Hernandez Magana 5976

:
: "■' . .. ' ....

Gregg 823 (MO). Baja California: Distr. del Sur, Llano de

.■'■..; ; r, ;
■ ■■..

(MO). Mexico: Cai

li<.r„ Toln.-.i

.■:/...,■..■ /.-..■; .

■■..■:. " ■ ■ .

. "• '. ' ..■■■ .

,■:■.,■/ .■;;; //;■

■ ■ ■::■ • •. . : .

; :n i; . <:■. . .
: :':.

2500 m, Gaslony el al. 363 (US).

16. Verbena iieomexicaiia (\ Gray) Small.
S.E. U.S. (A. Gray), ed. 1 [Small]: 1010. 1
Basonimo: Verbena c

A. Gray, Syn. Fl. N. Amer. (A. Gray) 2 (1): 337.
1878. TIPO: E.E. U.U. New Mexico: Grant Co.,
I f 1900 1851, C. Wright 1497

(holotipo, GH no visto, GH foto SI!; isotipo, UC
no visto, UC foto SI!). Figura 10.
Hierbas ere( tas hasta de 80 cm de altura, a veces

.is de 1-6 X 1-3 cm, de
1 cm, apice agudo, margen irregul

<■., I) ;■'■! ! ■;

venas y en los margenes, hfspido-escabrosos sobre

florescencia frondosa, form,
escencias densas

(0.25-)0.35(-0.5) cm, con 5 dientes

'• I i lull n

1 cm lat.: estambres

"HI' i'l" .J)! -i; . ' .

Observacion.es. Se reconocen dos variedades para

. :■ ■ ,hi' i-r ;i

pubescencia, la i en el tamafio de

hojas de base subamplexicaule, el porte ii

- . ■ . i | i II

sus largas bracteas florales con

usee pubescenci

I '..•,(■. (!-:■ '

j, ,.:, ..;;■ :■;■,: ■. , , . • "

I .ill II , , ! ','

,-]■■..: :: : :/■■:. ...

Ejemplares como Blumer 1804, MO;
como variedad xylopoda no difieren de V.
Moldenke (1941a: 27) funda Verbena pinetorum, sin

rios donde se hallan depositadas las coleccJ

.. ' >l Ml II 'l

mo de V. neomex
3 (1941a) describe Verbena r
una especie con pubei

I 1 | I I I I I M I

II I in I l

El analisis de la description en el protologo de

:; » .m!ii i I: ■

f VII CM.. |i'..ir:;ii,..M.
,:. ..,.-,., ,7 . '.

1 = -:. .:i» '.:: \\ ■ /

;;■/:.■/■■/, .-,-.-

sIob, White 3836 (NY, US). Tamad
de San Carlos, BarlleU 10021 (US).

16b. Verbena neomexicana var. hirtella L. M.

Perry, Ann. Missouri Bot. Card. 20: 298. 1933.
TIPO: E.E. U.U. Texas: Chisos Mlns.. 22 May
1928, E. J. Palmer 34065 (holotipo, MO no visto;
isotipos, GH no visto, NY no visto, NY foto SI!).
Figura 10D, E.

1940, syn. nov. Verbena lasioslachs \ar. abratmii
(Moldenke) Jeps.. Kl. Calif. (Jepson) 3: 381. 1943.
TIPO: E.E. U.U. Califomia: S San Diego Co.. Hoi
Springs. Jidx 1875.

. . . UC no vislo).

a. Los tipos de Torrey

la coleccion de tipos y tampoco en el herbar
NY (Michael Nee, comun. p

il !/;■:.,,;. /;;;'■',

I; slopes along Calabasas, Tidestrom 872 (US); Baboqui-
Mtns., Peebles et al. 3790 (LS); Chirieuhua Mlns..
ner 1804 (MO), Pinal Co., 5 mi. N Oracle, along San

• -■ I'll I 'i ..i.

. Norle, Apr. 1967, .

lisiana: Cameron Co., Wray Ranch, Correll 36820 (NY).
, Mexico: Grant Co., Easl Canyon, 27 Aug. 1911,
>,ingers.n. (US 660559); Pinos Altos Mtns., Greene 12505
l). Texas: Jeff Davis Co., Davis Mtns., Ferris 2607 (MO,
. MEXICO. Baja California: Calarina, Harvey 539 (US).

Texas i

la variedad tipo lla. Perry (1933)

■ ■■.;: Li I, MM

i'lli:- ,n; • : . ■■
i,i,l;ii'.. ..:■(■ ,i it i

La variedad hirsuta
con Verbena cloverae, p
hojas de lamina entera £

se puede confundir

Jepson (1943) Iraki Yerhena nhmn
Moldenke (1940b) como variedad de V. task

evidencia que este ta
: con V. lasiostachys ca

id.

' ■ ■

. ■ . ■ ' ' . .' .

,::: ■■:- ,■■-!., ,

Ml II III ,

de distribuida. I r (2002) y Mendez

alizada en casi todo el resto del mundo, como

\ \iiMriilia. Sin embargo. Barber (1982)

(Lewis & Oliver, 1961). Muchas veces

■

A

17. Verbena officinalis L., Sp. PL I:

TIPO: Herb. Clifford: 11, Verbena 6, fol. 6
(lectotipo, designado por Verdeourt [1993: 98],

Observaciones. Los

... ...... „ ... .. ... ,

105. 1907. norn. illeg. superfl.) se basan en el

I; .1: i ;

superfluos (McNeill et al., 2006: Art. 52).

' ■ ■'<!' i: I ■«■■-■■: -'ill:

Hierba gracil, erecta, de 20-100 cm de altura,

Jill! 1!

dentado-serrado con

renas suljredondeadas;

a, formada por paracladios

■■•■■ ■'. ■'

con pelos monili

Benlh.. H. \uslral. 5: 36. 1870. TIPO: Australia.
Q 1 d L iiardt, Peak Downs, 1856, F. Mueller

signado por Michael [1997: 294],

tena npurla Kaf. ex Small & A. Heller, Mem. Torre v Bol.

riparia (Kaf. ex Small & A. Hell!
Torrev Bol. Club 5: 276. 1894. TIPO: E.E. U.U. North
Carolina: Caldwell Co., along John's River near Globe,
3 Jul> 1891. J. k. Small A 4. 4. Hrlln s.«. (leduiipo.
aqui designado, NY!; isolipo, SI!).

K loin SI!).

163. 1982, syn. no\.

«>:U.)/. 1. Uitnn

i I-:! lM;.j, ,:•

H\ no vislo, NY foto SI!).

Aug. 1975, /. Z. Weber 4543 (holotipo, AD no visto).
Hojas de lamina <>

Nurnero cromosomico. n = 7 (Noack, L937;

\an lorn,. L982; Diez et al., 1984;

, .ciii^; ;■ i ■!...■■. I •

(Huang et al., 1986, 1989).

fia. Britton y Brown (1913: 95); Gleason
(1997: 294, fig. 1); Munir (2002: 79, fig. 7).

Observaciones. La morfologia de las florescencias
. Hind 727737, NY; Moore 393, L

<-.i. I.:. ■■ ;■ '

,i

son mas robustas 1; Dorsett & Morse

■

. - ii :l ,,i i I
i ' ' i

., ,1 : ■'

in no y su pu-

', 'if.!!:' - .'It

H (US) con las
ni como sinonimos.

..'■:,■ i.::. ■;■;■■»<■.

taxones se tratan coi

elongadas. Sin embargo, las i

i , I i 1 1 1 i ,

Ml :n i;il ;■.!■'. ...;■ II..; \

■ : rr , {■ :

;il H»iiil,i;il iV- ill .'

presentan se considera un caracter taxonoi

cencias delgada la descripcion

■ , •.

(1964c: 198) rita \erU>

' ' II 1 1

-■' ' I V ''I

m | | .1

1

de Holanda en 1 si tar el Herbario

I

- -iOOo:-

:

' ' : ' ' ' .' ,. I I , I .. II ,H',

'. S, SBT, UPS) y no se em-..,

ttall (1818), Muhlenberg (1818), Chapman

• ■ . .

•g (1818: 59), alii cita "Vir

'. Km I'll «• nicHilm un ejemplar de

neotipo porque es un buen

reslanle un isoii

..■■-.'! :■!'■. : ■*■■>

I'.n,:... , II. !

atribuyen este taxon a Rafine

o Klias Durand en 1800 destruyo todo el

lirrl.-.-sn..

:■ '! iliin-i

visto por Rafinesque

. Kn NY 6

I I". -i
y otra de Roger : donde dice que

"M I I ii In -

: ■ ■ ■ ■

HBG y otro en BR. Sin embargo, Hans-Helmut
que el Dr. Munir tenia intenciones de dejar

isotipo de este taxon

Material adicional cxaminado. AMERICA DEL

viunri!-:, \v ^ .■ ■

■..■■■..

• : ■■■:. ■ .

In 1 II - 1 1

10, NY, US).

<:

ii ilia: s. loc. 1 1
CHILE. X Region delos Lagos:

mayer 1916 (MO, US).
: \ •■{.■■

' II !' I II

//.■, .:.:■;. ( '•
I!"- .. '.,■,.;,, ' ..

i

a Zal, Duthie 4282 (US). IRAN.

Okinawa, Taketomi

,1. ;;,:...■..■/■
' ' ' ' . ■■ ■ ■ . ■ :

264613).

EUROPA. ALEMANIA. s. loc, 17 Jul;
3410). Baden- Wiii i Jan. 1884, Holzin-

:ben, Erdeborn, Kappel 3412 (SI).

..:,,,i

:

■ ■ ■ .. '• . .

: i . ,

4845 (SI). FRANCIA. Centre: II

:" : .:
I n i .•. Tidestrom 13282

ul. 3653 (NY). HOLANDA. Limburg:
. 49726). Z

U, ul I ."..

VI MM r|, ', "... ,

South West: Devon, Bideford, Jermyn 822 (I I'

I. In,
Palacrina, Hicken 2

:'■■

1 , , ••„,

f Rhone Valley, Stud. Bio.

(US).

ISLAS DEL ATLANTICO. ISLAS AZORES. Sta. Maria,

:■■

•>l' ;w. )\. ., ■

ewardson 492 (US).
Ribeira Principal, Granvaux Barbosa 6013 i

17b. Verbena <

ar. nalalensis Hochst.

ex C. Krauss, Flora 28: 68. 1845. TIPO:

: propre Umlaas,

Dec, C. F. Krauss 151 (holotipo, M no visto, M

foto SI!; isotipos, MO!, SI!).

a sororia D. Don, Prodr. Fl. Nepal. 104.
I ar. 1802. F. Buchar

trot., ser. 2(62): 3C
africana (R. Fern. & Ver

r<

:

tide Bot. Card. 20: 82.

West & Mabelreign, 1480 m, 21 Aug. 1955,

K folo SI!; isotipos, B no visto, BR no visto,

;.■;■/.. : .;■•

Gard. 20: 86. 2002, syn. nov. TIPO: Australia. V icloria:
Ml. Builalo. \k. dull
Ubrechl 2474 (holotipo. MKL 1560636 no xislo. MKI.

. • . •:•■::■■■ : :

1560637 folo SI!).

I I I - I Ml Ml

, I I I | || Il| I |

» ', 'M', Hi |
I' I I 'I

iriedad tipo, con

Iconografia. Hendersoi

Distribution y ecologia.

Observationes. Kernandes y Verdcourt (1989)

I nil ■ i 1 1 1 1 ■ >

■:■■:.' !■':■ , ; ; :.:(

, /M',..:".' ',■:■■!■.■ I."
' : . ' " i I I II I I ■ I II I . i | I I , I

os caracteres son

sin embargo se han encontrado

■:.■•- '■■■■■! •.■!'. .'I

Nueva Zelanda. caracteres diag-

I" ■:■ i ill MM:

;: sororia posee hojas
con los segmentos de apicc agudo,

•! i I i

I : ■ i I : I" ■ : 1 ' ■.■■

"■ l-i =1--. . ■:.

(MO). MOROCCO. High All

Highland forest, Margwe 29 (MO).

•\ Ford s.n. (IS

ay, Beauchamp 11/

(MO). TAILANDIA.
39 km up mlu. lo gale, Anderson
V
>58); Ton t h T h k h Tanaka 11032 (MO,

ISLAS DEL PACIFICO. IM

■■:

a, Okuhara & Sunagawa 22 (US);

r.s JO (US).

M"'IK I I' I'm .!. i

Constable 11633 I DA. Canterbury:

:)7639 (MO).

Club 25: 262. 1898. TIPO: E.E. U.U. New
Mexico: Lincoln Co., White Mtns., 1800 m, 21
July 1897, E. 0. Wooton 187 (holotipo, NY no
visto, NY foto SI!; isotipos, BKL no visto, GH no
visto, GH foto SI!, MO no visto, P 00371002 no
visto, P 00371002 foto SI!, P 00371003 no visto,
P 00371003 foto SI!, SI!, TEX no visto, US no
visto, US foto SI!). Figura 11.

le 40 cm .

agudo, margen

las florescencias laterales no

3-20 X 0.35-

l'i

1 i I i' I ill >.

■ ;" ' I iii.i ..■■; .' !. : 'l '

tubo corolino. Clusas

dones de esclerenquima.

Numero cromosomico. n = 7 (Lew
rd, 1984).

Otm-rrarioncs. \.w^ lioja- lineares de Verbena

leomexicana en
de las flores, sin

V. perennis son lineares.

:.;!M:i ll i.i; : !" ::

Esta \ariedad *e dil'erencia pur poseer tallos

',11 -.''ll, ll :■('«.; :

■

Ingram 2736 (US).

Phytologia 2: 150. 1946. Verbena perennis f.

G. L. Nesom, Phytologia 73: 321. 1992. TIPO:
Mexico. Tamaulipas: Palmillas to Miquihuana,
1950 m, 14 Aug. 1941, L. R. Stanford, K. L.
Retherford & R. D. Norther aft 915 (holotipo, NY
no visto, NY foto SI!; isotipo. MO no visto).
Figura HE, F.

Obserraciones. Moldenke (1946: 150) define la

..■■':,: ,>v:>n: .<r
'
!esom (1992: 321) la (leva a especie,
basandose fun I u diferente pu-

I •' -I:'. :■ "V i

i i

\' , ■■ > !■: :i I.

Por el tipo de pubescencia Verbena perennis var.
embargo las ho ens son oblongo

las bracteas florales soi
caliz siendo hojas linea
menor o igual longitud c

Material adiekmal examinado. MEXICO. Coahuila:
a. Rita, 14 May 1981, Hinton et al. 18244 (MO).

, Verbena plicata Greene, Pittonia 5: 135. 1903.
TIPO: E.E. U.U. Texas: Ward Co., Barstow, 14
Apr. 1902. S. VI. Tracy & F S. Earle 30
(holotipo, MM; 43325 no visto, NDG foto SI!;
isotipos, MO!, NY no visto, NY foto SI!, SI!, TEX
no visto, TEX foto SI!, US no visto, US foto SI!).

Observaciones. Este
bajo V.

Moldenke (1941a) funda Verbena plicai
por poseer las 1
' ().() cm, abrupl

de Texas, y agrega

i anlesis, frutos

I i

■onal examinado. E.E. U.U. ,
8 mi. E jcl. 28/>

: :i,-. :■,.,■:

; .

' ' "••■. -.■,.■■.. ■

Oliver 5412 (MO).

, Verbena recta Kunth, Nov. Gen. Sp. (quarto
ed.) 2: 277. 1818. Verbena Carolina f. recta
(Kunth) Loes., Repert. Spec. Nov. Regni Veg. 9:
362. 1911, sphalm. u caroliniana". I erbena

aliz 0.3-0.4 cm, con

res, subconniventes en la fructific

cion, pubescencia hirsuto-glandular; corola de col

rosa, Ida o rojizo, infundibulifonne, tuljo corolino 0/

0.65 cm, glabro externamente, algunos pelos en la zo:

li Veg. 9: 362. 1911, sphalm. ''car-
TIPO: Mexico. Hidalgo: entre Pachuca
ntoso, s.d., F. W. Humboldt & A.
4066 (holotipo, P no visto, P foto SI!;
no visto, P foto SI!, SI!). Figura 13A.

1961).

Ws6mic °- n

= 7 (Lewis

& (

(1999: 1059,

fig. :

idoeste de Estad<

ibglabro; caliz de 0.2 (

^ ' ^ I I I II

.iiiiiita, limbo poco
hacia la zona apical
mo. Clusas ca. 1.5 mm, de

• :. . |r,; ;■-■ i, ;\

bo montanas, a altitudes superiores a 28(

ro y sur do Mexico, donde <
do que se halla re:

■ ■■ i" !■<;,■■ | i ■

irescencias mas breves, agru-

: ' , i I

florescencias en Verbena (Marl

visto ejemplares de

Este taxon se incluye en el grupo informal Hastatae
por presentar los c;

..-.■;■'. ■:!

1;- ■ 'U hn

.. ■ ' • I! 1 'i

Obserradones. Schauer (1847) sinonimiza Verbe-

. Verbena scabra Vahl, Eclog. Amer. 2:2. 1798.
TIPO: Jamaica, s. loc, s.d.. ./. Von Rohr 35
(holotipo, C no visto, C foto SI!). Figura 14E, F.

>ena scabra f. angustifolia Moldenke, Phytologia 14: 296.
1967, svn. nov. TIPO:
Burnol Co.. 21 Juk l<)66. ./. R. Crulchfield 1837

K'na scabra f. lermfolia Moldenke, Phytologia 29: 503.
1975. svn. nov. TIPO: K.K. l.U. Texas: Tom Given Co..
Dove Creek, Knickerbocker, 19 July 1974, R. Eckhardt
1739 (holotipo, TEX no vislo, TEX folo SI!).

■.. :> . ■■■■....

entera, eliptico-ovada, de 4-8(-13) X 3-
apice agudo a subobtuso, margen serrado

«,il; . ■!■■'
.■ !>:: r\ru: : ,

formadas por paracladios trimeros laxos.

/ '^ ill

pubescencia esealm)sa, margen piloso;

. -

Ml :.!■:!■.■: I . '

HI ! II IIU

I ' ■ '.■'<>■

pubescencia escabrosa y hojas

En 1975 Moldenke describe la forma ternifolia

i |i In

,im ,.!,.; .....

Este to
por presentar los cara

I ii i I

Tlpificuciones v /(o,
cita Verbena scabra de

in de Marnock es

' I'll Mi ■■■

km N SR 16 in

:.
, '

(MO). Texas: Jefferson Co., Beaumont, Palmer 10692 (MO).

. ■ rl ■■■■■. ..;,, ,

inula: La Soledad, SW Monclova,
Palmer 1040 (NY).

ISLAS DEL CARIBE. BAH A

V. ■.::■,:.!■,■( i ' '

r viv v:
: :■■.
10456 (I

, rio Las Damas, Za.

(Hamburg) 17. 1825. TIPO: E.E. U.U. Tennes-
see: Perry Co., 6.3 mi. S of Buffalo, 24 May 1972,

?':
Figura 13B-E.
Hierba erecta, de 10-65 cm de altura, tallos

!, . ; I m I i •

3on pubescencia adpreso-estrigosa. Hojas de lamina
3-6(-10) X 0.4-2 cm,

i i:V .'.M ;l! ■ '

breves. Sinflorescencia frondos

.i:;rr; |. a/.

■ 10-25 X 0.4-0.6 cm, alar;

iscencia estrigosa; corola de color

■ i . ■ i i i
I '

Ili

■, ':;, ■■;...:;. ■■;■■.■; • - '■

el sur de Can

Observaciones. Kste taxon se incluye en el grupo
informal Hastatae por presentar los

Clave para las Variedades de Verbena simplex: Canada,

....... . . .

California en Mexico

■■

22b. var. orcuttiana

22a. Verbena simplex var. simplex. Figura 13B, C.

1803, num. illeg.. non Verbena angustij

Diet. ed. 8, 15. 1768. TIPO: E.E. U.U. "Hab. in

;<".'■,, .7: ■;.■;.

• V VWi IV-:

E.E. LJ.U. Missouri: Franklin Co., Pacific, 4 July 1896,
11. Eggerl s.n. (liololipo. _N i no visto, NY foto SI!:
isolipo, UC no visto).
Verbena simplex f. albiflora Moldenke, Phytoloj

Julv l<).-,7. R. L. \i

fU foto SI!).

Hojas escasamente pubescentes con pelos poco

■ • . .

ste de Estados Unidos

Observaciones. Perry (1933) dice que Verbena

Moldenke (1940b) funda la \ ailed
numerosas ramas base, el analisis

c\ uir. orciilliana (L. M.

Perry) N. O'Leary, stat. & comb. nov. Basonimo:
Verbena orcuttiana L. M. Perry, Ann. Missouri
Bot. Gard. 20: 284. 1933. TIPO: Mexico. Baja
California: Hanson's Ranch, 30 July 1883, C. R.
Orcutt 909 (holotipo, GH no visto, GH foto SI!;
isotipo, NY no visto, NY foto SI!). Figura 13D, E.

{Fox 4910, NY)

, MO), por lo cu

Moldenke (1964b)

■v. La mayoria de los

ii ' " i i I ! ''«

< I I I I II I ! I II M

Material adicional examinado. CANADA. Onl

;■ ■ • • i

/. .ii .'i ,:;:.-, ■■:. :

■i.:,!-.,,.^,. !■,: V ■
!;, ;i,i, :..■;

I. II ' II

Henderson 95225 (MO). Iowa: Cumberland Co..

Co., 1.5 mi. NE

i. II i

I j \wi Co.. near Miami, Stevens

MM

..........

" li'i .■:■:■. ',:'- \
II' 1,11 I

i ( -nte esparcidos,

Observaciones. En 1933 Perry funda Verbena
>r poseer pelos glandulares breves en

[CO. Baja Califor-

: . . ■ . ■ : '• ' .: :

2 mi. from Rancho la Botella, Moran 13604 (MO,

betw. San Domingo & Queretaro, Wiggins 55011 (IS).

23. Verbena str r. PL Nouv. 53.

1800. TIPO: E.E. U.U. "Regione Illioensi", s.d.,
s. coll. (holotipo. P no \islo. P foto SI!; isotipo,
SI!). Figura 8A, B.

■ I
TIPO: E.E. U.U. Kansas: ( loud Co., ( oncordia, 24 Jul)

1929. 11. C. Benkc 5164 (hololipo. F no vislo. F folo SI!:
isolipos, GH no vislo, NY no vislo, NY folo SI!, US no
vislo, US folo SI!).

suto canescente, pelos de mas

de 3.5-10 X 3-

apice agudo u obtuso, margen

tsa en la cara

rescencias solitar s trimeros, mayor

25-30(-40) X 0.6-0.8 cm, pedunculadas, (lores y

estrigosa en ami); on escasos pelos

pubeseencia de en la garganta,

Iffi. <■■■:■ ■ :■ ■-■ '

Iconografia. Britton y Brown (1913: 96); Gle;

1 : 342, fig. 2, o).
Distribution y ecologia. Verbena stricta habit
esle \ eenlro de Estados Unidos de Amei

flores conspicuas, por la abundanle pi

: : '! I . I

r. urticifolia. Barber (1982) se

hecho muchos p.

por Moldenke (1962: 272, 1964h: 195).

:ta var. mollis Torr., V.

r V. stricta f. albiflora

Miiommos de 1

7. stricta, sin embargo

los ejemplares tipo de todos es

tos taxones no se han

ultivado en Jacques

de una planta cultivada en el Ilorl. I

1 I

i.s P, BM y G ya

:

os, pero no se hallo.
Raiinesque (1832) en el protologo de Verbena

i 1827. Por lo tarn
llado.

bajo la forma tipo.

■ ' ;.
' '

Bluff, 3 mi. I,

i .„■:■■: .
' ■'. ,/ .■■■..■■■

New Rochester. Cusivk .1401)7 i\

■: : '

in.! i m

-■■■,■■.:■■:,■..■.■■
>wa, Fink 251 (US).

■■■-,■ ■ ' (' :'■).

Verbena supina L., Sp. PL 1: 21. 1753. TIPO:

[Espana.] s. loc, s.d., Loefling 16, Herb. Linn.
9.1 (lectotipo, designado por Moldenke [1965a:
255], S no visto, S foto SI!).

ma supina f. erecta Moldenke, Phytologia 11: 259. 1965,

.',. MO . ..:■.-':.. . '
! ■',:, ■!.;;.,: :

,|

C iolo SI!).

n la base de ramas

e la base, pubesc

lgunos pelos gla 0.8-4 X 0.5-

ii

disposition continu

Numero cromoson

ico. 2n = 14 (Silvestre, 1986;

gracilis y a V. ecu

oblongas, margen

ii i , ., II

in lat., pediinculos estrigosos, ligeramente

: i in Hi i i

■.'■I'M! : ". :. ■!!:■'■■■; I' .

\',.,: nil. Ii l; :!■■ ■■
1 ' : ; i ; '' ■■■

Munir (2002) Lrata la forma erecta de Moldenke

1 como una xariedad, \ evplica que se

: :

supina.

na var. minor

lllll i in I ;n | H :■>:'. linj I in i

florescencias ma cm. El ejemplar

supina, el ejemplar tipo no se ha localizado.

il/ei algunos pelos
glandulares breves en caliz y raquis.

Este taxon se incluye en el grupo informal

mi

i i I ,

debe ser rete.n, 57) acepta la

'I

Material adicional examinado. AFRICA. ALGERIA.

, <mln s.n. (US

:

Vlar. 1962, Nabil El

, 1880, Schweinfiirth
, Pappi 4331

,"' .,■-.„. ;vir
116767); Maroc, L lennen & Mauricio

' \' . ■ .". ■.■■,'...;.■,■,■. ■.;.■'-

, „ ' MM

,,. .1 ,M,

( VI 117460).
ASIA. IRAQ. Baghdad Governorate: 30 km E Bagdad,

'■ • : . .
eusGO'A, !■::;■-■...•. . \: , : , .

ia>: luerteventura,

Clo. I

:

"■ " ' . ' ■

nonda, Rainka 2419 (US).

•'..-. ■■■■.■ ' : , ■ :.. ■ u ii . -ih«- i .• .i

25. Verbena n PI. 1: 20. 1753.

TIPO: Herb. Linn. 35.

por Mendez Santos & Cafferty [2001: 1140],

'. m :.-,, ■! ! mm

a urticifolia var. leiocarpa L. M. Pern K IVrnald.

,1! • ..

TIPO: E.E. U.U.

dos. Hojas de lamina entera, ovada a oblong
X 5-8 cm, peel'..

papiraceas. Sinfloresc

nes, en la fructifieacion

preseneia de numerosos coidones

,l;

icologia. Verbena u
> y noreste de Estadc

) en si.elos organiea

Observaciones. Verbena

; ' ■ ' : " ! :; m k 'm, \ miIIii . i hi

florales.

Verbena diffusa Poir. se baso en un ejemplar

. ' • . "I " "I [M

: .■ I/,. IN':'.,

uloca este taxdn bajo la

ue, 1832) sea
vaviante del color de la, flore, de

menor tamafio d \ clusas. Perry

a pesar de que Moldenke (1979) 15 am.

y,) '.--.■ -i.nl :■;■:■ '

piezas florales i

334) sugiere que el ejem]

lloj.i Ml', VI '•'

II ill •

■ ■an este nombre con un

I-:. ' i <■■•■ ;;

LINN porque era el ejemplar mas completo.

Farwell (1924) al describir la variedad simplex

:

- ■.;■■'/','.: ( , , i.

. ■■■.

(US). Kentucky: Lewis Co.. W

I In , in

v

.. : ■■

.

Iii:,,,l„l|,.;:l!ii ,'i -. - . . . '

V •• : - . . :. '•

1330 iWJi., '--•„, , mi, II . ! II i„ ll -- - -

i. ■:,■>:;! (<!' : - -

iih-i

I'm II i.lin ■ ',■ , ' ' (I I II' -v.- \ - --

ili.l.. ,-, i -

;.-■.-.
Green Bay, s.d., Costelneau s.n. (S
, 7 iCI'kS).

. Verbena xutha Lehm., Index Seminum (Berlin)
7: 8. 1834. TIPO: E.E. U.L. Louisiana: Cameron
Parish, La. 27 & La. 82 betw. La. 1141 & Jetty
Rd., 16 July 1988, R. D. Thomas, C. Slaughter &
C. WcCrane) 1 0591 9 (neolipo, aqui designado,
Figura 15.

1876. TIPO: [America.] Hort. Bot. Berol, 20

IE loio SI!).

/ 1 .5-31-5) cm,

,, ' ,, | , H I M,

.

Iricas de 20-30 X ca.

■i fructificacion. Bracteas
; similar longitud que el

floreseencias L

caliz, 0.3-0.45 cm, de apice agudo, pi

fructificacion. |>u

ii i ii 1 1 1 1 II 1 > i , i, 1 1 i .

I :.,;,■)!■ -..!■■■

Estados !

nocible por su hah

ramente trilobadas o tripartidas en la has

abundant^ pubosconcia c-hi

En la Flora de las Islas Galop;
erff (1977) habia

i i i.'l

Moldenke (1965

\rk. 134, Thomas
Co.. 2 mi. W Ft.

, ,

h

Texas: Gonzales Co., Guadalupe

). G. Hashimoto 663 (holotipo, SP no

ena townsendii Svenson, Amer. J. Bot. 22: 253. 1935.
TIPO: Ecuador. Galapagos Islands: Indefatigable
Island. Acadenn Ba\ . 10 Apr. 1930. 11. k. Srenson
249 (holotipo, BKL no vislo, BKL folo SI!; isolipos,
CAS no vislo, CAS (olo SI!, GH no visto).

" " f Bay, 10 ^

: .

:■'■■■ ■■' il ,■ ; !■■■ • I
253). Moldenke (en Wiggins & Porter, 1971)

:

embargo, van der Werff (1977) explica que las hojas

i ! : : r i i ■■■■■■ ■ ■■ ■

imente variable en este caracter.

..... . .

■■■ ■■ i <l..'l ; <»

■ t >•■ ■ ! " '■

la posicion t
dentro del genero Ve

Fernandez Casas. J. & B. Camarra.
. & S. Silvestre. 1985.

'■:. vi. . : : .■!—■..

8:630-631.

ann, Leipzig.

. 1913. Verbena. Pp. 94-97 a

il. Madrid.

sections of Verbena. Cytologia 7: 160-175.
Diez, M. J., J. Paslor & i. Fernandez. 1984. Niimeros

Jard. Bot. Madrid 41: 191-194.

\ abend. Pp. 1051-1059 in IllusliaUd Hoia ol [\ ot ill
Central Texas. Botanical Besearch Institute of Texas. Sida.
Bot. Misc. 16.

Williams (editors), Flora
24(9): 167-236.

Bot. 3: 183-188.

ae. En P. C. Standley & L. (

: Guatemala. Fieldiana Bo

en A Manual of the
isissippi. George P.

I S ii |. I II I i < *

Pari I: The Herbaria o

.1 , ,. ,1 II, .1

nearly allied gen

1986. Plant chromosome count (3). Subtrop. Forest. Sci. &

In ,

me counts on or

-176.

i. Pp. 379-383

, Vol. 3(2). Ur

California Press,

der Verbenaceen und Lab

i. -nine Infor. Sen. 1

Kunth, C. S. 1818. Verbenaceae. Pp. 244-285 en

Humboldt. A. lionpland cK C. S. Kunlh, Nova Genera

.■.|..-i. ■. I'-.ai . .

Lawrence, G. H. M. 1951. Pp. 746-747 en Taxonomy
Vascular Plants. Macmillan Company, New York.

Bot. 48: 638-643.
Lindley, J. 1951. Glosologia de los Terminos Usados

. 15.

- - ! : •

ed., Vol. 1. Stockholm.

31: 342-368.

. 1982b. Chromosome number reports LN

31: 574-598.

regionibus Mexicanis collectarum. Bull. Acad. Roy. Sci.
i 320 324.

Verbenae. Darwiniana 31: 1-17.

SilvaJ. E.SkogJ. H. WiersemaS N.J. furland (editors).
egnum Veg. 146.

einigen neuen Gat Lunge n and Allen. Hanover.

■ !:■.
': ::..'■■

Antilles. Taxon 50: 113

Phytologia 1(14): 453-480.

. 1040!,

k 750-754.

. •;:!:..

..■ .',:;,
. 10411,. !

129-151.

. ■■.>!,-.

1:213-242.

■ I !l "

I":

.",•53,-370.

. 1962. Materials toward a monograph o

Verbena IV. Phytologia 8(5): 230-272.

i ; '"' ".■■

Verbena VIII. Phytologia 8(9): 460-496.

Verbena IX. Phytologia 9(1): 8 54.

. 1003c. II

Verbena XL Phytologia 9(3): 113-181.

! = .":■■.

Verbena XIII. Phytologia 9(5): 267-336.
Verbena XV. Phytologia 9(7): 459
l: 170-172.

I '.•■:'■ :

Verbena XIX. Phytologia 10(3): 173-236.

■..:'
(2): 80-143.

Verbena XXVI. Phytologia 11(4): 219-287.
Verbena \\\ II. Phytologia 11(5): 200-357.

:■: !:,:■ ■■■:■::■! .

Verbena XXIX. Phytologia 11(7): 435-507.

..'■■.■■.

(5): 275-301.

I: 216-256.
. 1975. Notes on new and noteworthy pi,

Phytologia 29: 503.
. 1976. N, .

Phytologia 34(1): 18-20.

0/: .......

6(1): 49-53.

. 1979. Notes on nev

.,,44(3): 134.
.. I ':;:,-
Phytologia 50(5): 308-310.

. o,<--:i .
Phytologia 51(2): 162-163.

';■!-, ,,i-:i.-.. ,. '

Contributions to a cytological catalogue of British and

I'll: i : i- ■ 1 1! ; 1 1 I •■ i -: - ■■'

Seplenlrionalis. 2nd ed. William Hamilton. Lancaster,

;

i Australia. J. Adelaide Hoi.

Verbena L. (Verbenaceae) i
Card. 20: 21-103.
Nesom. G. L 190

. ,i I III
Species. 1). Heart, Philadelphia.

ceae): Serie Pachystachyae. Ann. Missouri Bot. Card. 94:
571-621.
Pastor, J., I. Fernandez & M. J. Diez. 1988. Numeros

I-.-;' i;,-. v .

Torre> Bot. Club 1
Perry, I

;. Gard. 20: 239-363.
'lants from the Coastal Plain
pi. 450, figs. 5-8.

ttintains. Atlantic J. 1(4): 144-154.

I , , <: "i

-Craig. S. 1966. Drawings of British Plants. Part 23: t.
. Bell, London.

ii a. Kasc 3: 3. Leipzig.

owski, J. & G. C. Rzedowski. 2002. Verbena. Pp. 110-

Flora del Bajio

..:;■■.;■ ...-HI

K. Jan is. K. K.
Barrie & D. M. Allan (editors), A List of Linnaean Generic
Names and Their Types. Regnum Veg. 127.
Wadmond, S. C. 1932. Notes from southeastern Wisconsin.
Rhodora 34: 18-19.

:

'■■:'n' ■ I''"-

..;,..:■■■..'■■...

Vhaucr. J. C. 1817. \ erbenaceae. Prodr. (DC.) .
700. Treutlel el Wiirlz, Paris.

ihiai sobre una mod

& R. Spelle

Phytologia 64: 390-

— & c. c

1

Zhurn. S.S.S.R. 70(7):

2. Verbena California Moldenke

Hi

107-148.

4. Verbena Carolina L.

I i

of the Southeastern Mora. Published by the author, New

Carolina and contiguous lerrilorv. Mem. Torres Bol. Club

•racilescens var. s

3(1): 1-36.

(16): 747-765.

.ualts Desf.

12. Verbena halei Small

Sciences to the Galapagos Islands 1905-1906. Proc. Calif.

i haslala L.

:

(Galapagos and Cocos Islands). Amer. J. Bol. 22: 208-277.

.. . .,.;.i.

II-;'" .

Burkarl (editor), flora Enlre Rios. Colecc. Ci. Inst. Nac.
Tecnol. Agropecu. 6(5).

Verbena recta Kunth
Verbena simplex var. c

Comenianae, Bot. 25: 1-R
-an der Werff, H. 1977. Vase
Islands: New records am

; ,| ,„

responde (ver Apendice 1).

dam 12959 (29), 13072 (29); Adams C.
iE. 558 (10); Ahles 4784
lard 14838 (16), 1682 (
iderson 10404 (5), 3977 {

10967 (25); Aguir
et al. 1232 (10); i
US 1490133 (4);/
al. 704 (11); A

. :

672 (13), 8829 (16) (3), 22069 (30), s.ra.

US 464299 (4), ..// n. US 464303 (16);

; '
, ' . . ■• : - : ). /;...■'/

Barkley 1485 (28), v (12); Barkley &

:

; .
: , ...,,■. -\i>

Bernet s.n. (20); Biltmore 4759 (27); i?iun™ & Pagliari 6149

\ : : :

: ■ ■ '

' . . ' ' . .. .'

.-.v ; .. ,: ::.: :
■:: ) .■•:■.■/■/.■..'■■

Brenckle 47533 (28), 47547 (13), 48067 (12); Brett 308 (4);

. . . ,

: il-'i

; :

■ ■ ■ :■■ .■.■.:..;.' .;!■:>!

27358 (10); Burkart et al. 28824 (10), 31067 (I

■ ; ,

:
(10), 28360 (10), 28384 (10), 29844 (10), 29970 (10), 30260

(4); Calzada J. 212 US 771850; (28);

(10); Carleton 276 (16); Carnevali

.■ : .. ; ..

. . . ' • !

. : '

s.n. MO 703969 (13), s.n. MO 859901 (13); 67

3228 (30), 3229 (13); Chevallier I

• ' " '" . .

: .

:
ite 736 (13), 4057 (28), 5053 (12);
Conrad 234 (27); Constable 11633 (19); Conlrcn

1288 (18), 4992 (3);

' ' ' ■ ' ■ . ■

: .

(22), 38275 (18), 48 nomas 100220 (31);

3), 50968 (31), 57970 (23), 53037

: ' "

(5), 4765 (5), 5722 ( 28348 (28), 34007

:■ ■• " ' '• . ' '

28); Davidson 858 (28); Dovw s.n. (13), 220 (16),

; .

18023 (18); Demaree 3553 (28). 829.3 (30).
12996 (28), 26520 (30), 2 72 78 (27), 2 7808 (27).
27288 (30), 27792 (27), 29588 (25

: ':"..■ ,-./m

•'.
Drummond 253 (5) /J/mmra 2600 (27);

(22); £ar/e & £arZe
;7e & 7racj 41 (23); Eastwood 2.5 (1)

. . ' . s ■ •■•>) ■■„■.

409 (13). .TIT.

■tt 39 (28); Te/g-e/- et
Ferguson 325 (22): 2753 (25); Fernald

Fahrenholly s.n. US S
(5); Fa^ 3667 (20);

. ■ ■ . . . . .,

■ ■. ■ • . ' ■ .■ .

:

'i •

; .

■ ..■■■.■■■■■■ (-I
79303 (4); Gebhardt 655 (30); Gibert 779 (10);

(30), 49809 (25), 53548 (25), 56533a (12); Got,

: .

Grant & Longbottom 9702881 (13); Granvaux Barbosa 6013

■ 12505 (18); Greenman 1374 (30),

7953 (13); Greerua, i (16); Gre«no 3278

. ■'■..-., ■,■',■:

Hauser 3058 (28); Havard s.n.

I; Heisrr !

. 4660 (11), 4890 (3

ffiggins 4537 (28), 5764 (15), 7023 (23), 7065 (23), 7188
rins et al. 9867 (23),

'■".:.<:.■,■ .■'■-"•' . ^

ffi/ifo/i 5847 (11), 76636 (3), 18487 (18); ffi/iton, et aZ. 18244

</.-.■./,■■.■•', ■ ; '
: •■.;

: • '. ■ ' ' • :

::.■. (.-,.! ■'• • • ' '

< •..

). Ibarra Manriquez

' ^ ' ■■;..,'■ ..'.■:,,.!.■,.

. ■ . .. . ■ ■ ' : ■ :

; •

: : . '• •

ss 151 (19); Krug &

, :■ ,■,.>:■;■■.: :■■;

:

(12), 10843 (6), 173 1340 (17); Ly/e 253

(23); Macoun 54634 (27), 81042

,.'.-,■■■;. L..:.- '■ :■

: ;./■/;;,.,;■

McKechnie 68 (22); MciVeaZ 2997 (16); McVaugh 18865 (4);

:

:

,). 1330 (30), 1339
(13), 18898 (13), 19024 (13), 19038 (13), 19125

r .',./„■.,,,;- /

Morello 3060 (10); I (30); Morton 6640

■: ■■,■.■!■ ■.<,...:.-'.-

), 22919 (4), 23467
'^ ^ . ' ' '

al. 43634 (30), 44021 (12); A^eZso/i 505 (28), 45?

, ■ '.: ' . • • ' .'

.■:<.•■:;, ■,-,.■,:

2287149 (4); Ortenburger et al. 16810 (4); Owr 14385 (30).
PaZmer 78 (12), 13, (16), 244 (28), 304

: : . . . • ' ■:.'..

I. !
PartW 5934 (15), 8204 (12), 75150 (30); 1W,

^ ^ ■! /W ,s.„. IS

: . . .. . .

.'• ".. :w»- = :

): Pltard 316 (29); Polatschek s.n.

. ■.■■.■:. ; . . .

; ; :

Rainka 2419 (29); Rambo 30975 (9); Rapp 57 (
26281 (27), 27849 (6), 37941 (27)

(6); Ripley & Barneby 11151 (22); /..

. ■ ■ .(■::■:■. \ .,■.■,■„

'.'■•' ih i : ; '..-
^ . ' ^ ' /:■■,'.'■■■ !!•.>:■:

' :. ' • ■ . : ; ' . :

:

. . ' . ■ : ■>) ..,./,. !

Sandberg 266 (28); Saravia Toledo 1705 (10); Sargent 695
(25); Saunders 1162 (30); Sayago 2369 (10); Scfu

: .

s.n. (20); Schuhwerk 90/219 (29);
(9), 6207 (9); Schweinfurth s.n. US 806208 (29); Seaman s.n.

. ' ' ■■..-,■','■■ ■:/ ;■■■■:

45487 (11), 44326 (16), 441290 (4); Shear 149 (>

I, 9089 (17); Singer

' " ..■■.' (f-.i. .:./,-.

:
2304 (31); Small & v Small 4341 (25);

: ..

■ ■ ' : ". : : '

. . ' ,-'i,,:. .-,■.:!.

^- ' : : : < : ii. >

.■ :,;>>; .■;..■;,'■■■
6169 (28); Sirorcg

.■.'/,■:.■■■■ ;■■■.■.! ■..■■.

5wa6 55i (30); Swo //. US 4494 (20), 5.

/. 110,32 (19); Taylor 49 (18), 233 (4)

; . : ■; . ;

Troiani & Steibel 3893 (10); Trou

Tyacke 1838 (20); Tyler s.n. US 500803 (12). Uml.

rir 2208 (4); Van Sickle s.n. US

Vignolo-Lutali s.n. ; 544220 (11); Visher

■
8101 (19), 76H37 (18); IFaZZace ef

21827 (22), 46244 (3); Wtoe/faK 1442 (1), 3795 (22), 4520
Veigend 99/76 (30);

S\ .■/■./, : ■-■:' !..

(12); Wheeler 1191 < 8), 3336 (18), 4104

(16), 4776 (18); Whitehouse 16426 (30), 7 7019 (J

; : ' -. .

Wiggins & Demur. ;.n. (4), s.ra. US

:
Winter 20 (28); Mtte 176 (22); Wolff 2948 (12); JFootore 208
;

f 6 (11); JFynd 525
816433 (22); Youngjune Chang

Zardini & Perez 2832 (10); Zetterstedt 1050 (20);

,//. 2691 (10).

, M. Perryl

ena africana (K. Fern. & Verde.) P. W. Michael |= V.

|

enke [= V. menthifolia Benth.]
Moldenke [= "

i Moldcnkc | = V.

Link |

. Utvhys Link |
r.iftrliys Link |
stachys Link]
lasioslachys Link ]

blia Benth.]
,a officinalis f. roseiflora

var. officinalis]

i c\ C. Krauss|
var. officinalis]

i sedula Moldenke [= L. coro/ino L.1
i sedula var. dara;m» Moldenke [= V. Carolina L.]
Verbena sedula var. fournieri Moldenke [= V. Carolina L.|
Verbena subuligera Greene [= K bracteata Lag. & Rodr.]
/eriena supma f. erecta Moldenke [= V. supina L.]

. I -IN-:!

ENDEMISM IN NEOTROPICAL a : ■ Claudia P. Bove?

PODOSTEMACEAE 1 Hannah L Stevens "

for a subset of species. M

|.U 1UCN assessment
Lei) one third oi the species fall into one of three
-ruble (VU). I

■.■.■i- " .: I',' : ... , ■■.!:,.-,:■■;: );; ,

hidrclctrieas na Auk m n rsle problcma.

■IJ hi,, •!,,,-

: • . , •• : . . ■ . . .'. . • ' : . •

, . , !

, I • N iir flitter for his help in interpreting his collections from Bolivia. Paula K. B.

I , ,, , i ,

. I:.
'I'.: ,..::,■;■■,, ■!

de Janeiro, Brazil.

U.S.A.

doi: 10.3417/2008087

ri Bot. Gard. 97: 425-456. Published on 10 October 2010.

r.v.
.ikichcd Lo solid

I

I.. 2002: Wurdack & Davis,

1 i i ■ I 'i

i i i I

Weddell (187: X)2, 1914) we«

: ! ;■■.(■( ..-;■. ;

ion of species with
e.g., Royen, 1951; Taylor, 1953;

2002; Leon, 2006; Cook &

.'.ri >.<>;: li'i !.:':• .i; i!

Analyses of distribution patterns, and thereby
■ssments of species endemism,

!,. i;.- :■!■■; "

■.

: i! ■:!■. i;i ■

: ...' lil- <i... IT;'. ',•-.

detailed assessment of narrow species di

if <■. . <■; ">' i

Tropical rivers are under intense threat by humans

:

v !/■.' Ml;:.', •

' nii' . .

. :■. ,.j (,.■.■::■.,
i II i| I

IIJCN Red List

i i 1 1 1 i i i ,

,ii

the Neotropics.

Two estimates of en
sively in Royen ,4) treatment of

1) were based

;*■(■:■. i<- ■:\<-i].

Estimates wen- then calculated based on die
current laxonomy, i.e., Royen (1951, 1953, 1954)

1987, 1997, 2003; Burger, 1983; Hollander & Berg,
1983; Novelo & b, 1995, 1997;

Werkhoven & Peeters, 1993; Velasquez, 1994;

VX I :.:,■.<. ;

I ..■::■;■:'.. .-■'.."■: : ■■...

■ :.'.,»■'; I'.

EAP, GH, GUA, ICN, L, MEXU, MG, NHA, NY, R,
RB, U, VEN, WCSU.

lo rivers. We propose

Eastern Guii

Lophogyne sp. A

' ■ ; ; .■.!<■■■: i ' ■

' i I! I ,

■ ■ ■

.ill ■::■" il <'■ iiiiiiiinl! i III in. i, ii hi. In li

'I i i i

Analyses of species distributions within and

■ 1 1 .

. , • "I ili

single species (WeddeUina squamulosa

brick & Novelo, 2004; Phil]
2009; Bove et al, 2006, in press).

' i i i I i

; '.■■■! i

ii -;.•■..:. I i; -, rr

i;n ':' '
regions (Guiana Area, Orinoco

I

I i ,;ir, ■>* ii;" ■ ■

i for the extinctioi

' ' ■■■.■:■;!,-::

: ..Mr :-.7.,.,/:;;;

Tvveiil\-t\\(i -pccio were mapped and analyzed

in which a species occurs. The IUCN Red cated by Z te (1979) and using

geospatial riv( Americas Base Map

(Bletter et al., 2004). Both the major and minor rivers

Endemism in Neotropical Podostemaceae

1 Geographic System (WGS) 1984.

riterion use
(IUCN, 2009) that measures the area

calculated for all species that had

I ' I '■ • ' !

& C. P. Bove, Cipoia ramosa C. P. Bove,
forme (Tul. & Wedd.) C. T. Philbrick & Novelo) were

.:■;!<■ i .■■::.;-ir,,i'

I II I I I

li'll II ' '

i species listed

, I i I I ' ,

■ ' ' . ■■

•roved as EX or CR in the

h: h- ;i in,

■■■■(>;■.!■!■[

ata Deficient (DD).
Estimates of the length of reservoirs associated with

|W ,,■,,,. ,.,-|r. : .

Google Earth (<http://earth.google.com/>; 16 June

Royen (1951, 1953, 1954) recognized 19 genera

I i II ■

(Table 2). The perc

genus ranged from zero in thre

dellma) to 100%

steiraola Suess.). Five of the six

iola had two sp<
(Apinagia, Marath
had 56%, 21%, and 48% oi
respectively. It is notable that
i of Castelnavia \
endemics. Overall, 73 (48%) of th.
by Royen were one

endemic species (Table 2). Apir

had three. Twcnt

Royen's treatments

Argentina. Brazil, Costa Rica, Hondu

■> -.■!'•■!!,! , . ■

I V'. ■■■■>' ■ <>

taxonomic recogi

in six (Ceratolacis,
ia, Monostylis, Wett-
genera with 100%

<iia

■';■■.■;.■■: •■■:■
i, i I ' ' , I

species scored as Dala ,u. n.a., Genus not recoj

11. 1953, 1954) Current taxonom;

2 (29%) 2 (100%)

1 (21%) 3 (16%)

2 (20%) 2 (20%)

1 (17%) 1 (100%) 2 (33%) 1 (50%)

1 (48%) 5 (22%)

7 (32%) 7 (100%) 6 (27%)

1 (100%)

3 (70%) 22 (16%)

cies. Schnell (1969. Guyana) reported broader

idle) P. Royen, A. longifolia
(Tul.) P. Royen, ent) P. Royen, A.

, • !'| l|: I. :r.

well as Mamthrum rapillaceum (Pulle) P. Royen and
Oserya perpiisilla (Weill) P. Royen. Berry (2004,

na (Went) P. Royen, A. com,:
Engl, 4. ni'/;

n Wedd.), Oserya Tul. & Wedd. (0.

K. I. Goebel, #. flagellifolia P. Royen),

genera that indicated broader distributions ll
reported by Royen (1951, 1954): A. kochii (Engl.)
Royen, A. multibranchiata (Matthiesen) P. Royen,

. : ..■ i.. .•'■ .

of some species as reported by Royen (195

■■■.<■■■■■■.■:;!,■;■ I '.. imp. i i.
■■.■,■•:■ !■:■■.:■> ,iii;l
1 i I

!

(Went) P. Royen [Went) P. Royen,

■ ■■■;. h,.r...- L ■.'■.'

P. Royen, Tristicha trifaria (Bory ex Will.

' .'T.'CI I"; |||:

Two species that Royen (1951) documented from a
■illata (P. Royen)

Endemism in Neotropical Podostemaceae

(1951): A. digit,: uosa (Tul.) \\

• yanensis, and A. marowrn,ensis.

Tur (1997, Argentina) reported that Podostemum

il ' ■ , ,

revised taxonomy of the genus provided In

and Novelo (2004; see below) presented a markedly

Novelo and Philbrick (1997. Mexico) documented

■■■■■.■

.■■■>!■,■■! ;!.;■"

Philbrick and Novelo (2004, Podostemum) reported

(Tul. & Wedd.) C. T. Philbrick & Novelo (

that was documented from a sing
ic ranges. For example, P. //•«

I . i I 1

i only known from northeast Sao

II o had been

Mr: " ■; ,;,

approximately 1400-1

had the second narrowest disti

I five species of

while the presen

I

'ul. & Wedd.) were

in south-central Brazil.
Wedd. was the most

Para, and Tocantins.

Velasquez (1994, Venezuela) listed 10 species for

I '

I I" ii

'

(2004), but not by Velasquez (1994).
Published literature: new taxa. Thi rteen i

and Hollander and Berg (1983) desc

I : ' II 'i.i

noveloi from To et al. (2004a)

iilc Bove et al.

■ In i I i..i

(D. lombardii Novelo, (..

I ■■!■ ■.■!;!,■.

• I!'.....: ;: ■.■■■■.

i Mia (Novelo &

■■ '! ''I' '

Tur (Tur, 1975).

Several nomenclatural changes were also made.

Spreng.

R ^ 1 L 1 (200)) ll L L Lt of

nized by Royen (1951) under their

Philbrick and Novelo (2004) proposed a broader

and Novelo (2004) was also

i ' !

!

;■!...:■<■ .';■. » I II - .
I ,•;«■< 1 !:■•■ !■.■■.

Insight, from herbarium hold

ii ; ■:. I

ns for many species than reported
3, 1954). Royen (1954) reporter

latter species was also documented from Mato Grosso
and Tocantins (Brazil).

peruviana (Wedd.) Kngl. occurred in Ecuador,

, i, I' ii
\ ■■-'■! >,- ; ■ ■

I i I ' ' ■ II

collections by one ndicated that this

Even species that Royen reported ;is common in

.'■:■ !■ •■:;.■ r: :■

Ii

-■.:■.

Distributions for 22 species documented using GIS

;: rin

:

,■.;■!;■■ i ii '■.■■■!■■:
;.^.;,?.y. -.:,,.

capillacea were documented

l,i;; i.l, Mr, ;•

only from the
Tocantins Rhci re single-ri\ei

! I'.

were documented i River. Castelna-

:•■■" :■, ; , ;;

iii 1 in HI ;; .nil II i i S\;vu;,i '

I >er of species per

I; <■!■ :■■• ;'i; ; .*■> -■.,■,■.

(six species each).

■■ ' ■ ' !<■ ;" . .,;■!: ' I

-panned greater

, , ,11". :ii:.: . ' .. '../'. ■;,... ,!ll.. ■.mmi.

; .■.■..,■,;.■■ .;;■::• ,:■■■; ;•::<:■! :fr.-n ■ . . ■. . . I::.:;!, ■.[■: .

-ine river in each),

' . ■ ■ ! i ri\>'\ ■

lie basins (see below). Six specie:

i. The Doce and

Five species were documented from more than one

ceps, Cipoia inserta, PodosWm
C. T. Philbrick & Novelo, P.

\ »-= - s i r , i . ..,;

1, Figs. 2, 3)
occurred in the Eastern Brazil
System. Castelnavia princeps and P. scaturig

i the Guiana area and Orinoco

' ' , . .. ) l',i;r

System (Fig. 1).

ii in | i 'I ia»a: ill air a n i a m |

Ml: Hi':', II S " I. II 1 " : ' '

, Colombia, Sum

Seven genera possessed at least one two-river

:)'■/'<, Ill I ::"

27% (6 spp.) two-river endemism, respectively.

as were placed

: : ., ... ■ a*

saa • !!■■■■;■.

a ■.':■■,;!<:>■:-:.,

I I II I <

The number of species per river ranged from one to

;,.<■ i a P "
I" va: : i .in; .., ■ ■

. . .

>ecies (Table 2). All species in th

;enera, the percentage of one-river endenn

>hus, Lophogyne,

!•■■'.■■ uaa-.a-

Podostemaceae occur in 22 Latin American

,1 I i'!i

VU D2 (with a restricted
in Apinagia (18) and Rhy
monotypic genera (Diam

:

:

iioven were score
by Leon (2006); we follow Leon

: an collected sin

reportedly oc<

brick & Row.

Castelnavia (C. monandra

were doc

i region in a

d as EN Blab(iii) by Bo

tress), because its

5 populations

construction. The remaining two CR species are

(IT. accorsii

aspectively, at the

Endemism in Neotropical Podostemaceae

of about 6000 km 2 , five species ranged from 20,000 to
100,000 km 2 , an< I >00,000 km 2 . The

1,000,000 km 2 (Caalcliiavia princeps, Podostemum

II I ' ' ; I

■ ' •

hnwcxer. was weak (r 2 = 0.23).

■ ■■;'■■'.■■

i (cf. Philbrick & Novelo,

> : :

I >il ii mi m I Ml 111 <»; ';■. II, ! linn i, II i ; ji ni ;: r-
preting the degre nism in Podoste-

- ..:..;■ <r ill i: I ;
I I I i

adequate. Such genera as Apinagia. ,/

Clearly, the distribution of species of Podostema-

i 'i ili-

i ill I, i,l ill II i, | I; i I III I II II ' II 1,1

We propose that a river, rather than a location

... I,,""". I! 'I

embers of the family.
El L f 1 th species biology of Podostemaceae,

■ ... .. .;, ,i"i

si . ;■.-■:

.

1 |CrBla,b(iii)|(2%)

2 (40%)

1 [Cr Blb(iii)] (50%)

f

1 (50%)

1 [EN Bla,b(iii)] (100%)

1 [Cr Bla,b(iii)] (10%)

1 LCr Blb(iii)J (9%)

2 LCr Blb(iii)j (67%)

41 (30%)

45 (33%)

39 (29%)

10 (7%)

iterfalls) separated by expanses of

dispersal. Large c

may be misleading. Indeed, incomplete un< I

of the taxonomy ai ril nition of species

hinders accurate estimates of endemism. Consequent-

■ !l ■' :■■■>■-■

, if further analyses of DD
in being reduced to synonymy,

Berry, 2004). Future studies will no doubt resi
imates provided here.

i I ill

bird of them are

! ■'.

'HI .jvniled .;;■.

DD one- and two ies (42 spp. total)

- i i ill , I ii

' '

i i .

Endemism in Neotropical Podostemaceae

: ' > ■".

for the 22 species included in tli
i i i i ii

jased on Royen (1951, 1953, 1954) and

. ; .......

are more thorough h

Reports in the early literature; (e.g., Willis, 1902)

. i ■Mil:. I ■

iown from only a 0.5-1 -km

. • ^ ii i ' Ii i

i- i mi

Eight species, representing five genera, have

1 1 1 I

Janeiro (Bove et 3). Podostemum

the Parana River System hj

• ■■ In -

; -'^ ■ ii ii ii > Mil

istern Sao Paulo

documented only
from a small region in the state of Rio de Janeiro.
Among species in Mexico, where species distribu-

I ,'

I mil I I i. I i'l i I ,

nana and 0. perpusilla range from central Venezuela

ii i 1 1

i eh represent taxa

n: ' ii.

from northern I

m e; ten B 1 l

to western Mato Grosso (Fig. 1). Five species (and one

ranges in southc a astern Argentina

(Fig. 2). Podostemum scaturigi

' .«> ;r;.. ■•,',

Rio de Janeiro (Fig. 2). More

■■ i-i'ii'.' ..i l: I'.l.

Some species ha\e distributions larger than

'..■■> in ..ii ..; ■;

:

III I I III

mill

Endemism in Neotropical Podostemaceae

w Brunswick and Nova Scui'

i ili ■

iv..rili--n I,'-
diversity of geo;

• M , | '

; H-i (<■; I .•:■-■.

:cies of Podostemaceae. Such

waterfalls)

il

Assessment of tlic number of river- tlii.it a given

:

I !'

;;:■■■>..■ i :
r .■! •: ■■: '

I I I I III'

stems, and rivers,

basins (Amazon River System

Parana River System) were similar in the number of

' ' ' ' ' ■■■:'■ '

the monotypic genus Monostyk

■ I ■'!■■■. ■> i ' ■■■■.'

: : .

basins possesse< que podostemad

aphic regions certain
mazon River System basin, three of tl

nil il! 11

re needed.
Werkhoven and Peeters (1993), in their consider-

' " '. >■<> '|,: >;■!!■■'.

I ii all In :l '

55 (34%) and 12 (39%) in the

Rivers are heavily impacted tropical aquatic
- .»n et ah, 2006).

to river biola (( i

in I II I I I I i III II I II II MllIlM II 'I, I

' ;:• ;ii.':v

tng-Seuk et ah, 2003). The

1 ;■ ., :.M,iii'ii,)
et al, 1989; Allan, 1996; Nils

;
et al, 2007). Pringle et al. (2000) dis«

. I I"; ■.■ ei : II

Five ecological conditions are central to persistence

i i .| ill ii i ,1 ,n II

Pi [ I

Uruguai

lla

Machadinho

Grande

Marimbondo

Grande

Grande

i seed, which

Obviously, dams have
regime is changed into

n reservoirs m

large dams in A

Poff et al. (1997) emphasized the i
timing of high/low waler levels t
Management of water release from d
j s to flooding patter
natural water flow, and thus impac

communities are influenced downstrea
KingsoKing and Bain (1993) shoi

along the Tocanti imbined reservoir

length of about 280 km. The Grande River, which

..: . ' <i:< :

Large dams influence the occurrence of aquatic
af, 2006). For example, pat-

r released from a m

mi for more than

both upstream and

Anecdotal accounts indicate that large dams have

, i I i '1

apparent extinction of Wetts

<!■■.:■;■ il>- ;Vi i ' ■ ......

ated with the Lajeado Dam (TocanLins Ri\ei. with a focus on those tlmt have the smallest

■ • ■■•'■■ i i

...... ...

account for 15%-
constructed in the

Chodat & \ ische pccies is enhanced.

r.ic species that are

few have yet been do, . I the number 01 nvcrs is taken into

in i- that are account [»i
heavilj impacted I!

the species can Jx: ! is being LC, nature of species and their geographic distributions.

arc based on single and/or incomplete

third of the species in the Neotropics.

Increasing demand for hydropower has the potential

The Report of the on Dams (2000)

I at > 90% of power generate;.!

: ' ■ .: i. . : i i! .; ' . -A I II ■'

■ I i I i I il< Mi I I !

laceae. Increasing pressures to

II ,„ II ' I

vs. Chapman & Hall, London.
;. 2000. The Biology, Taxonomy and

,"g. c. (.: ■

(Podostemaceae) horn Ghana. PL Syst. Evol. 237:
165-183.

Press, St. Louis.

Beyer, II. L. 2001. Hawth's Analysis

<http // J l le 1 g /hi 1

Bletter, N., J. lanovec, B. Brosi & D. C. D

D. C. Daly. 2004. A digital

[he lower reaches Regulated Rivers: Res. Managem. 4:

ijol. 13: 1-8.

Publishing, The Hague.

. 1- '<»(,[,

i :ss, Oxford.

& R. Rutishauser. 2001. Name changes in

..'. II h.,
—

Plants, Vol. 9. Springer, Berlin.
.UssHt. C & (, ( n

psida. II. Repartition et evolution des Tristichaceae. Bui

Mus. Natl. Hisl. Nat.. R, Adansonia 2: 223-262.
iudgeon, D., A. H. Arthinglon, M. 0. Gessner, Z.-
Kawabata, D. J. Knowler, C. Leveque, R. J. Naimai

.. :'.i;...-. ,-. •■:' ■::

:■, P. S. & B. Malmqvi
i Rivers. Oxford Univ

. I , ill i

can rivers. Geomorphology

'75. The Podoslemaeeae in

ll'eil 2. Unler-
suchungen ubre die Keimung. Rot. Jalirb. Syst. 95:
455-477.

Phylogeny of Clusiaceae based on rbcL sequences. Int. J.
53: 1045-1054.

Bot. Neerl. 32: 223

vember 2009.
Jager-Zurn, I. 2005. Shoot apex and sp.H

■!•., !'! "• '.

,li ,

II

29: 921-932.
Peru Biol. 13: 565.

and molecular systematica of African Podostemaceae-

:

!'• i ■:,.: I.-.

67.

N.nelo. R. A. &

(Podoslemaeeae) from Jalisco. Mexico. rSovon 5: 54-56.

••:
ceae. Aquatic Bot. 57:

Mesoamericana 3: 1-7. First published on the Flora
Ucsoamerieana website 7 Jul) 2000. <http://www.lropicos.
org/docs/meso/podostemaceae.pdf?projectid=3&langid=66>,

i ().. A. S. Taxaies & A. h.in

111!. ': ■■ ■./■Hi "i!

New York.

& C. P. Bove. 2008. A new species of

(Pock t n ) f om Tocantins, Brazil. Novon 18: 94-98.

Castelnaiiu { Podostomaceae). Ssl. Bot. 34: 715-729.

& A. Novelo R. 1995. New World Podoslemaeeae:

Ecological and evolutionary enigmas. Brillonia 47: 210-
222.

Aquatic Bot. 57: 183

& . 2001. A ji,

.nogr. 70: 1-106.

2004a. Two new genera

Endemism in Neotropical Podostemaceae

Poff, N. L. & D. D. Har

B. D. Richter & R. P. Sparks. 1997. The natural [low

. Proc. A all. Acad. Sci.

U.S.A. 104:5732

macro] )iola in ihe New World: Tropical-temperate com-
1507-823.

Development: A New Framework for Decision-Making.
Venezuela. Acta Bot. Venez. 30: 249-252.

,-. ' \, ■ I !.

Manage. Rev. (New Delhi) 2: 1-26.

. ' 1,1,. 1 >, I .1

I'): 50 52.

s, Dordrecht.
and Ceylon. Ann. Roy. Bot. Card. (Peradeniya) 1:

r

eerl. 2: 1-20.

I. 3: 215-263.

&R. R. K.

R. ReiLz (editor). Flora ihistrada Catarinense, Part la

Desenvolvimienlo Florestal, Herbario Barbosa Rodrigues
in Podostemaceae (river-weeds). Aquatic Bot. 57: 29-70.

1748-1758.

■. ■ ■

Lalina Tech. Pap., (1): 171 pp.

Plants. St. Martin's Press, New York.

: Podostemaceae para

IV...
Rios. Colecc. Ci. Inst. Nac. Tecnol. Agropecu. 6: 43-54.
I ,..,..,

57: 213-241.

. 2003. Uti,

maceae) cita del genero para la Argentina. Hickenia 3:
151-156.
mi I - I

Ihokopondo Lake. Utrecht: |P\SKSN\| l*,rokopon<lo Ke-
'.,-. '' ■,.■■: •■;.■: :•;:■ ■■

,,, I .:,,,:: ",:!:,■

Yungas, Huarinilla River, 18 Ma,

.'• • .!!■■).

il{. \\(M I.

Suriname River. I

Philbrick et al. 621 i-Kondre, Suriname

. .' : • . : . . . ' . •

54°26'12.9"W, 4 i / al. 6258 (BBS,

,/.w, 6022 (CAR, WCSU).

:CUADOR. Azuay:

Sieyermark 52759 (NY).

..■.'!■■■- ■■<

:;

' !■:.;,::,. ,:.,
- I i , '

; : : ,,, i,:--

: !.,■ = •"': . .

XW.'.II .'Hi
(R, WCSU).

:
5976 (R, WCSU).

Marathrum aide 1
Noevo, Jilamito, 15°30'N,87°34'W, 3 Nov. 1996, M«6
Mass 8495 (EAP).

>h ;.. Ill ■.■.'! :ii:i
■I;,-, l-n..-,, '

WCSU); Apiacas, Apiacas River,

:■

55°59'43.3"W, 16 Sep. 2007, Bove & Philbrick

;■■

1 ,„.

I 1 I ' II 'I 1 i i

WCSU); Keyserberg N . 56°29'1.2"W, 15

6145 (BBS, WCSU); Poeloegoedoe,

:■!•;■■;■.■;■,!. : ■ . ■ ■■. .

/.,,.,,, ,/ .-/. .

(CAR, WCSU).

Weddellina squamulosa Tul. BB

^ i ' '

:
:
Cachoeira dos Papagaio, 9°19'11.9"S, 57°4'18.8"W, 21 Sep.

?■"..;■. .. >'/:■■.■■ • ;

.1"S, 60°44'11"\V. 25 Sop. 2007. A/o/y. ,

;■■

ar. 1978, Santos et al. 280 (RB); Fori

:

" ■■.;■:: :ii )

Species recognized by Royen (1951. h each occurs, number

secies, and source of

glaziovii (Warm.) P. R03

. longifolia CM.) P. Royen

(1993)

Werkhoven & Peelers
(1993), Velasquez
(1994), Berry (2004)

parvifolia P. Royen
peruviana (Wedd.) Engl.
platystigma P. Royen

Country 1 Ik

Kr. Gu., Guy., > 20 >

elmell (1969),

elasquez (1994), Berr>

(2004)
chnell (1969),

Werkhoven & Peelers

(1993)

.) P. Royen

C. monandra Tul. & Wedd.
C. multipartita Tul. & Wedd

t al. (2009)
t al. (2009)

-»/// C. T. Philbrick,
Movelo & lrgang

Philbrick & Novelo

itifolia P. Royen
nanii (Engl.) P. Royer

Endemism in Neotropical Podostemaceae

Counlry 1 Roye

iuy. 2 (2)

Lophogyne arculifera

sp.A]
Lophogyne sp. A

M. cheiriferum P. Royer

M. cubanum C. Wright
M. elegans P. Royen [ St

Schnell (1969),

foeniculaceum]
minutiflorum Engl.* [se

oxycarpum Till, [see M.
jHwtf/um P. Royen [see
[see M. foeniculaceum]

M. irichophorum P. Koyei

urger ( i) \ovelo e

al. (2009)
urger ( i) \ovelo e

al. (2009)
erger (1983), Novelo e

JNoveloelal. (2009)

Burger (1983), Novelo &

Philbrick (1997),

Novelo el al. (2009)

Velasquez (1994), Berry

(2004)

scored by Leon (2006)

LC

Burger (1983), Novelo &

Philbrick (1997)

Philbrick (1997)

Country 1 Royerr

Podostemum weddellianum]
'onostylis capillacea Tul.

Schnell (1969),

Velasquez (1994),

3 hnell (1969),

Werkhoven & Peelers

(1994), Berry (2004),
Appendix 1

LC Philbrick & I

entatum P. Royen

Philbrick & Novelo

:kl.)Wedd. Br.

n.a. Philbri<

n.a. Philbric

(2004)
LC Philbric

(2004)
CK Hlb(iii) Philbrick & Novelo

urrenl 2 IUW

Philbrick & Novelc
arm. subsp. rutifoliu

(Liebm.) Novelo & C. T. 1
saldanhanum (Warm.)

applanata

brassicifolic

carinata P.

(2004)
Philbrick & Novelo

{. g,i)aneims P. Rcnei

R. nitelloides (Wedd.)
A «o/h/« P. Royen

! cK PCC

Jasquc/

Burger (1983), Cusset &
Cussel (1988),
Velasquez (1994),
Novelo & Philbrick
(1997), Berry (2004)

Werkhoven & Peeters

Appendix 1

V. Bittrich, pers. comm.

Tur (1975, 1997)

iations: Ar., Argentina; Be., Belize; B< Rica; Cu., Cuba; Do.,

.,::: ill.:- y : \ ■

! --ni.-n-,- : - :',„, ,,,.- I ;

Endemism in Neotropical Podostemaceae

1

Al.,W!!l!!!li!ili

1111 11 Ji If 6* l|

111111 11111111111111111

illtut

JJJJJJllHit!!

Hli

1 1 I lj s.

jitUi

1 § : : I I 1 1 I I I I

ilttitl,

JflllllllillllJIi

5 ^ ^ a, a H a H a,ci,a,a,a,a,a,&c/)

lli!ifl„hiiitl1 ,iJ{l "

I

If

illlif
_ 1111:

..-Mi

IJliiJjillJiiiJI

HONDURODENDRON,
A NEW MONOTYPIC GENUS
OF APTANDRACEAE
FROM HONDURAS 1

[his" genus in a clade with Aptandra
Miers, Harmandia unochUon Benth., and Ongokea Pierre in the family Aptandracea.

■ A-..-,' ,■ .

Ml. Whitef. & I). Kelly es un arbol dioico, que se distingue porlas

: : . /,:;/,■■,■:■ '■1|.. .:

.. , Jraceae Miers.

An ,,;,nh: \plut.d

i liionliiV;

<» .1.1..-. ■ ■::■ ri;;

Compared with other Central Americ,

: ,". < i li i-

■■:. !■-. ill!, i ■/.
.'■■■■ li I- 1 i ■ ■ ■■- ■■■',;•.-.■■'■!■»/■:■ ; i : l>. in

II: ',!-: :•;!:> :', .. II II.- pll.ili i . :

lonal field observa-

three calves. IN

ir:,h).r:,.v: M II I I . . . .■. ' : II'. II ,■■!.■!,. 'I

..■,.■■

mi Hondurena de Desarrollo Forestal (COHDEFOR)
and Us successor organization n I. We gratefully acknowledge the assistance of our

, ' ' . ' ■■■:'.' ■■.!:!;■■■.! ill.

• manuscript.

Ill I II : i ■

■". I
"Department of Botany, The Natural History Museum, Cromwell Roa United Kingdom.

■■]>.■■,. .;rl.., ..i :.i . I.:,'.. I-I.:.- '

7/2009040

ri Bot. Gard. 97: 457-467. Published on 10 October 2010.

silica gel-dried leal

Materials and Mei

The specimens us<
in Table 1. Samples were tal

i •

lied Biosystems,

for nuclear sm

reported in Rogers et al. (2008). Eight in

in the present study, whereas th<
reported l>y Malecot and Xickrent (2008). The

' '!■■;■■.

•ts" at <http://

data set using PAUP* 4.0bl0 (Swofford, 2002). Nodal
support was determined using MP bootstra

reversible (GTR + G + I) i

;

'. i ■ \: ■ ;■,. I v.c
i - ! ■ •

11111 111 11

IIIIS III II
lllll ill II

lllll 111
o§ | s| 1 g §
lllll III

lllll III I I

i ill ? niit

illairin°i

and disk, petals

ivr,H-,r;l. .;■,!■:' '

■'■ ■ !v;c:

slightly ovate to oblong, 6.5-12.

5X 1.5-4.6 cm, acute

to acuminate at apex, acute to

attenuate and slightly

/■-I '..., ' 1 I

(lecunvnt at l),i

ntire, flat to slightly

. ■ , '.:,,|: ■; ■■ ii: ■: ■

revolute ul.en dried, midnen

e flat to deeply im-

Kelly, July 2008). — B. Lon

courtesy J. Kolhy, Jul

' ■; '.!i:'.:'M!

1 ■■"■■:.■■>■; ■'■>■.'[ '.•

" ' • .■ ,I'.W. ■!■• I: ■ I i-> ::.|:

. — B. Oblique to near:

icels 1-2

mm, sparsely

i. 0.5 mm

, the

i, ovate, (

.•a. I X 0.8 run

lumber t>

o and opposite

0.6-0.8 mm,

e, ca. 0.3 mm

mesocolpium wit! urn (Fig. 4); disk

enter of fully opened male flc

flowers (only a few open flowers

in bud, ea. 2.5 X 2.5 mm, pedicels

■ a. 1 mm tall, densely

just inside the rim, 4 or 5(6), deltate, ca. 1.5 X 0.8-

I "i' i,

ili;. :u him III ! ai In I w 'ill a ill in

i th 2 ovules pendant near its tip

obovoid, 15-18 X 15-20 mm. each completely

' i:t. . ; lll.''l i
I ' ■■■■ i '. I il!

10-13 mm tall, ca. 1 mm th

.■ ' - . ' ■• 'I! I'M 'Mil

■ional El Cusuco,

' >;!,■'.- , ■■< J "

:: ., :v . ■ ,.,,

I i il I .

. . . . . ; ....
■ ■■ |Ml I

III I ''ill WMi I I II I II II ill 111 ! II ' II I
I " II

>H 3.9 to 4.5) over siliceoi

; ,:;■ ' .••;:■■; :■;!

, I i ,

III i 'I I II \ I II I I III II i I i I II III Ml Ml ill III i

jh a total of 19
1 (Figs. 5, 6). The gender distri-
bution is notabll

appearance, whereas female
II y on larger trees
(4-10 m tall).

IUCN Red List adegory. The species is known

i i a ■ ii'ih

mountain range — a forested area largely surrounded

by agriculture lands. Some logging and grazing by

I i ' i i I i II

• I i '! I | i ' j nt of \00 that falls outside

: . ■ " oi

Working Group, 2008). In terms of our current

:

I , I"

Phenology. Flowers were collected in July and

I'-i'ii'! I

I In ; i . '

i '' l n

M. Ramirez & R. Alvarenga,

in

for dispcwil l,N M-rd-ll.. .1

ramp (28 July 2008). This supports the

I I- III': I!

2-3.9 4-5.9 6-7.9 8-9.9
Height range (m)

P. Cortes (pers. comm.).

Paralypes. HONDURAS. Cortes: Parque Pvaeional Kl

:

Hot 7. trail K of

:

..■ ;■■'/■.■■:;■/;

:

; .■:',',■ ; . ■' . ■ ' . • : : '

; 90 (TEFH).

alyses clearly r

010). Given the

:■. !<■( :,•:',;'!:: i . :

II I |i I i

;

' <■■ '■'■:

(Malecot et al., 2004). A 2-ce

' " ' i: ,h',:. ■■■■■■■

H Female (all fruiting)

| Male

la

.1

■ ■

0-1.9 2-3.9 4-5.9 6-7.9 8-9.9 10-11.9

Diameter at breast height range (cm)

ombined area 600

amp (altitude ca. 1340 m).

llf.K :.V|:.' !■' ; ■■■(:

these genera. However, all five genera in the Aptai
the greatly accres

data show. ho\\<

-

■ ,'i'V. II ;■■::■ I

Aptandra, Ongokea,
linal filaments conn,

annulus by their thick c

': '. " ! I 111 ill

iurodendron are free; however,

The pollen in the Aptandra clade is also quite

icking elaborate
The phylogenetic tree (Fig. 1) also provides

The family Aptandraceae is now constituted as

• : . • < '.n:-.:'i; '. .

(three species in i ind one in tropical

of the Aptandra

leaves; stamens i iposite the petals;

v. I! I ;ir. :;v

Photographs of the taxa discussed above are

Bell, A. I). 1991. Plant 1

■• : :: " I:.'.,.

ill III I I

lS ing PA UP* (Swofford,

3 re used to assess the

degree of genetic diffe

• :i( . [■<■■:

Criteria, Vers. 7.0. Prepared by the Standards and
Petitions Working Group of the IUCN SSC Biodiversity
Assessments Sub-CommiUee in \ugusl 200!!.
dabberley, D. J. 2008. Mabberley's Plant-Book:

II ' hi! I I,

! Inivorsity Press, Cambridge.

Bot. 33: 97-106.

, G. E. Schatz & J. Bosser. 2003. Revision

du genre Phanerodiscm Cavaco (Olaeacrar) a Mada»as-
. . . :■:;.
.. i i
Lobreau-Callen. 2004. A morphological cladistic analysis

oma de Ho

C. H.

1.

uas: Kspen

, D. L., V.

.ell & .). P. Der.
ion of Sanlalales

..■■■■'■

and Pilgerina: Two new arborescent gen

!-,:„>: M.-.-l- ■
II II II « ,

Spermat. 10: 1-29.

!'.'; -

Planls, 2nd cd. Springer-Yerlag, Berlin.

Hi , II I i

Guatemala. Fieldiana, Bot. 24(13): 1-266.

sity of Texas at Austin,

www. mbgpr ess . org

Forests of Peru Paid I. 1.

Garcia-Villacorta, Nigel C. A. Pitman, Italo Mesones & Steven W. Kembel 283

A Generic Classification of the Danthonioideae (Poaceae) H. Peter Under,

Marcelo Baeza, Nigel P. Barker, Chloe Galley, Aelys M. Humphreys, Kelvin M. Lloyd,
David A. Orlovich, i, Neville Walsh & G. Anthony Verboom 306

Revision Taxonomu a de ld> Especies del Genero Verbena (Verbenaceae). II: Serie Verbena

Nataly O'Leary, Maria Ema Mulgura & Osvaldo Morrone 365

Endemism in Neotropical Podostemaceae C. Thorn u:

Claudia P. Bove & Hannah I. Stevens 425

II.. Kelly 157

id I) S. A. Grahai
Taciana Ca\ alcanli.

of the
Missouri
Botanical
Garden

01(H!

Volume 97
Number

' 3 Early Cretaceous, evident in thr<

from 12i mill ion years ago (Ma) to ca. 90 Ma. During this In d in different ways

35-million-year interval there were significant shifts in l»

■■■■■■:. " '

later Jurassic pollir

ii i

nectar feedin:

Ii i, :,

i i , i ill I In i i

i

, , ., i,ii I i i

ferns, sphenopsids

■<■ lishment of the long-proboscid pollination mode is

lr. < llo 'I'll". ; :!!■:■. i.. I'; . ■' ::i' ;

i (<< I I! ill

• ' ' .

ore prominent roles

ii slxle and its

(caddisflies), and among

■ .,. I! ' :.

f Mid Mesozoic Seed Plants

\l--iW • ; :,: ■

h I 1 I" III 111

l'A',1 HI-
evidence needed for recognition of a particuli

■ I; . ;.;■;! ,:,«'. n
■■■;.. Ill-' ! l.»V. i
!... il in l.l

ira, 2002a).

. Decipher™

i II i In

|.....' .'ill r,-. - I; : ' .

'

' I I

extinct or have survived to the;

Seven types of evidence are used to infer the

. ii> ; . ; i'

-* Thk Lnskcts

2002a). First are

II

■ • ;.i si'. •. ■■'.

1: Novokshonov, 1998; Ren,
n. 2000: Borrell & Krenn,

I. L and equally

" •' •

ii i

II I i I | ' I ' 1 1 1 1 I i

.M!,:.,i.:'. f . ; | i!

et ah, 1994; Zeii

2004; Hu et ah, 2008). Fourth is the occurrence of

.

et ah, 1993; ha

weaker source of evidence, dispersed copro

ill ill II | 'Mil

phage (Harris, 1945; Crepet,

l-'-- : .. !'- I ■

ah, 2002; Hu et ah, 2008). Sixth, related p

II 'ill

■ id ■ in; ii .."

• -rfr ."•: :■...

e the first distinctive group

i' I .. in
nation. Characterized by biting

1961). The ancestral condition in
, liich extends to the

mdeira et ah, 198;"

capsule. The more

eages of Orthopteroi
:ives), Blattodea, Psoi

' I , I I ' ,

(ft

E

CD

CL

o

c

03

to

CO

>i

g

CD

C

o

u

a>

C £ W

£ Q.

Q.

sjooipne

eeeoeiqes t

S9|B||AqdoiBjeo

s;ooouo^m

seiejedid

s9|e||aueo

se|ejne-|

S8|e!|0u6eiA|
8eaoeqiuBJO|L|o

S9|BA9||Bqoj;snv

aeaoeiieiepAH

S9|B9Bl|dluAN
9B90B||9JOqillV

seiBjuo^Aeo
S9|Bj!U9uuag

S9|B|AX0JU9d
S9|BpU9jd0SS0|9

S9|B}9U9

lt sp!OSS9Jdno„

9B90B!pid9|0J!9M0

S9|BU!d

S9|B|Z)|0A
S9|BjL|0Bq9-l

S9|Bi!epjoo
S9jAqdo6>)U!6 J9140

O S9|BI>1SM0UB>19Z0

S9|Bo6>|U!9

to

Q>

S9|BUJJ9dS0;sAj00

eiunjn \/

CO

CO

2 S0|BLUJ9dSB)|9d

S9|BPB0A0

0)

<0

Q h-

LU
LU <

<0

Q.

609N

aud6od|ec]

OIOZON30

I

Sn093B18JQ

DlSSBJnp

oisseux

oiozosaw
1

10

LO

T
O

ueiwj^cj

U U9cj

jddjSSjSSiiAj

oiozoaivd

1

CM

CM

CO

yi .•!■■.;; -I:.:'.

ill J', ill li

! of pollen into a

I . :■■. ■ ■;! ■'! . ■ H : ' ':■: u] \ ■ ]Ch. ' :"' v ; I

II , '

. ■■ ■

2002). Although palynophagy is an ancient feeding ker & Baker, 1979).

.. .. i , ; i

.-•Is in some fluid -

' | i 'i

Jurassic (Arnol'di et al., 1977; Hunt et al., 2007). lid butterflies) of the Lepidoptera (Holloway, 1976;

in a nectar diet.

Peng, 1984), and spoonwing

ii \ and are required
bert, 1985; Haslett,

1980; Caldas et eira, 2006b). A 1989a; Roulston & Cane, 2000).

'.::■'::■.

catchment structiu ns syn, 2002). Modern Xyelidae feed mostly on gymn

■ • i IJunlick. I ( »()l
(Schicha, 1967) Jil\ asymmetrical ar

e eurh phase

Cheirolepidiaceae) (L;

(10) Paleorosa similkameensis (Rosaceae) (Stewart & Rothwell, 1993); and (11) Vanilla planifolia Andrews (Orchi(

?8

5 2

en

E Q-

Q.

ejejdoipui

<D

O

o

a'

ejessoio

BJ8;d009|A| J3LJ10

bep!L)oAsdo|9jneuv

eJ9}deuoi|d!S

o

2

Q

«

£
o

o

ejneuoLuajg
Bappiisy

83p!0UU)S8LU3rsJ

etidjoaioueqei

8ep|6eL|do|Ax

BL|dJOLUOALUO!}eJJS

a

BJ eoo t8 u,eu ! ,p^PM^j gfe

ej8jd|sd9Jis

BJ9}dOU8UUAH
BJ8;d08|0Q

0> 1
"B 1

o

o 1

o

si

■Q

c I

o

o 1

■ ^H

Ql

m 1

O)

c 1

o

"5 1

- 1

o. 1

o

<d

eepiodsiiUBi^j

eapioBAjsjdomoQ

B8p!0|Aiuso

B9P!0J9^d0UJ8N

B3piOJU03|9LUjA[/\J

B9pi0!U0LB|

BJ9ido|e69[A|
BJ9;do!P!qdey

B9p0JlA|9SS0|0

2

0)

O

£
Q.

BJ9idouBsAgi

Bja^diiusH
Bja^deji^qd

ejajdooosd

B9p0Jn9U0|BQ

2

0)

BJ9;doq^io

E9p01BLUSBgd

BJ9idoAp!Q
BJa^doiqujg

eapo)eujseL|do]ue^

B9pouB|qo||/uo

o

CD

o

0.

CO

°o

>

o

LU

^

^<9

i

I i

ii '. i 'I i- H

lie evidence for this feeding Diptera, Lepidoptera. and Hymenopti

il i n .

-■■ ■■ ■■■ ;:■..

some extinct line;.. • itli jdult ^hn h aie the pie-eminent haustellate < lades. \ anous

|.i,. ui 1,11 1! ii. ii- iimiiil ■ labial, maxillary, and often

.;
1967). Another hole -> ; <-is or a label lum,

.

vith pollen-gnu

):">). I'iercer-and-
obs.). The basalmc <urkn* |>Ui> a minor role; examples are some

the archostematan Cupedidae (Hunt ct m

. . i | , , ,,

parts (Hornschemeyer et al., 20-

- Lhe labral > maxil "
have mortar-and-pesi •">'> combine to

.in the glossate

but do not use pollen-crushing mouthparts. Lepidoptera a i oleoptera, or sutured

labial palps, v. i ional elements, as in

:

' ' '"".' •: '.', ,-|. !■■■,.■. ; ■.,!, ■:■■■

:i.:i . J, :l, ! , ■:,! , i .ill,,;,:. .! .:■!.:'■.! :,■-:!, I i'i: '. 1 1 ' ■ '

various sources in Lj

'hi i ; "■

uptake of fluids and particulate pollen (Schremmer. the esophagi ga & Broce, 1986;

1961; Elzinga & Broce, 1986: Jervis el al.. I99:k ill labella are often

Faucheux, 1999; K rous (Kevan & Baker. 1983: Larson et al,

! :ii ■ in!-;: i I-,- ' . ' ■■ ■ is: ! I :■:•:,: ■: :■ I IC

labellae of extinct

2009). There may be a second salivary pump formed of imbibe suiface fluids, presu

I , ,' i

or other means of (II I'lKRCINC AND SUCKING

terminus. Long-pro . cur in true

lineages, two extinct lacewing line. h J

" ■ "

•: Mi 'i.:-V. 1 I,m:'.; .V. ' ? ' ■' : I I ■: " I

IJ III 1 I i I I

(Boggs et al., 1981; Eberhard et al., 2009). l^or^wrT^Xl^tl^ ZZulZXt^TlZ

I' .il

i i nii-i

. . . ■ ■

ii ' ' .'in ■■

. lymph in vertebrates or consul

i • ■ V i i ■ i other piercer-and-suckers arc
•ii

II i I i I i ' I il.

1 region, e.g., the dis

Permian noeggerathialei

labellum of flies (Peterson, 1916: Elzinga & Broce,

:

' ' ' ' i,,, :-, , ■■

, I II II II,

;,,:!|.-|. in ir.r ,] > T; I' :'l! ..;

■ i ! I ' 1 1 1 i i i '

■ ■ ■

m 1 , i ,i

III Mill I. I II "I II I,

toed on pollen but instead cover

. ■■ tin- o ■■■.[, ■■ I.

I iiiation for the host plant. result in poll 1997). The domi-

r I:'; ■ i,

I , li '• ii

Nepi et al., 2009).
largely pollinated by mandibulate 2, Third is protection of ihe ovulate pari of the

destructive feeding

!''-!'

similarly pollinated (Gottsberger, 1988: Bernhardt, ovule of anj ipule of fCaytonia

2000). Early angios] (Spechl & Bartlett, 2009), if reduced to a single

of ovulate tissues is

ii from .in outer wall formed

)()»). In the case of

xtraoMilar structures, including
implicated in the

tude in size (cf. Tin

■'.' mmmmm "■:*;■] :.■•■..').
: •' .. •'

Other mandibular il, type of plant-host

Mi ,'■;. .;■,. .'.:, i ,,,,; , ■.■ .[■■

feeders. Other veer

Orthoptera, and Trichoptera (Porsch, 1958). ductive tissue such as ovules and p lie He ell I le

ll'ou |<<i

ill '

,1' M III |i I, | | ,||

I ' ill. Mill' J II !l il II | | | l|

■:>.;■•;■•■>. .■,; ;<m. !,■■,■ ; ..■,.■:

can strobili, many of
\ in reproductively

2006) favor use of

: ' ■■! m|,"

ii i |, " ' 1 1 " I II | i

lUM , M: ; : I'M, .

' "I I ' " "

;

)■

ic Laxa with cycad

II . |.,i

et al, 2009). The) inated by insects,

'

al., 2009). Ins

Yang et al, 1999; Kono & Tobe, 200

" ii, .'!..■■>:;:■ .
;i ;. II in i i ill I'mII ii I I,

Norstog & Fawcett, 1989; Crowson, 1991;

i

•I; 'IVrry et al..

. •■] il ;
a; •',-:■< l; in,' :;

as several beede
lineages have mid Mesozoie body-fossil

rstog, 1987).

•,le, ■ ■■'.ni..- a:'.; • i

' ' I-'!',!; . -:. h I ;■■::-

l.al.andeira el al., 2007a). Based on lli.

i;' .
....

i' id 1 1

'II' ' I. 'I

The Bennettitales are a moderately diverse group of

- i I

• I ' ■• ;t-

obilus not typicall)

iade presently associated v
- typically feed on sap flows
1982; Kirejtshuk, 1997).

mblage are three,

In contrast to mid Me;

ither gymnosperm clades pos-

•I -ii

I ii

' ' a:'. 'ai;

f Mid Mesozoic Seed Plants

ring in present-day plai

.: ■■^■'■n. ' < ii< ■■::■■■

ill ; :

• 'I

toy, 1993; Takaso & Owens,

: : .

II"' 1 1 1 1 1 I I 1 1 1 1

■n ■!!■. i i..' ■" •• ' mi..

ilin.ii.- i ;) :■

■ :■..- ■;-;• I h! ■ ■■! >■; ■■:■( ; ■■ -■-.■
| i. ' "

et al., 1990). This shift in pollination mode required five
• 'hangers in plant morphologx i- well as

diameter became wider to accommodate narrow-
diametered and prolonged insect proboscises in the
range of 0.1-0.7 mm diam. to ca. 5-11 mm in length
(Ren et al, 2009). During the Early Cretaceous,
us extended to 15 mm or longer,

' IN I ! I II , II

i i

in length from ca. 3 i
surrounded often bv

with an outer sclerified layer (Ren el al., 2009).
ructures bore surface entry points —

funnels, tubuli, elongate micropyles — that are not
homologous but represented convergent solutions

proboscid insects (Labandeira et al., 2007a; Ren et
al., 2009). Shorter tubular structures would afford
access to short-proboscid and other insects, similar

gnetaleans (Church, 191 1; van der Pijl, 1953; Bino
et al., 1984a, b; Marsh, 1987; Carafa et al., 1992;
Kato et al, 1995; Wetsching & Depisch, 1999).

includ-
ing extranuptial nectary secretions in ferns,
pollination drops in gymnosperms, and nectar

illi
suggest a third modification (Pacini et al., 2003;
Nepi et al., 2009). Fern nectaries produce watery,

drate and amino acid concentrations of pollen

<!:■'■■ »:■■ i i '■ >

sperms — conifers. Ginkgo L., cycads, and gneta-

pollinated chides (Labandeira et al., 2007a).

1 II II II III I III I II i I !li »;'. mi I, |,i

'Labandeira et al.,
2007a; Wagner et al., 2007; Nepi et al., 2009).
Lipid levels were not measured. Pollen drops
associated with wind pollination may be an

s high levels of ci

■ ; Hi - i 'I I I "I

winged insects (Baker & Baker, 1983; Gottsberger
et al., 1984; Erhardt & Baker, 1990; Tang, 1997;
Wackers, 2002).

t t tl Lomophil z 1

threads or pollenkitt (Nixon & Crepet, 1993; Zetter

another way of bun

achieve an efficient transportable size. Pollinia are

known in several angiosperm lineages, such as

leau et al., 2009), but do not occur

■ "I i '.I! .).'■:" .i; ii:

mentation and exine

mophily in modern angiosperms (Osborn et al.,

■ , ■

■■'■■ > ;<::'./.H :

■ hi.- ■'..(■■!!■.■ ..! s.:

iessed into a single,

, ,.; (li --i-: i 'I :■':.■ :! ' '

during the Late Triassic and Jurassic, hut

- 1 h"i .<■.-■ r ■■-. ■.-. ■- -i . . .

; : i , i ,,

. probable corystosperm seeds

.■"H.V,. Ih^-r;
\

in- i . in I I I

2009) or measu mil et al., 1995),

(Retallack & Dilcher, 1988), supporting wind pollina-

*■■: .in". ■. i h ■ .■.■:■

, i - i

'■:■■...:. O; ',!.«)■, i

1 i •• i I II !

tion. Pollen drops would r
pollen, which could he
suggesting ambiphilous p<

As members of a broad ginkgoopsid alliance.

hi i , i

rgans, and Lepto-

2007). The ovule: apparently had a

- I' il I '

1 i I i I i I!

'Ihi|

the terminal slit or

on the species. The presence of pollen drops

.i .i.:-|:,.-.-.--ii:-.

■ in. I; ■■ i ;.:' ' ,. sii ■■-,;

'. . . -ill . .IR,'< I.

Mill i I II i I!

Ill ill I' ill

hi! mi,

oiled, whose micropyles are o

f Mid Mesozoic Seed Plants

1 1 I 1 1 i i

. . :. I ;t; li;

J "I • ' : '<■■ ■(■ :'! ■"<

. : i ; :.| ..Cil.r

i .I-; i;

"ni'i ; ■■■;■!

i' ; il i' |

In i I ( ill i i '

long, somewhat longer than the 6-mm-long pipe.

i In'.
.■■■■■ .■.:■; i; ■■,: : lull ."';-

' I

' I i ■

: Id have provided a reward as

I i

. . ,[«•., :; ;; ■ i

isily found during die Early
((',.-, ,-■. I'.-vv,;

ceae, Gnetales ar< lino et al, 1984a,

b; Kato et ah. 1

ceae), and Gnetun i e a broad array of

inggnetaleanpoll
1978; Carala ,-t

ogy similar to the three extant
(Lloyd & Wells, 1992). Howev.

' . • - vi ;i ■■> i ■

;:ll\ i '.■■'(

achene base sun; bracteate papery

Caytoniales comprise a few genera of which

.
1940, 1957: \nderson et al

i the Late Triassic (Carnian) to the

(Crane, 1985; Doyle, 2008). The most notable

■, r.'.u ;i

; ; ■-,■..,;.-,■■,■.■
Retallack & Dilcher, 1988; Ren et ah. >

HI:. ;;■"' , : ;

i ate tissue that terminated in
a surface openinj e lip adjacent to

II i

connections between the micr<

' ■,■-■]' .1 I V; II III I
ill

, syndromes was eslab- The earliest Palynophagy occurred during

r.-ir •. in '»ol n ■ .

been challenged , u-r a single kind c

Fenster et al. ilh P^mt spore or ■

subsequent modification, a pollination

group of functionally rela

characters and 1 ,e h i \ ely are con- targeting of early land-plant hosts by microarthropods,

I 1 < , . i.

liMll! |j

h- obvious dLUibulcs (Baker & Bakei ica. Two lineages of insects, in particular the

Pellmyr & Thien, 1986; Haslett, 1989a; Thien el ma )<» , ^ tinct (,|a(l( * Palaeodictyopteroidea, included
al., 1990; Bergstrom et al, I" ie(l piercing-and-sucking beaks

s for consumption of spores (Labandeira, 2006b). Also,

; distant mandibulate ancestors of Orthoptera (grass-

2006). Recently, tl. m hopper and enckcts) consumed spoies and sporan-

syndromes, e.g., beetle-pollinate-: 1 <- uu tissues.

1 1"'.- 'i' ' l!' ■■ i : ■ . ' [

4 e dunng the Per

variables (see Ollei ran example). insect mouthp

■■■v. ; !.■:■!

i i I ;

■ ' II 1 1 I ' ■ '"

,|| M

A Brief History of Earlier Pollination- tfPotoniespori

RELATED Feeding gnetophytes (f n & Krassilov, 1996;

Krassilov el I al., 2009).

; , in II"

-

tion of surface flui

„i 'I . "l Hi
■■. T'-l .■!!■'. :," :

"

■..:.. I i"! II,; Mil.. ..Mil.'. ■ l,il" ."ill., " i

plant hosts.

f Mid Mesozoic Seed Plants

The early fossil record of feeding on the external

' 1 1

lining during the

I , >r ■ ■■

Lot preserved as insect gut contents, evidence

i ■■:■■:] IM.I li;
■ 'I I i I !

to Permian record for nectarivory sugges

II:-. (II lr ■■

•■•

surface fluids pi

i i I! i i II ii i, j

ugs & Kerp, 1999; Labandc

II I i

dan. One late Early Permian

.i ii' in I
listent with fluid

From the Early Triassic to Early Jurassic, there is

."' II li -, ■: . II <. I l.<>'
III I i ' in

ej 1 ti e t ctures rather than insect i

- ;! in ' 'run

,.',1;.

. ;. : ;'.; IN III'.!

into the late Early Cretaceous (Ren et al, 2009).

Pollination Modes During the Middle Jurassic to

ovulate anatomy and <

in certain cycad genera of Australia (Terry et al., 2004,

I " ' ";:■;'. I I 1

■.:■:'.:'. I n.-.'niU

III

tors of palynovory or

the insect rniwi

■ ■<<■'■<■ ■•■

, i i , i .,

I'M): ■!'■ ;'li;i,
'I /I .III

"' ■ ' - : . ■■:;■ aim:!

(Nagamitsu & Inoue, 1997), Paratropes

Costa Rica (Perry,
i platystylata Heba

Blattodea would be prime candidates

Unlike the Blattodea, there is a fossil record of

Orlovskaya, I '-J

and other pollen

' !

! I: :■<■,■!<■ | II I

(Micheneau et al., 2009).

There are no record

"I "" .

■■■■■.■■
dean, ^Phasmomimoides mini

laratau that may

i ii

: ■■■f l it . : ■ . ; :m: i ■■ ■ !-:'.

& Rasnitsyn, 1998). It is unci;

■ ■ . ■ ■ ■ i tt ■. sit i.".

• 'i !■ i:y.\ i !■.:■ >.:■

mouthparts that are convert n

:

■ I imada, 1997). These (

>t dnerse group ot large
Coleoptera. Pollen and
11 } II t t I

ous times within the order

. . :■ I !:<■; ill: ■'!.

teetles), Cleridae

III. 1 '.in > i ,.'!.: > il ,i II

lae (blister beetles), Scarabae-

.... ...... ....

■ ■ , . Vi; Mill.'! ill.-',

1 ,■ I

umnres. that currently polli-
ts once was considered the
ancestral syndrome for angios

'/'. '■' :

1985; Williamson & Schneider, 1994; Hirthe &

■•■..". . ': ' ■

(Azuma et al., al., 1999), and

. I i .I i In

of larger-sized beetle polli,

(Johnson & Nicholson, 2001).

.•••Mi:-, <:•-<' (">•■ adiili. I;«:ci.l.;::'. .' " ■ . '

(Crepet, 1974; Labandeira et al.,

talean strohili ,1;

<!.;.;: I i

pollinators. Beetle 002) and may have

' : ■■>,: ■■■-'.n

; ■ i i i I i "

had relatively .short proboscises compared to those of

i i . , , ^ - ''

akita & Kato, 2004).

strohili. Similar <

; ^^ ^ ■

. . . . . . . ... ...

hi I ..

in mil

in in i inn ,i .i in in ! ,i i

' ' ' !.:■■: HI r ,i!V-

■' '.iiirill I.",;-!:

involving vegetative and frequently woody tissues of

. "• . . . ■ ■ ■ .

1 1 li i ill

" j

roboscid insects of approxim

i"ii i |n II | i. i

(Dilcher, 1995; Crepet, 2008; Taylor el a
Thien et al., 2009) and may have develope

later deliquesces

;..■,:■:■. '..' "I; :::'.
I I i 1 il

colored, unscente

contrasts strong j )()t h lineages has

uhk: !,■(■;-!■ i ; ■::,- ; -j.-(..,. ■..,!;■■

pollinators of large, conspicuous flowers of the (Ervik & Knudsen, 2003; Gandolfo et ah, 2004).

'"■>< : '!"■

native options, as both floral types probably reflect
early angiosperm history. Nevertheless, small, non-

'iii. .....

and diverse in the initial pollinator colonization oi irtaceous (Crepet &

beetles (Thien, 1980; Thien et ah, 2009). ils from New Jersey,

' i i)i

I age were flies (!'

i_' ' ' i i in i

: ■ ■■ ' ' :

:i !:■<> ■ -- a i ■: :■ r ■

ineider & Jeter,

I -■ , ii

!■■■.;!.■ I ii; '

the musculature and valvular conl.ro]

■ I ' ii i

nd subsequent processing of

chemosensillae I 30; Barth, 1985;

Proctor et al..

Krenn, 2000: Borrell & Krenn, 200

from msec I pol \ Krenn, 2000;

.m-,1 has been the

so as to maximize joint and

of pollinator feeding and host-plan! i

dices, detection of host-plant
specificities, and ecological ai

latcs of proboscis length and floral tube depth (e.g.,
Whittall & Hodges, 2007; Pauw et al.. >

.■,.-, ■ .

■ I *■:■, I

.. . . . r-c 'ii i

rest of this section.
These recent investigations involve modern clades

Paleogene. For seed plants, i

I : .V,!. !i, '

Mesozoic, in turn succeeded by more derive

ira (S. Sepkoski, 1993) that

■I'M. 'Ill,': .:■ » ;■;

■ ■\ & Ponomarenko, 2002;

.>! i - in.

ary patterns (e.g., Crepet & Niklas, 2009).

There is an approximate 20-million-year overlap

!■,:-: ■■<■>■ li-
the early Aptian i e mid Cretaceous
■ ■nnvncesoftlie

■ ■■■ .'■ ■■-<■ '•</
.' ■

ime and space;

million years l.i

example, the study of how coevc

■■■■ ■■,. -. 1. ;i 1 " I : :: ■ III

mtually extirpated at the populati

35) or species (Armbrusler & T

ialdwin, 1998)

els. Finally, there is the detec

tion of insect

lination in the insect and seed pla

nt fossil record

Mouthpart elements from the maxillarv

correlates. Al-

../ . ■ ■ ..

f Mid Mesozoic Seed Plants

I I ! I;

(Rogers & Kaufman, 1997).

li . .)<>: ■■!;■ ' im
i' ''I i'

in the huge lepido

I-. ■-!■ -v. n

III hi, Ml

,^ I i in ;... in illi i •

Led clades within
the Coleoptera (R la & Pinto, 2001),

' ■ J I i ■ ■■ ' : ( n >■■■<■

Ml I!'", II

: provided in Table 1. Other fossil and

llMill i I ill

: mii i i ;r<.

1 .7-mm-long proboscis (Fig. 3). The pre-

■,.l ;'IH, 'I- HI li ;| !

i ' i I, ! i

concealed, reproductive organs (Mamay, 1976).

Extant adult Mecopte

ii I in i, i ■ ii

i ill I

capsule (Ileddergott, 1938). The labium, while

i :

■,

. ir, :IM ,i;i

often dead, food.

By contrast, the proboscis of the early derived

(Novokshonov. 19 2005; Ren et al,

:—'":. i

. , ■

165 Ma) and the mid Early
»ns of China. The

. i:, i: :•.; "./ i .■ ■■ ; n\

nil |,, | Li urn ii ill ii ii i I i ill i Mi

(Figs. 4-7). The km ally long and

.:"!■'■ ;■!] v.irt

i i in in iii 'I I ill i i i i ii ! ill I 1 III I

The proboscis is connected to

suction to assist the capillary-based uptal

second suction pump at the proboscis I:
Mesopsychidae (Ren et al., 2C

psychidae; taxa of the other families are palpless.
Relevant to the origin of the long-proboscid clade is

irly Mesozoic. Its

■ ill : ■ .im

a separate order, a sister-group to the Diple

leas), due to its

I J I liinilll l( i liil Ml i III ii, ^ ' ' ''

J pjpiipipiiijyipji!

I itlllll ! II i\\

J i i ilJJiil i i i III
i ii r'r'i i 1 i i

|i

I I I

ii I

t }! 1 III

,i.fl JjitjlU. » m,i
Jii I til- i iii

isPiPipiiifH

II } j] jl i! jl j! jl ft i

II (lip II

1 I! I
1 P! J

J n «i ti.Mi.iii i

ji pj iiipijiijiiiiiiipiiiiii

I i J I p 1 1 I 1 I I

i I

H i j i ji 1 1 i if i

f

"ji M PiH II

•1 iii II 1 i i I? i . i i

,! I i I I !i i

n i 1 1 1 hi ji , j , i

ill

1 I

Ii 1 I P P

JHlilljl

I I i

i
c i i

i i i

s 4
3 ! ii

I I I

ii I

I liil

Overlay drawing of a second specimen modified I: scale bar = 1

V

oboscis; scale bar = 1 mm. — C. Dr\

. . : ,.„■ ...,.,,., \:.< .. i.,.

"iil"ii.. ' . I hoh. : ' ..'■'.. .,:;.: ■■■::. .■,!.,: • ' ■ -,;,,■ V .::■:.::■ '.. ■..■;:!■■ :.:■.;

I ,. : i , • I ! :. '

.....'. ■ .. .■■■..

f Mid Mesozoic Seed Plants

■..'.. • I M i -

'•■■ ■■<>■ ■;: in ■ i. . ■ . . '.-■ :i .

,■ ' , ' i II ■ i -11 . i

. ■ ■ i :. Hi

■..,

.!»; Grimaldi &
i. r >). The Kalligrammatidae have been

M;'.!<r: ■■ ■ ,.;
:' li.h/; I.

. ■' i

■■.'■'.I:,. I. I.T. :■: ■

Mesozoic deposits in China that produced

■ mMM"

r:i !■;■. mi;;.

'■■i;'. ■■■■■ < ,i

.;.n|... '.,■!; r : : :

■>""!': . M'M. ■:.■ .:; I.

and occanona

■'■.!■

flies have cc

(Nagatomi &

®

horacic leg; bold, das

n to establish a comparison o

f Mid Mesozoic Seed Plants

Cretaceous Nemestrinidae (tanglevein flies; F

' ' ', ,:■■[■>■■-■; >':

Apioceridae, and others (Figs. 2, 9) are first 1

as, as in the
1998; Ren, 1998a; Mazzarolo & Vm.

I la I'lrir',;. .'.

lostovski, 1998;
Ren, 1998l>; I i i nips of gymno-

; ...'; ' i ■. ■■■ I il ;■ ' •: '

Constituting almost all

lopteran taxa, the

diverse cla

ide Glossata is

, paired gale;.!

joined into a

section and

»y a zipperlike

cis is almost

1 ( Mill II 1

bend ca.

one third of

(Ki istensen, 1984, 1997).

is derived

proboscis of kalligrammat

origin ol t

n proboscis occurred once

mid Early Ci

•etaceous. con; en

ation, based on t

Insect clades su<

1 1 ■

i :Thl '. .ti ,1
I ill

irgan, the haustorium, for uptake of surface

:■!;■ "I 'or. :

I

air ■<'■:■ ;' iii

natid Neuroptera,

which center on p ithers that involve

il i|< || III ii I I i <::;:■), I |. nil nil I ^ • .

i ill i

.■;< n
III In. i III

incompletely connected, suggesting a cliai

landschin, 1929; Barth, 1985;

::

!.. ,'.

proboscis shown in A at lcll. Sc.ilc lui .> mm. — C. 1! L

f Mid Mesozoic Seed Plants

though it is uncle ixa are associated

- . ill i I

> , . ' :,'!... I„ II !':;

I ' ' " l I II i i . i 1 1 1 ,

('■ Hi <> <!■■

,1 : ;!,.';■;

., nl ,i

in ' I; ■!'

abolous lineages.

'^ . <.:'."!'! ,:■. :■

ra — the Symphyta (sawflies)-

l>.. .:■!'■<]■'.;■ ■■■. ,

■■,'. I •'! ..'Ii )•■■■.■

I! I ii ■ i i
palpal structures (He

Several persistent themes characterize the evolu-

/ . 1 i i i I 1

Is. One remarkable aspect is

; . . i III 1 1

' I i ill

. ; '. ;■; -■. '

iini'" i .■!:■■

;
i i

in 1 I in ill I ii i 'in i i. s ; - : ' '

i i . i I! I i . i II II I i,

illted initially in

i .i i .ill

i return for more
then an expected

d neclar

■n ■!■. ■.!,-■ ; i:':

' 'II." .■'II ■.-■ ■: ■ II- . :■■■.:■■: >

II I I I

an) of -New Jersey (Grimal.li " .22). Reprinted with _

IX. I ,.i ■',,.'

;,<:,:. ■ ■■'■;;::l !M." ■ ■ ... , ■■■■ i :,.. • ,>,,>! .'!

a ers: The Biology oft

i University Press, Prin,

ii' ■'

mnosperms, a wide variety of

founded by cupulate
sue connecting each micropyle to a surface aperture
arris, 1933, 1940). For the bivalved I jt t I
llination was accomplished by anatropous ovules

" ■ I ■■' lif: ;■■•[ M
e exposed, opposite end of the ovulate organ

ratios (Labandeira et al., 2007a; Ren et al., 2009).

drops. For o\ i

These tubular structures originate from various

.i i 1 i , ',

; ■: 1 ,!'.,>.' I.-.T 1

'

...!::■:■■:■. •■; I

' ' . -',:!■: I ■■!■. ■■

1 1

"I I i I Ml

i III !i i; ill 'li|i i '

1994; Axsmith el a I

11 et ill., 2005) and
i i i i . i ■ - , . 1 1 : , . ,

anied by palps that are absent or significantly

,.■■. : .;(]■:■ :■.:■.

ilit: |.in

opening, and rewards such as se< mentioned above, suggesting

. ' . ' Ii I i in '

alionship may have
lis pollen that would have been transported demonstrated from

i in idem organisms

!;■ ■!!';■. ;,>!■::■■■... ■ ■■!■.■. -'■'■! ■:■', I! ,in-

Insect mouthparts

With the except i
imentation during in, Mesozoic that would fit into these tubes. Third, the pollen

ilh insect than wind
uthparts up to 1 2 >ollen grains from candidate ovulate

i seven organs pivsi
orders of insects. surfaces and in the

lutoi's. Finally, the

above in seed plant mules. Majoi. mid Mcsozok outcios^ with i uiwpt i ih

,: ' ■■■■:■.■ r*-:.

Pseudopolycentropodidae); (2) Diptera (Nemestrinidae,
Apioceridae, M\di ■ioniine Ta-

■■'.■■ . . .

•
ancestors of modern [urassic (165 Ma) to approxim

I h i i ii

'. ! '.ii:: ( ; .. ' ,!■■.■..

"■ !-;'!'" ,

(Table 1; Borrell cK nnnon, or extirpat-

uKenetal., ed (Figs. 1, 2). During die 20-million-year co-

I I

' ^. i . i

• ■ . ■. . ■ ■ ■ . ■ ■

Pattern 3: Origination

Major clades of insects had their origins as

il

Thien et al, 2003, 2009; Danforth et al., 2006;

Pattern 1: Extinction

Se\eidl major -eed plant lineages with pollinatoi

i Ii i I '.I'

1} 'I"

iii, nil

.'
I i - 1 i 1 1 )

,.;■■■.

i I; "I ■■,■■..!... .Ml- ' ■ '
'■ ' I: , I I' ' I ' .1 I! .

floricolous, long lineages, such as

■■ <■.:■;■;■(■: i- :'

l»> mi, i>M ;■ ■ ■

M :. i '' i =

! ' I I

optera, Diptera, and Lepidoj

lllli nil

I,- Il II i I',' 1 1 . Ill'

1,1 ,1 i I

■ii of angiosperms and then

Mi I" ' ill Hi, I I

biota (Crepet, 1983, 2008; Crepet & Friis, 1987;

' 'i , i

nted than earlier

I i i In

b) or the Midd of gymnosperm

Whether earlier,

sects and gymnosperms, have

:i I.''! "V.S,:- ' I ', !■■■■!.

understanding the

d Engel (2005). This has been

..r,i-;;'.iiir:n .■ ■

2001; Labandeira, 2005a, I.: I.alumdcini et al.,

;MIM ii;il i 1.IM

ical data. Any enlarged synthesis regardii

f Mid Mesozoic Seed Plants

ial insect taxa that also
;ts; (3) include knowl-

.,. y ' i i i.T n i I d i I

plant association as the reproduc-

i Lire of plant ovulate organs ;

i i ' 1 1 i i nil

■ i

i ii' 'I 1 1 ' ' i i i i . i

" :■( 'UMii'' (1

^ . ' , '.iii: .i;'Ci(i.|ir.:.|-

.":(,■!■■.. , '■

the Mesozoic history

? types of mid A

'US tubular devices in

different types of pollination is provided by Laba

. (2007a).

'
ill ,1, , I in

eeuse, 1978; Lloyd & Wells,

.' .. ' : ,..;■! I: :■ I--I '|[ )'■■ :■ ■•'

any credible, co- dlinators, and no

. .•<;!■.. I!:'.
■ "::,i.::i:,.v:r

, ;.-,<; Dik-her, 2000: 110'. . '

!■.,.■■:■: ii :■■! ;■,
| | i 1 1 1 I i i I '

' i '.III!! .Il.illlil

iiosperm flower remains to be seen. But it
gymnosperms, may provide a v.

ill 1

types of pollination and related

:i v. n

; organs with rewards typically being

significant drop-off in gymnosperm-

'

Ii; :■. I uri : II (HI

supported by their preangiosper-
and occasional knowledge of their

1 i.
berger, 1988; Gorelick, 2001; Laband-
2007a; Ren et al, 2009).

l»proximate 25-million-year lag after their

Kiltli. 1999: Crepet. 2000), initially with a

quently increasing to the elevated levels

(!,- "• I I"!' :"'

2002; Meyer, 2003; Engel, 2005a; Laband

:, '!",; -i ■■■

i" ■: I •-■"■"':■.. : •

i ' ■■ ill i " i ii

, . ' ' ■ ■■ :i II ;■■.<■(■ ..■;■,

from gymnosperm to angiosperm. An

is wedged between

>se; ..••:■!■.■■.;'

From the plant l<
throated flowers di

lineages of angio-pcims. which tend to he bowl-
shaped, open, and accessible to a variety of small I wore aneuretopsy-

ly by small nonpr

deira, 2005a). Th alcd flowers Ifiuis. czekanowskialeans. cheirolepidiaceous coni-

■■'•■ ■ <■ "He !■■■■■ '■ :' ' ■""■ '

I ,, V.MI «,

s found in deep-throated

■ ."',', ■;:■<>:<!;■!■■ c.

<■::■! n im. ;

i( ,| ii _ imumeu a . man. mn n >pi.( .*

s; ( 2 ) 111*" structure of ovulate organs and ^

modes undoubte

ium-sized beetle

■ '

-

Ill cMi;-;e , | i I, i i I In h'.

I !

their insect po

■■■..■■ •' ': .:"/.. ;■-■■'.■■■! :

between an insect pollinator and a host plant. proboscid insects became

roboscid insects.

f Mid Mesozoic Seed Plants

" i 1 1 1

■;.■■■
angiosperms ap-

during their e\ tilnLitn

• iter understand-

' il ! '■>: ■: ! J" II: I',',

unisexual or hi

' I i • i , 1 1

!:. 1 ■':;,;■
,' |

mode on angiosperms may be related to the

data support previous studies

:

.il." ■■'.■ .-I

over from gymnosperm to angiosj

ii ii i i i

was replaced by subsequent angiosperm

Vckerman, J. D. 2000. Abie

icted from the gut of the Early Pern
Tillyardembia (GrvUoblattida). Paleontol. J. 34: 575-579.

phylogenetieally basal eudicots using rbcL sequences and

^.rmbruster, W. S. & B.
specialized to generaliz

:

: I. :!:.: ,.:!■■ I :■!:

'.: 327-336.

Vi. I., ■.

,'. ; '. ■:. ii; il',. ! , :■ '

! , ,i

»: 402-409.

I 121-127.

Murker. K. J. & V l.chncr. 1<>72. The icsislancc ol

173 177.
Barth, F. G. 1985. Insects and Flowers: The Biolo (

ii .■,:-,. i ',!,-, !■■

!

V !'■-;.. '

222: 293-320.

;. & E. Baum. 2008. A longstanding

■^ ' .-,:,i ,. in

Trinidad, B.W.I. Trap. Agric, (Trinidad) 18: 151-156.

,,., :

in the dioecious g\mnosperm Ephedra aph\Ua Forsk.

C.A.Mey. I. Aspects of the,

■■, . I '■■■ ■

alte C.A. Mey.), with some notes on E. campylopoda C.A.
Mey. II. Pollination droplets, nectaries, and nectarial
secretion in Ephedra. Proc. Kon. Ned. Akad. Wetensch. C
87: 15-24.

284 289.

Meloidae (Coleoptera), with emphasis on the evolution of
phoresy. Syst. Entomol. 26: 33-72.

head and abdomen of the adult horsefly (Diptera:

,.■■: :; r -■ -

proboscid insects. Pp. 185-212 in A. Herrel, T. Speck &
JN. P. Roue (editors). Kcologv and IJiomechanics: A
Mechanical Approach lo the Ecolog\ ol Vnimals and

: " . . .■.■■•.■,■...■,■.*,■,,.■■

planl. Pliilo-,. T,an>.. N-i. Li .510: 77-108.

lull I II"

281-353.

(Hvmenopleia Apomla \vehdae) no Cielaceo da Bacia
do Araripe. Pp. 195-196 in Atas II Simposio Nacional de

Sociedade Brasileira de Geologia, Forlaleza.
CampbeU, D. R. 2008. Pollinator shifts and the origin and loss

'iiii

ici. 7: 51-62.
23: 83-93.

and the chemical i

Sexual PL Reprod. 5: 275-279.

L985. Phylogenetic £
716-793.

r i;
Grisethorpe Bed (Middle Jurassic) at Cayton Bay,
Wkshirc, L.k. Ah,
( lepet. \Y. L.

19: 1048-1056.

■'•>, : ' .
The reproductive biology of Cycadeoidea. Palaeontogra-
Palaophytol. 148: 144-169.

. 1983. The ,

ol the angiosperms. Pp. 20-50 in L. Real (editor),
'.'ess. New York.

& E. M. Fri:

pollination in angiosj

W. G. Chaloner & P. R. Crane (editors), The Origins of

Angiosperms and Their Biological Consequences. Cam-

CielaccoLis (Turonian) ol ^e\\ Jersey and implications

' , i.
Ser. B 241: 45-91.

■ess, London.

' ' I, ! MM II !

Zunino, X. Belles & M. Bias (editors), Advances in
Coleopterology. European Association of Coleopterology,

genus Dipseudopsis Walk. (Trichoplera). \nn. Mag. Nat.
I: 308-312.

I'.'i.

I ■ .,.!... 1 1 , II

, Ser. 8, 14: 2

first fossil mydaid fly. Castillo

27-42.

Deutsch. Bot. Ges. 34: 758-774.

G., R. L. Cabrera, M. Lara, L. Loya & P. Reyes-
I" 1 BeelJ poiiinai ion and floral thermogeni-

Sci. 160: 64-71.
Dilcher. I). L. 1979. Karly angiosperm reproduction: An
int rod Lie ton report. Rev. Palaeobot. Palynol. 27: 291-328.

(,. Stephenson (editor
tematics. Monogr. Sysl. Bot. Missouri Bot. Card. 53.

insect taxonomic dheisin. Pp. 325-331 in A. P.
Rasnitsyn & D. L. J. Quicke (editors), History of Insects.
Kluwer, Dordrecht.

Dobson, H. K. M

components by larvae ol the ill.

f Mid Mesozoic Seed Plants

,,■. ,!!- ! h<

19: 627-640.

■,•.-:;).■,• ' :■:■■ ' -'.■.: .■■■■■ :

47: 23-35.

pollination? I lu pollination biology ol Encephulartos
villosus (Zamiaceae). Amer. J. Bot. 84: 1398-1406.

! i

nidae). Trans. Ko\. Enlomol. Soc. London 106: 439-

\ i ■ v I

): 816-843.
. . ' . ■. ■. . .. . ' '

mechanism of the butterfly Pierls brassicae L. Philos.
] 239: 1-43.
,1 ' •

. A. L. Hikl, ( . L. Boggs & H. \\ . Krenn. 2000. Saliva

: I . ■.•!■:■.: ■■i-.'t !.:.:'■

-. \mcr. 102: I 1 05- I 1 08.
lilliputian world. Rev. Pa

,■ "iv .i ■->!;. <-.r

79: 150-209.

' . . . . ' ■

oldest definitive record of phorelic meloid Iriungulins

Zool. Cracov., Ser. B 48: 43-48.
. 2005b. ■

additional diet for a nectar feeding butterfly? PI. Syst.
Evol. 169: 111-121.

Faithful partners for 100 million years? Biol. J. Linn. Soc.
80: 539-543.

. ■ i .- -■ i.- ■-.:-.

eta). Bull. Soc.

^ . . ■■:■ I!.:!!:.

:
J. D. Thomson. 2004. Pollination syndromes and floral

Korsler. P. I.. P. J

in Queensland and northeast New South Wales, Australia.
Biotropica 26: 217-222.

earl) angiosperms. Proc. Natl. Acad. U.S.A. 101:
8056-8060.

'nana ill Israel. J. Amer.
Soc. Hort. Sci. 107: i

part of pollination mechanisms in conifers. Ann. Forest
Sci. 59: 345-357.

■ [

hoverflies (l)iptera, Svrphidae). Proc. Kov. Soc. London.
Ser. B, Biol. Sci. 224: 91-105.

■
of Helicon ius butteillies. Pioc. Nail. \< ad ll>A. W:
1403-1407.
.'I,., I! i

insect diversity in the tropics. Philos. Trans., Ser. B 354:
1811-1824.
i. i I I! •■

. 74: 407-427.

angiosperms. Taxon 37: 630-643.

. .... :■•:■> . .

and sugars in nectar, and their putative rwilutionarv

t. Nat., Ser. B,

1 des Dipleres. Mem. Muf

167-270.

in the science ol form. Paleobiologx 8: 1-15.

.I:

:

of weevils and related beetle families (Coleoptera,
Curculionoidea). Ada Zool. Craco\., Ser. B. 40(Suppl.
"Fossil Insects"): 129-138.

Card. 86: 373^06.

& J. Gumming. 1000. Braclncciai

.. . ■■ = :■» r u :>'.v.

' il i

8: 941-952.
, J .-F. Zha i P. Rasnitsyn. 2005.

1 I 1 ke pecies in Cretaceous amber. Insect Syst.
Evol. 36: 443-458.

(Orthoptera: Tettigoniidae) on pollen of flowers and their

38: 715-720.
1975. A in 1 1

Entomol. Rev. 54: 18-22.

lull, J. A., G. 11
2004. Pollination ecology of the Australian c\cad
I'cic). \ustral. J. Bol.
52: 333-343.

:"»: 177-200.

Gronland 85: 3-133, pis. 1-19.

—

114, pis. 4-5.

. 1935. The fossil flora from Scores] n

Greenland, part 2: Description of seed plant- incerlae

:

]. R. 1989a. Adult 1

Pollen and nectar ;

: 361-363.

MM I HI ',l

!' ■■!■.!. ■■: I'.- '•"■

(ecoloiiia 7!',: 433 442.
H. 1938. Kopf und Vorderdarm \

Hermsen, E. J., E. L. Taylor & T. N. T;

I- [nil 111 '

Hesse, M. 2000. Pollen wall stratification and pol
222: 1-17.

y Press, New York.

ill in I i. n
the northeastern Ivory Coast. PI. Biol. (Stuttgart) 5:

ool. 3: 339-350.
• :

• 263-270.
lu, S., D. L. Dilcher, D. M. Jarzen & D. W. Taylor. 20

mI .J

lunt, T., J. Bergsten, Z. Levkanicova. A Papadopoulou,

unci, D. Ahrens. M. Bal
M. S. Calerino. J. G6mez-Zurila, 1. Riliera. T.

anzen, D. H. 198(

611-612.

. K. A. & A. J. Ross. 1996. In-

63: 461-493.

Biol. J. Linn. Soc. 70: 121-146.

Dawah. 1993. Flower-visiting In hunenopleran parasil-

■ mi'

55: 551-558.

• lation. Spc/ialisierung.

, Z. 1962. Merkmale

oiden (Coleoptera). ,

-175.

M. & T. Inoue. 1994. The origin of insect j

-, & T. Nagamitsu. 1995. Pollinati

Kevan, P. G. & H.

f Mid Mesozoic Seed Plants

Kirk, W. D. J. J

Biodiversity in Insects. Mem. Mus. Natl. Hist. Nat. 173.

: i:'< •' V

Editions du Museum, Paris.

Taylor. 2005. Coprolites in a Middle Triassic cycad pollen

jj .;IJ:::mI::;!,: ' ' ' ' ' . '

cone: K\idence for insect pollination in earl\ c\cads?

'

,i;.,i! :.i '..:'.m..-,,m: ! { : ■

alimentary canal of honeybees (Apis mellifera L.). Canad.

Palaeobot. Palynol. 112: 51-78.

11316-1319.

' .. i. r,,;:, ' h'

adult Tabanidae (Diptera). Oecologia 46: 125-129.

:->:) L93.

:

. 1908. J I,

wind- or insect ,

280: 57-59.

;oic gnetophytes and

the first angiosperms. Paleontol. J. 43: 1272-1280.

precursors. Pp. 233-260 //, R. A. Gastaldo. \\ . A.

."- .' . I . .

DiMichele & R. D. White (editors), Phanerozoic Terres-

the intestine of Earl\ Cretaceous sawflies. Paleontol. J.

trial Ecosystems. Paleontol. Soc. Pap. 6.

1982(4): 80-95.

& . 1996. Folic

and animals. Pp. 26-74, 248-261 in C. M. Herrera & O.

insects: First evidence of pollinivory and its evolutionary
significance. Letham _
& . 1998. Plant remains from

es. Pp. 65-72 in Proceedings of the First International
Palaeoentomological Conference. Moscow, 1998. AMBA
Projects, Bratislava.

, V. V. Zherikhin & A. P. Kasnili

Classopollis in the guls ol Jurassic insects. Palaeontology
40: 1095-1101.

■'■• . '

li. .:-. : ; v. "!:',;

and Mesozoic. African Invert. 48: 3-11.
. 11. Teklc

ictaceous Res. 24: 149-
156.

og) of the galea in b,i

179-196.

\ :! ., . . . . ' '

suctorial proboscis in pollen wasps (Masarinae, Vespidae).
Arthropod Struct. Developm. 31: 103-120.

. II . :

1-40.

. Ir,--.
Popov. 2008. Flower visiting Neuroptera: Mouthparts and

Eur. J. Entomol. 105: 267-277.

I i I

pia 10: 141-191.
. 1997. Early evolution of the Lep

mm h< ill

& P. H. Kelley (editors), The Fossil Record of Predalion.
fecial Pap. 8.

Diptera and their associations with plants. Pp. 217-272 in
D. K. \eales & B. M. \\ iegmann (editors). The

New York.
. 20051,. I!

interpretations. Arthropod Syst. Phylogen. 64: 53-94.

: /.li:
v.

- .). Kvacck & M. 15. Vloslovski. 2007a. Pollination
>s. pollen, and insect pollination of Mesozoic gvmno-
:»6: 663-695.

:

■ct (and Other) Damage T\ pes on Compressed Plant
sils. \ei. 3.0 (Spun

■111-.' Ill ,01'i ,'!,;■."■

, 1994. Un

, Diptera, Tabanidae) da

lazzarolo. L. A,

species, genus and i'amil\ of ihe Stratiomyomorpha
(Diptera). Insect Sysl. Evol. 31: 91-102.

Kon. Ned. Akad. Wetensch. C 81: 300-326.

Meyer, H. W. 2003. The Fossils of Floris

Books, Washington, D.C.
Vlicheneau, C, S. D. Johnson & M. F. 1

Soc. 161: 1-19.

II). The Bees of the \W
University Press, Baltimore.
Vlichez, D., A. Nel, J.-j. Menier & P. Ra
oldest fossil of a melittid bee (Hymenc
from the early Eocene c

ue. 1998. Thrips c

idae) described by Ro

ach pollination and

Sarawak. Amer. J.

Soroida. 1985. The

il'.nlion of five related

. . ■ ' .

3pi, M., P. von Aderkas, R. Wagner, S. Mugnaini, A.
Coulter & E. Pacini. 2009. Nectar and pollination drops:
Bot. (Oxford)

fly, Drosophilaflavohuia L i I m >,j I II

' ■ ■• . . ! " .

species Ic v < I Pp 97-128 in J \\ Valentine (editor)

lion. Princeton Iniversilv Press, Princeton. P\ew Jersey.

J. PL Res. 109: .1

flowers of ericalean affinity. Amer. J. Bot. 80: 616-623.

pollination. Amer. Sci. 75: 270-279.

& P. K. S. Fawcell. 1989. Insecl-c\c

and its relation to [lie

two species of Zamia: Evolutional'} and ecological
considerations. Pp. 149-158 in B. S. Venkatachala, D.
L. Dilcher & II. K. Maheshwari (editors), Essays in
Evolutionary Plant Biology . Palaeobolanist II.

[ Conference on Cycad
iellenbosch.

-In i II i

Mesopsychidae, Pseudopolycenlropodidae, Billacidae,

•, ■ :: ■ ;,:■. ,
. 1998. New insects (lnsecta: Hypoperlida, Mischop-

terida, Jurinida) from the Lower Permian of the Middle
J. 32: 46-53.
& A. P. Rasnitsyn. 2000.

insects (Psocidea. Tshekardicephalidae) from Tshekarda

f Mid Mesozoic Seed Plants

(Lower Permian of ihe Middle Urals).

S284-S287.

Nozaki, T. & T. Shimada. 1997. Nectar feedi

dae) and its effect on their reproduclion. Pp. 379-386 in
R. W. Holzenthal & 0. S. Flint Jr. (editors), Proceedings of

Ihe Eighlh Inlernalional Symposium on Trichoptera. Ohio

ilionV Pp. 170-194 'in .)." A.

ii i. Thailand.
logic Time Scale. Cambridge University Press, Cambridge.

i Mi in-

(liar (Fipcnu-cuc) in Australia. Entomologist 115: 181-181.

<

pollination. Science 326: 808-809.

. i !
Cranmer, A. Kingston, C. I. Peter & J. Rotenbern . 2009.

, i 1 i
Bot. (Oxford) 103: 1471-1480.

PI. Sci. 90: 509

Entomol Exp Appl. 83: 21-30.

Paulas. 11. F. S

III

K., K. VI. Friis & P. K. ( ran

i (.In . ii |lil ,M .:;!' ! ^r-lc^cr^c

.11

101: 577-581.
Perry, I). K. 197! (Orlhoptera: Blatti-

dae): An outcrossing pollinator in a Neotropical wel forest

, ■■ : ,,!■■ .;,,.' i.ohilr li.aii: ;:.i

■ ..

Aquatic Insects 16: 177-187.

with notes on I

■..-,.:[... !'.■■■■;;
179-193.

404-412.

Oeslen. Ilol. Z. KM

„.^ , i ii ; .i

Kristensen (editor), Handbuch der Zoologie, Band IV

. lihi. '■■■ ■!; ,■■■

Pulleiflies). Vol. 1 (Exolulion, S N stematics. and liiogeog-

n,

m. Timber Press, Portland.

a Ling the origin of the Orchidaceae
from a fossil orchid with its pollinator. Nature 148:
1042-1045.

1977: 60-72.
. 2002. Si I

1781). Pp. 242-254 in A. P. Rasnitsyn & D. L. J. Quic

. Kluwer Academic Publish

U.S.S.R Acad. Sci.. t n

.':. . .. .
i

ienschaften 78: 280-282.

:

lies). Rev. Palaeobot. Palynol. 60: 7-24.

evidence for Jurassic angiosperm origins. Science 21

ellmyr, 0. & L. 1!

. 1998b. Late Jurassic Brachycera from northeast*

on 35: 76-85.

China (Insecla: Diptera). Acta Zoolax. Sin. 23: 65-83.

, C. C. Labandeira, J. A. Santiago-Blay, A.

of New Caledonian Winteraceae: Opportunistic shifts or

parallel radiation with their pollinators? PI. Syst. Evol.

173: 143-157.

pionlhes. science 326: 840-8,47 (+ 24 pp. suppoit

.1!" ( -.-.|. i ' " '

■;. .1. & D. L. Dilcher. 1988. Recom

>t. Card. 75:
1010-1057.

'!:. I'|:|lll .Til-.

diversity of flies (Diptera) Biodiversil) 3 3-27
13. 1985. Feeding mechanisms. Pp.

Physiology, Biochemistry and Pharmacology, Vol. 4.

Oxford.

Lis, P. S. & D. E. Sollis. 2004. The origin and diversi-
fication of angiosperms. Amer. J. Pol. 91: 1614-1626.
, S. F. Brockington, M.-J. Yoo, A. Piedrahita, M.

ihwelL G. 1977. Evidence for

nism in Paleozoic pteridosperms. Science

mlston, T. H. & J. H. Cane. 2000. Pollen nutritional

content and digestibility for animals. PL Syst. Evol. 222:

187-209.

, In I
D. D. Sokoloff. 2009. Nonfhm.

G. A. 1989. Pollen feeding in Alticinae
(CLrysomelidae). Entomography 6: 407-411.
■ >.,:■ = .-...

ications of two
Burmese amber (Lower Cr,

h..l I !i i. ii

116: 341-346.
Schedl, W. 1991. Morphologie, Anatomk
(editor), Hyi

n | n I! in I! 1 ii !i .1 , ii
ogie, Band IV (Arthropoda, Insecla), Teilband 31. Waller

dmlkg lb d b kllg

7(» 4:',:;.

■■ HI.' >;■>■

■ I- -, .11 ■■....,.■..■,.■,■..■.

" IK; '

Ml

1'ieren — inbesoiidere Inseklcn — an die Gewinnung von
Blumennahrung. Verh. Deutsch. Zool. Ges. 55: 375-401.
Schuster. J. C.

3 9: L 68-184.

Scientific and
Technical Education Publishing House, Shanghai.

, Q. Ji, 1). 1

I 1 i ■ Hi ii |

family. Science 296: 899-904.

I. Morphology and

' 7«> <>(>.

Amer. J. Hot. 83: 1175-1180.

a. 1941. Morphological study of the

II I III i
148: 165-174.

, " I.

12-14.
Taylor, K. E. SI

lurking there? Amer. J. Hot. 96: 237-251.

., I i , .,id

27: 329-355.

, G. M. Del Fueyo & E. L. Ta

Permineralized seed fern cupules from the Triassic of

, E. L. Ta) ). Paleobotany: The

I I III,! j , , , i

Int. J. Pl.Sci. 162: 12<:
, G. H. Waller, J. D. Donaldson, E. Snow.

f Mid Mesozoic Seed Plants

ropiea 12: 1-13.

, 0. IViimyr. I ,. Y. Yal

McPherson. 1990. Polysaccharide food-bodies as pollinator

list. Nat., B, Adansonia 2: 191-197.
, H. Azuma t e\v perspectives on

l: S225-S235.

, P. Bernha,

!■!» !' .-'■ < ^ •

biology of basal angiosperms (ANITA grade). Amer. J. Bot.

:ago Press, Chicago.
era-Planipennia Nemopt*

II j

..-: ..'.■'.

\hroma). Ann. liogor. 1: 77-99.
Vilesov. A. P. II nuplerans (Insecta:

tera (Insecta): Comparative morphology and phylogenetic

: !.; IV<r.

•ollinalors of Clusia a IT.
295-304.
'. 165-169.
Poulis, M. Nepi, E. Pacini & P. von Aderkas. 2007.

Oosperm >pecialio
, L. Chittka, M. V. Price. A. M. Williams

\aN„ii. J. ,K ('. V. Smcock. 1992. Bennettitales

I', ,;li I, .i I
pis. 1-23.

central Europe (Hymen<
senschaften 96: 703-712.

Celsching. W. & B. Depis.
of Welwitschia mirabilis
167-183.

Cretaceous to Recent. Science 289: 291-294.
Neerl. 29: 57-58.

structuie PI Snst. Evol. 8(Suppl.): S159-S173.

Plants. Oxford University Press, New York.

Illlii! lool iii ngeriaceae). Biotropica 34:

438-441.

.

. . •:•<>

:!:,!> '. ! .l:-;l '
■ ' ' " i! :i'-' ■ N ■! -^ - - ;>l

fossil onagraceous pollen grains. PL Sysl. Evol. 157: 1-7.

Ericaceae. Grana 35:

, ,,,<■ II II Li ■

Coleoplera: Chnsomeloidea) from Callovian-Oxfordian
in. Geobios 38: 865-871.

ASSEMBLING THE ANGIOSPERM Douglas E. Soltis, 1 Michael J. Moore, 2
TREE OF LIFE: PROGRESS AND J - Gordon Burleigh,' Charles D. Bell,"

FUTURE PROSPECTS

i '

i.' '-": i ' ■.•'■iHl- .,, ,:> . . .

radiations. During i

' ' ' ' •

I " !

mm ' i

genome sequencing via next-generation s<

i!,, ,11 U; v..

e it possible to pinpoint and

^ ' ,■■.;: i r ,'
: ■; . r ; 'l.l|.=: ; ■■'.

j i i ..

Earl) studies usin;

'.. i ■([,, ■ r ;

M

,l 12 i i i ill u. et al., 2006). A

illustrate the rapid progress in angiosperm

•st suggested that

■:. ' ■■sr. i ■■.■;'! :

,i, I,, .

advances in PCR technolog)

;

I Florida. Gainesville

e, Oberlin, Ohio 44074, U.S.A.

70148, U.S.A.

27 December 2010.

Despite the rapid progress of these

i ; I, I i
; the construction

I iii,

,i , i
San Diego, Call

duced a genomic perspective to phyloge-

- for deep transcriptome sequ<

, ■ ,

(e.g., de la Torre son & McMahon,

I

the next two years; G.K.Wong,
Principal lino iy of Alberta) as

well as the moii...

■ ■:!■! ■:■!

netic inference.
"c sampling of orthologous i

paralogs. Furthermore, the

& Vision, 2007;

■. ■ ; ; ill. ■.'■':■■ i 'II.H.:" ".i"

I I /

uia et al, 2009;
Burleigh et al., in press).

Perhaps the biggest impact of next-generation

upiete plastid genomes. The

k of gene duplication and reco-
il .i i i i i, . I I

now made complete plastid genome i

; .; :■,:■.-. ;■:!

2005; Jansen et al, 2005; Moore et al. 2

II. '.'!..' '

.;'. ... !■.!■ ; . ■ ;l|. ,!.:'.

(e.g., Moore et al., 2006, 2007; Cronn el a

With rapid technological advances, the cost of
sequencing a single plastid genome has drc

$150 for a complete plastid genome sequel

that employ com] data are readily

, III; ■.,■:■, ,

I III I

deep-level phylog arly studies that

"i; 'I i..' •:,■';:■.

-nivkin et al., 2003), and co

; hi III. i

ion within this new phylogenet

(2007). We :

gomorphy and ii

ate in the superastends, whor.

i Cantino et

al., 2007)

|»h\ and

s {Magnoliidae.

inthium and wood]

, ids ihan super-
plants other tli >wly evolving plastid

O.:--: \<. ■<:■■■:■<■■.

iv and inexpensive alternative to lull plastid genome
1 1 id 75% of all sequencing lor deep-level

^ . ' ;. ■ . . . ■■ '."•■■■. V; • ■■; :

III"

•■'.-•

eh successfully re-

i I i . i ■ • i

/ ,^ ■■:■■: ■:!■ i" i ■<■:■■, it'-: '

ceae-eudicots (Jansen et al, 2007; Moore et al, clades <

. . ' ilj..'. ■.•!;■. ';l:i

■ . i : ; .

I I.M.I

mae lineages, which ull les, and Picramniales.

i i i II

. ' : .

modern silversword alliance on the Hawaiian Islands cc e plastid genome

(Baldwin & Sanderson, 1998). anahses (a I

placement of Dille-

'■..■■!■; 'i. '"..Mil
; '.in- «» ,1

ill I" II li' ill "l

)f Pentapetalae 83 plastid genes (Moore et al., 2010) and IR sequence
(reviewed in Soli is <■ ■<■ Dilleniaceae as

,i.'. XI..
! :.*,")('■/,;.".. , .; Hi" ' '

of deep-level angio-

i from the nucleus

■."..'• :":■">!'■:;" i : .:■

" i i ■ i . i

_ .:. non-iecombin-

1 result in incongru-

■....'.■...''■

, ji
ii. i ii . i t j •:• '. - I-

'I 'I

■■ ■ :

angiosperms produced high

Doyle, 2001; Soltis et al., 2002; Sanderson et al.,
2004; Bell et al., 2005: Mag

onverged on estimates that are

I — ^to superrosids (Fig. 2B)

Ml.'' .:!;::■:■.: '• ' , , / .

2004; Bell et al., 2005: Mag,

al., 2010).

1 1 i i II ; ■• .-i i ii

ill! I 1

jnly the age

i ii'; T'r ■;■ 'i

■ ,ii I c ■:>[<)•

: ;

(BEAST) (Drummond & Rambaut, 2007), a relaxed
does not assume any correla-

' i il \< ii

In one set of

:

". ; ,'■' iir.-

Ml III

•■■ri,'.n ; c:

angiosperms (e.j ., 2004; Bell et

. I Vitaceae

1 — Mo remainder of tree (Fig. 2A)

t al., 2007 M e (

lie II el al. (2010) also obtained the

al, 2008).

139-109 Ma); Rosidae (132

The Rise of Angtosi'kkm-i>omin\tki> Foi;ests \nd

Associated Codi\ krsific ation E\ ents

• ... ■(■ ; » ..■ 1

years, perhaps as quickly as

■s of divergence

nr :■ h

radiations in the

■|V..t, . II..- "

complete |>U

i .<<

radiations thim.J.out the diversification of major

groups around 112-91 Ma (A

et al, 2001; Davies et al., 2004; Magallon & Castillo,
(2001) provided an estimate of 117-108 Ma (their

!<>..!<■ IM.. :; >
110 Ma.

, Betulaceae, Casuarina-

Malvales, Sapin and Myrtales.

;• provided elade I
.ngiosperm Phylogem ere eslimated using an

6 fossil constraints (see Bell el al, 2010).

Clade

Wikslrom el al. (2001)

BEAST

1

Angiospermae

158-179

183 (167-199)

Mesangiospermae

140 (128-140)

122 (108-138)

156 (146-168)

Pentapetalae

128 (120-135)

24

95-101

116 (108-121)

ition of other major herbivores,
et al, 2000). Diversification in mn.

i i II in II i I

ii I i" a

IN.": 'I'll

' ' ' ' ' ■ - ■ 'r ■(■

in :'.| ,■::.■,.:

■ . ' I ■:!' I II" III!'

| ,r . ii,!

largely represent
the rapid rise of angiosperm-

■ ■■'>:■ -i:---i

foundly shaped nrrent terrestrial

Routine Sequencing of Complete Nuclear Genomes
Next-generation sequencing has made it possible to

<i

, I, I III MM ' II

ra L. [Jaillon et al, 2007; Vela;

I, [Ming et al., 2008]).

;st be obtained via

One such phylogenetically pivotal angiosperm is

.. ., '..

date have been either

ling the nuclear genome sequence of

ah, 2008) in much the same \un as the nuclear

: ' l [.'III-.

genome sequences of other "basal angios

)ortant. Comparing the nuclear genomes of

■^ , ■>"■; .ii.il! ■...'■;!:'

. M| || m

'•'

i:.-.::v, , : i,-

. ■■:■:!.■... >:r«o:;;
For similar reasons, the nuclear genome of

l.:< ■■■.■).■! ; '.

tcr to all other

1 ■

ada'.ir, > :.■:!■

'■••■■'>''■ -.■■■■ .■■:■■■■.■:

A strong argument can also be made for sequencing
the genomes of taxa that are s

tins, for example,

ember of Gunne
nuclear genome si one represen-

Group III as a g,

nt biology.

The availability of DNA sequences from thousands
lie spectrum has

, , In; i, i

of species have become increasingly c

Smith et al., 2009). Establishing such a broad

only green plant; II have profound

*,.::.ir.Ki' en (■■.

'i!"!:iL'. !■■■;

i .;" i '. 1 ;;,;'.l;'"

I ' I

■. ■ ■ i .!,■;■ hi '
Donoghue, 2008) and have helped elucidate patterns

. • ;.::■■■.( :r,, III,
',i!:<;<;v '. ■.:■ ..:

et al., 2006; Proches et al, 2008). Several s

in a given geographic area (e.g..

■: .,!.. -:(.io i ..'i.

-
Donoghue, 2008); and a

j .." I i

' ' ' .:■' ■•; ;'■■! I.:

and Bayesian techniques to reconstruct character

agreement on a set of gene regions to be seq
all plants and/or genomic approaches tl

regions on a large pli

of ca. 13,000 (Smith et al., 2009) and ca. 19,000

(Burleigh, in prep.) plant sequences ha

i ! : i , : > '

Recently, the funding of the iPlant Tree of Life

'..! ,"lil'V .1
i ' I I i I "

I-. II 1 1. :■ II ^ ;; : I ' .ti II I ' |.:;l

will be to scale up and build these and other

The systematics community is now in position to
the infrastructure for reconstructing a com

the next two ye for all 500,000

i

M.iii ! i, ,1 , . I ill,

Gard. 85: 531-553.

and families of flowering plants. Hot. J. Linn. Soc. 141:

161: 105-121.

v 796-815.

Sci. U.S.A. 95:

:

c inference is a

3t result of the

and collaborative

5 ofpla

id computational

However, tools alt

beei

this grand

challenge successfully.

Only ca. 75,000

re now represented

ol. 19: 315-322.

vii ■:■

D. Beck, R. Grenyer, S. A. Price, R. A. Vos, J. L.
Giltleman & \. Plums. 2007. Hie delu\ed use of piesent-

v .:i:\

II ,11 1, II ,,„

2009. Phylogeny of the Carvophvllales sensu lato:

differenlialion in the core Caryophyllales. Int. J. PL Sci.
170: 627-643.
I'.urlei-h, .1. (;.. K. \\. Hiln cK I). K. Sollis.
phylogenies with incomplete ,1
taxon analysis of angiospenns. BMC Evol. Biol. 9: 61.

, 'VII.. , ■ ,
& T. J. Vision. 2010. Genome-scale phylogenetics:
Inferring the planl tree of life from 18,896 discordant
gene trees. Sysl. Biol, (in press).

Olmslead. D. E. Sollis, P. S. Soltis & M. J. Donoghue.
2007. Towards a phylogenetic nomenclature of Tracheo-

!■ ^ :.if,M. . .:.».■■ ' I

phylogenetic biology. Ecol. Lett. 12: 693-715.

-••004. Monocot relationship.:
Amer. J. Bol. 91: 1645 1655.

r> i' v. .,

B. D. Mishler, M. R. Duvall, R. A. Price, H. G. Hills, Y.-L.
Qiu, K. A. Kron, J. H. Retlig. E. Conli. J. D. Palmer. K. J.

: : .■■-■„ i , . ! -,,,

F. Wimpee, J. F. Smith, G. R. Furnier, S. H. Strauss, Q.-Y.
Xiang, G. M. Plunkett, P. S. Soltis, S. M. Swensen. S. F.
Williams, P. A. Gadek, C. J. Quinn, F. E. Eguiarte, E.
Golenbcrg, G. H. Fearn Jr., S. W. Graham, S. C. H.
Fanell. S. Da\ anandan & \. A. Albert. 1993. Phyloge-
netie relationships among seed plants based on rbcL
sequence data. \nn. Missouri 15ol. Gard. 80: 528-580.

, iVL. '.
Davies, Y. Pillon, G. Petersen, 0. Seberg, M. N. Tamura, C. B.
Asmussen, K. Hilu, T. Borsch, J. I. Davis, D. W. Stevenson, J.

C. Pires, T. J. Givnish, K. J. Sylsma, S. W. Graham, H. S. Rai
& M. A. McPherson. 2006. Multi-gene analyses oi monocol
relationships: A summary. Aliso 22: 63-75.

Crane, P. R. 1

Mockler. 2008. Multiplex sequencing of pla 11 j. 1 I

Kes. 36: el22.

E. Soltis & V. Savolainen. 2004. Darwin's abominable
mystery: Insights from a superlree of the angiosperms.
Proc. Natl. Acad. Sci. U.S.A. 101: 1904-1909.

■:.:„.<■ ■:■ i,

to systematics. Trends Ecol. Evol. 22: 34-41.

1 II , I , , |

n c. \i. (oiuzzj <x R II

... ■: !■;.
MurnaJ. K., S.-O. kolokotronis. K. k. Lee, I).

& R. DeSalle. 2009. The impact of outgroup choice and

genome-wide EST data. PFoS ONE 4: e5764.

176.

(Gramineae). Evolution 44: 1097-1108.
7: 214.

22:243-249.

■ ,i., .1 : In

D. P. Faith, A. Balmford, J. C. Manning, S. Proches, M. van

del Rank. G. Reeves. F \. J. Heddeison & \ . Sdu.Funen.
i potential ol floids in
■ 445: 757-760.

analysis of 73060 taxa corroborates major eukaryolic
groups. Clddislics 25: 211-230.

V. V., K. 1. Hirsch-Ernst, S. Wolfl & F. H.
Hell wig. 200:5. \nal\sis ol the Amborella trichopoda

phylogenomics: C

an one accurately in

fer a phylogenetic

Hughes, N.F. r iW

Cambridge Unive

Interndlional Kk < (

Project. 2005. The

ome. Nature 436:

793 800.

Jaillon, 0., J. M. Ai

e Characterization. 2(

X)7. The grapevine

suggests ancestral 1

phyla. Nature 440: 4

Jansen, R. K., F.

J. Herman, H. M.

uehl, J. R. McNeal, J

, H. Feebens-Mack

& F. Cui. 2005.

Methods for obtain

genome sequences. M

eth. Enzymol. 395:

348-384.

, Z. Cai, I

. Daniell, C. W.

dePamphilis, J. Feel::

singer-Bellian, R

. C. Haberle, A. I<

.. Hansen. T. W.

:e, R. Peery, J. R. Mel

leal, J. V. Kuehl &

'. Analysis of 81 gen

s relationships in

itterns. Proc. Natl.

104: 19369-19374.

Jian, S., P. S. Soltis,

M..J. Moore, K. Li, T.

Hendry, Y. Qiu, A. Dhingra, C. Bell &

Judd, W. S. & R. G.

Olmstead. 2004. A t

(eudicot) phyloge

netic relationships.

Amer. J. Bot. 91:

.'. Cladistics 15: 91-93.

Biol. 60: 261-277.

II, !, .,-...i'..,.-

H. Fourcdde, T. W. Chumley, J. F. Boore, R. K. Jdnsen &
C. W. dePamphilis. 2005. Identifying the basal dngio-
sperm node in chloroplast genome phylogenies: Sampling
one's way out of the Felsenstein zone. Molec. Biol. Eve"

& A. Caslillo. 2009. Angiosperm di

. :; i<>-365.

McMahon, M. M. & M. J. S

supermatrix analysis of GenBank sec

'nines. Sw. Biol. .15: 818-836.

■ ' " . ,,..,.;.,!

<•. Natl. Acad. Sci. U.S.A.

oore. M. J., A. 1

87: 4640^644.

Farmerie, K. M. Folia & D. F. Sollis. 2006. Rapid and

Zanis. \ . Saw.laincn. \\ . H. Halin. S. B. Hoot, M. F. Fay,

ol. 6: 17-30.

M. Axtell, S. M. Swensen, L. M. Prince, W. J. Kress, K. C.

■ : i

,i ' 1 'n,i

from a combined data set of 18S rDNA, rbcL and atpB

ships among basal angiJspeims. Pioc. Nad. \ea<L Set.

sequences. Bol. J. Linn. Sue. 133: 381-461.

I- .-■,:■■
2010. Phylogenetic analysis of 83 plastid genes further
resolves ihe earl\ diversification of eudicots. Proc. Natl.
Acad. Sci. U.S.A. 107: 4623-4628.

Croley, P. S. Soltis & D. E. Soltis. Phylogenetic analysis of

>ryer, K. M., H. Schneider, E. A. Zimmer & J. A.

studies. Trends PI. Sci. 7: 550-554.

Ml- i |

I I I"

. Im

I .1,

Biju, K. Guillaume, L. Moriau & F. Bossuyt. 2007. Global

confidence intervals in estimating the age of angiosperms
from rhcL and 18S rDNA dala. Amer. J. Bol. 88:
1499-1516.
& M. M. iferring angiosperm

phylogem from KST dala with widespread gene duplica-
tion. BMC Evol. Biol. 7: S3.

.11 II

Bot. 91: 1656-1665.

Schneider, H., E. Schuc
Magallon & K. Lupia
shadow of angiosperm

Smith, S. A. & M. J. D

Science 322: 86-89.

1 ill, M, 'i

M I I

477^83.
, P. S. Soltis, P. K. Endress & M. W. Chase. 20

, M. A. Gitzendanner & II

Bayesian analyses of large data sets. Int. J. PL Sci. 168:
137-157.

\ \ :

, M. J. Moore G Burleigh & P S Soltis

Hint:' ?•:■«': ;'■

-15.

F. Sollis. 2004. The

1614-1626.

, & M. W. CI

comparative biology. Nature 402: 402-404.

,, ,
Acad. Sci. U.S.A. 103: 5

America. Pp. 243-281 in W. G. E. Caldwell & E. G.

Kauffman (editors). Evolution of the Western Interior
.eend Pap. 39.

:•::■;.<■■. i'V.,

Cestaio. I). Piuss. \1. Pindo. I M. hU/^idld. S. \<v/ulli
& J. Reid, et al. 2007. \ high qualit) draft consensus

Wang, 11.-C. M. J.

:erly, M. A. Mel

175 505.
Wikstrom, N., V. Savolainer, & M. W. Chase.

Itee. Pmc. Pun. Soc!" London, Ser. B, Biol. Sci.
2211-2220.

'..' ■iihh-r. h.v,

avis. 2008. Phylogenetic patterns of

Natl. Acad. Sci. U.S.A. 105: 17029-17033.

imos. S. J. Mazer, 11. C.
Muller-Landau, H. Paz, N. C. A. Pitman. L. Poorler. M. R.
Silman, C. F. Vriesendorp, C. 0. Webb, M. Westoby & S.
.1. \\ light. 2007. Relationships among ecologicalL impor-

ical forests. Ann. Bot. (Oxford) 99: 1003-1015.

ANGIOSPERMS HELPED PUT THE C. Kevin Boyce, 2 Jung-Eun Lee 2 Taylor S. Feild?
RAIN IN THE RAINFORESTS: THE Tim J - Brodribb,* and Maciej A. Zwieniecki 5

IMPACT OF PLANT
PHYSIOLOGICAL EVOLUTION ON
TROPICAL BIODIVERSITY 1

initialed In l he angiosperms themselves. Lineage diversifical

■ i .

nes, especialmente en el

i i .

IKS) o\ci ihc 2007; Falcon-Lang et al., 2009). With the transition

• ' , ■ i ■■ ; .ii;.

"

Stein et al.. 200".

; Ji they were subject to

'■': ^ ' ". ->r\

incil (F.J.B.).

. Card. 97: 527-540. Published on 27 December 2010.

paleontologists 1 1 „. 2004; Wing et

...i., . >Kf'.\:

I ' !

strongest support for local developmenl

palynofloras do overwhelmii

.•i:r I l-i I-

2009).

item, housing more than half of a

I li :.

(Bierregaard et al., 1992; Wilson, 1994). The niche

2004; Wing et al.. : |[ ieir vegetation, and

can be ambiguous ,(„,;, ( . m ,.,..,„,. n f ., | ai . g( . amJ heterogeneous area

!()04; Leigh et al.,

"'" " ^ ! » II

1 I' 1 I '• ,

merits and model inr ns further promote

1111 ' „| '

.-tween them neutral

i of angiosperms accompa-

(Burnham & Johnson, 2004;

iosperm-dominat

ct is debated (Upchurch &

et al., 2009). II'

t both tropical and tem

m & Elli

s, 2002;

;Beerling&Woodvvaj

2003; Ulnar et al.. ,, jivitv ;m( , sh(i(T

' "" (1 , •

u,led. as is uhedier

ill I; '

of large angiosperm trees or of large seeds sugge iales of & mugeum

1 ' '

ney, 1984; Wheeler & Baas, 1991; Wing &B

■III • ' 'II ■

^TT^T ^y. & tle P elul(>m ' e 011 lm; underlying physical parameter of

i ^ pc urc abundant and I rainfall. Here, we

, , , w i

The Evolution of Leaf Hydr,

. .
limited to that envim Morley, 2000)

havebeenqiieMi.pr bun dioxide (C0 2 )

:■■!■■: : ■'! !•■! i ! ■ .

1

Plant Physiological Evolution and Tropical
Biodiversity

il)b, 2009).

lired water in leaves requires

the sites of evii|. .\vs mass flow of

■ ' l ' . ■[ ■■;■.:•.!
' ^ • ■':■ M ' !i '•

In ! I"

III i '

1 1 1 '! 'I '

/ .' I" I I :'

resistance of the en1

The most

•t wa

y to shorten the

between leaf xylen

i and

stomata through t

'

c the

;

er leaf vein densil

and transpiration i

as been demonstrated i

)hylo^

genetically diverse

b et al., 2007; Boy

2010; Fig. 1A).

i liable from many

"ill i ill i '

■ ■ ■

'' lull

' ■■. UIM

habits, and growth rates (Wing & Si

....
•I. In i

:,: ',..,... ,!■,. , [..;,: - ■■ u I,

re, 2008).

l gh 1.8 mm ]

Laminate leaves are common among euphyl-
lophyte vascular plants, but
(Galtier, 1981; Kenrick & Crane, 1997:
2008; Boyce, 2010). Leaf laminae evolved in-
Utility of separate

I i i n i

• • " ■

(Boyce & Knoll,

ii I i , II II ■ , i i i |

1 ill 1 i i I ' • u I

ill in, i i I

li ;■ II; ,11 ■..:■! I ■■ ■ :
1 I i i

world (Fig. 2).
remarkable given

| I | I

i 1 ■''' il-'lil". ■:>■■'

I II.

in ■

!.'u:i i '.;;■:■ ■

. I i i

ger, 1999; Fig. 2) is more perplexing. C0 2

....■;■ V ■ i. r

■ ■' -IMi; ■. >. Ill"' u

I II i

1 1 ii i I ill <

in, ii ,i ! in i In mi inn i ;ii a in, i ii i| In

Ii-- e\en as (,(), <

urn

■■

u

■■■

i

V

^ ■ ' i in

vein densities that

hi ji
Early Cretaceous, but since then angiospevms have (Boyce et al., 2009; Brodribb & Feild, 2010). High

'■;■'■ • i "'•' ■

ill- 1 !

et al., 2009). Actinodaphne Nees at 15.2 mm r

in-; I • ..-i i .

e (Fig. IB). Lineages at the mm mm i. .

£S

II

s:

! i

Plant Physiological Evolution and Tropical
Biodiversity

53

_ BaninOT

a8elnlh e Up

::,'

zii::

tz

(Fig. IB). Howeve

only in thick-leave

Crassula L. at 0.4

at 0.7 mm mnT 2 ;

ferns for which sue

:. ■

■ !■■:■ :| Ik ", II

i J! m II ii i ill' iii
et al., 1999).

I ite spring to early

1

|

Illinois, U.S. \. (Findell & Eltahir, 1997; D'Odorico &

5

icreases have also

. J I T I

J

I T * { t

Lranspiralion associated with crop irrigation (Stidd,

1975).

Millions of years ago

' ;.. , i H ' i '|:

■ i' ■ i i

' :! ili'.i l!, 'MlCi-

(up.

'

ll III

d?^)fShera^roT^SSil C atat

s

; . . .","■.?■.*) oil ;i

cling of rainfall

198

el al., 2005).

■'. v.'.'i. T ■..•

n\ K cm : ■.

| 111 I ll

'"I .I , 111 •. .'C.'.i'l M

I i 11 II

r. ■'!( ;i mii'i ; :'.<■:■..

II I , I M

ll" (' ■ I = I i ' .

Evapotranspiration (mm ycai

i#

""■■

y T ^
Li

LL v y *m

ft

Lee, 2010; Lee &
season (e.g.. I

v is indeed i ; ;

■ [.:■;■. -0101.

The influence of transpiration on climate is largest
i South America 0; Lee & Boyce,

CASE STUDY OF THE MODERN WORLD 1500 mm P er ! involves both less

angiosperm transpiration. In climate sin .s et al., 2009), with

coupling atmospheric and land

III- ■ ;■■.:■ l;',|.:illi" <

Plant Physiological Evolution and Tropical
Biodiversity

(Boyce & Lee, 20

heat (Lee et al, 2005),

The lesser impact on precipitation seen in South-

■■ I '.'II'-. <H.:'.: " . ' ' ' '

'

:

hI ■

Ginkgo L. is below the ;

as cycads, medi
approach LAI vali
2001). Third, plan)

tend to be found in low LAI lan<

i and deep shading
is ((Tuk el t
quadrupling the number

i like a compelling i\
increased angiospenn transp

i

dependent on pi ve feedback loop

i world without angiosperms

rates results in less precipitati

,■;»; ! ',.;! Mi ,. /;. ■

indicated by changes i

How many leaves?

ie above climate modeling in o
[pact of changes in transpiratio

'i I ■

>'■'"•-• : I :■:■; ' ■> ;

(Doyle & Hickey, 1976), possibility

first five or six m

I i'i I

important elemei tropics (Brenner,

1976; Rees et al., 2000; Brodribb & Feild, 2008).

belts close to o< Early Cretaceous

..'... ■ ■ . Si ■ '■■ ' I.' Ml,' i

'I '' ^

Early Cenozoic warmth
\L Llit n E ne apog

i In
(Morley, 2000). Although this M

extended past the

of the Early Cenozoic versus t

te Early Cretaceous, and high

: ■: I; ■;!;:'

! i

III II! I

I I

ihukla et al, 1990; Eltahir &
Bras, 1996; Laurance & Willi

i !..■[■ ..'I ii I '. ' ■

in ll <i
al.. 2010). hi addition to i
effects, the destruction of angiosperm tree canopies

!i I hi !. , i Ih I in

:

( ' '! I 1 I I II

capacities of the plants involved.

As a more complicated example, the Paleocene/

1 1 " :

ection of greenhouse gases into

■. .. : . ". ' .'
terrestrial plant populations migrated 1000 km or
more to higher latitudes (Wing et al., 200;.

evenLs in the geologic

increased risks of amplified <

(Boyce & Lee, 2010). For example, the i

■ ' I i I . ■ ( . r , ■■ ■
; :■ '..» :■, ; I- ill

into the upper atmosphere, foil

the atmosphere (O'Keefe & Ah

involved wholesale destine tin

: ■:■ ■ ■■: in;." i

' 1 1 i lii'

' . . ^ i i 'I

Hi ■ 1

magnitude of temperature i

significantly larger than in the oceans

■■: 'i ■ I VI -a:'..- ■;■

rature. However, if the PETM onset was slow

I -> within a contin-
i existing canopy, then terrestrial temperature

■■■■ ii.""' i" >.ii in

ETM I II I mill

luring the Eocene Thermal Optimum, but were

.■■:■:. ■.■■!.■:■■ |"I '

Plant Physiological Evolution and Tropical
Biodiversity

ators from the PETM and later
train the rapidity of PETM onset
itial environment;! I

■ ii >■■■ •' |>" '■ w

(>•■ »'i; in m

! i "

(1 & Fleagle, 199 Leigh et al >004;
Jaramillo et al., 2006). Because lli.

■■> > « ! i;i k <\

angiosperm Iranspiratio

largely a result of the ecosystem

nls out as an

■■'.:■.=. , ! ii ■■•:■
ri.::,',:'.n .<>.. : i

! 'ii i in I I-
i ii

feedbacks at the ecosystem level that re-engineered

: >f l.i'-. ■■!■■. Ii. ; , Ii ■■.

:■<! If'. :" ill .-'■!.»■

I! 1, '

■ 'I !!>■]<■:■. ii,' ;

II ',llir;i!i',i,' •

al, 2004; Morea i < la-Emonds et al,

, et al, 2007;
Wahlberg et al., 2009; Wang et al, 2009). E

: have driven the

et al., 2004; Schuettpelz &

I'" ' I'"

ncreased precipitation

response to the increased prodi

Lie i i Ii n i

-'

The impact of angiosperm evolution on tropical

i

;

■;■■: ■'■ Ulllh Hi
lit,

2006; Burnham, 2009). True epiphytes radiated in

' I'!
" I

, M I I I ' i I I

soils has likely propagation of

> Ml'.'l"". V\

Ill I II II Ml II, 1 "III lli ..

accommodate the ids of high solar

led to the spread of high rainfall en

i ■ i !

; -'I.' :! Vii

it we argue angiosperms have

. "in .] mil-; ii

Algeo, T. J. & 5

anoxic events. Philos. Trans., Ser. B 353: 13-130.
Arens, N. C. 1<> ( anatomy to light

environment in lh( lre« fern (uillua caruvasuna ((\-
atheaceae) and its applications lo some ancient seed [cms.
Palaios 12: 84-94.

Hold. Science 1 Hi

climates: High atmospheric ( 2 as a plausible explana-
tion. Pp. 546-553 in E. T. Sundquist & W. S. Broecker
(editors). The Carbon Cycle and Atmospheric C0 2 : Natural
Variations, Arehean to Present. American Geophysical
binglon. D.C.
L. H. 1981. Vegetative anatomy and

: I " , ;

,: 275-313.

... .!<;: : NIL.

tropical rainforest fragments. BioScience 42: 859-866.

:

Vos, J. L. Gittleman & A. Purvis. 2007. The delayed rise
of present-day mammals. Nature 446: 507-512.

ossil record of plant physiology and

Pap. 14: 133-146.

:■:<: .'
pal l 1 1 :ontext. Curr. Opin. PL Biol. 13: 1-6.

■"

Paleozoic vascular plants. Paleobiology 28: 70-100.

and biodiversity. Proc. Ron. Soc. Loud.. Ser. B. Biol. Sci.
277: 3437-3443.

......

■ ...i.l

early migrations of angiosperms. Pp. 23-47 in C. B. Beck

n i n. i

77: 245-251.

&

Lett. 13: 175-183.
, & G. J. Jordan. 2007. Leaf maximum

climbers: liejucos, sogas. Irepadoras, lianas, cipos, and
vines. Kevisla Brasil. Paleonlol. 12: 149-160.
& K. R. Johnson. 2004. South American paleobotany

i, ',.,

Carbon Cvcle: ModeLu

R. Kump. 2002. An atmospheric pC() 2 reconstruction

Ser. B 353: 75-82.
& Z. Kolh i

in Cretaceous florist ic
dhersih. Science 246: 675-678.
Crepet. \\ . L. >

Requiem or renaissance? \nn. Missouri Hot. Uard. 95:

Plant Physiological Evolution and Tropical
Biodiversity

r. :■.'■.!■..

DeLucia. K. H.. \l. I!

T. Tissue, I). Glenn> , T. M. McSeveny & D. Whitehead. 2003.

soil moisture and climate dynamics. Proc. Nail. Acad. Sci.

mid-Cretaceous Potomac Group and their bearing on early
an^ p lrtion. Pp. 139 206 in C. B. Beck (editor),

'•.... \l, R II ".. !!'i II i

>phys. 34: 367-378.

:

".:■!"■:. |:(,i. !:i;:': ': f . V ; ' ..

. IN. C. Arens, J. A. Doyle, T. E. Daws

Donoghue 2004 Dark and disturbed: \ new image of
early angiosperm ecology. Paleobiology 30: 82 407.

■ lier relations of

silo in a tropical montane forest in southern Ethiopia.
Trees (Berlin) 18: 428-435.

tions from Illinois. Water Resources Res. 33: 725-735.

:.ns. Part I: Framework

Gallrer. J. 1981

Pteridospermales du Carbonifere Inferieur et leur signifi

cation evolutive. Palaeonlographica 180B: 1-38.

tree diversity. J. Ecol. 87: 193-210.

• I . •

I :

of Bromeliaceae inferred from ndhF sequence data. Alis,
23: 3-26.

niche. Biol. Rev. Cambridge Philos. Soc. 52: 107-145.

.oling from the K/T

-
larms, V. L. &
n 1 1 1 g of certain Cordaites leaves. J. Paleontol. 35:
1041-1064.

Production and resource lisc efficiencies in N- and P-

ion. Ecosystems 4: 646-657.

Schneider. 2007. Evolution of leafy liverworts (Jungerman-

ii i . I Hi i!i. . .1

" ' . ' . . ' : .

Rees, S. A. Robinson & C. E. Ross. 2003. Carbon-cycle

perturbation in the Middle Jui

changes in the terrestrial paleoenvironmenl. J. Geol. Ill:
259-276.

P. 2001. The Unified Neutral Theorv of

Press, Princeton, New Jersey.
Jan/on. I). H. II

■

ens & K. G. Miller. 1999.

1531-1533.

Diversification of Land Plants: A Cladistic Study.

II ,i I . i i i,i ' i ,

■■.■..■

:

precipitation as determined 1,\ the NASA GISS GCM.
Geophys. Res. Lett. 13: 121-124.

30.

, H. Kerp & T. N.

. 2001. Positive

i the NCAR climate r

ma. Lieikelev.

& C. K. Boyce. The impact of the hydraulic capaci

America. J. Geophys. Pes. (in press), doi: 10.102
2010JD014568.

R. S. Oliveira, T. E. Daws

J.S.A. 102: 17576-17581.

I. G., Jr., P. Davidar, C. W.

rgh, H. ter Steege & S. J

tropical forests have so

ueu genu* ..1

■,r;:I li'l .■ .::•:.■!!■

Ihe Permian of Soulh China. int. J. PI. Sci. 163: 175-183.
:

[lie Permiaii-Tiiassic ecological crisis. Proe. Nail. Acad.
96: 13857-13862.
Ludlow, C. J. & F. T. Wolf.

- J. 65:43-48.

a. Slomatal density
and index of fossil plants [rack atmospheric carbon
dioxide in the Paleozoic. Ann. Hot. (Oxford) 76: 389-395.
, D. J. Beerling & F. I. Woodward. 1999. I!

(Asteraceae). Ann. Bot. (Oxford) 104: 1085-1098.

T. D. Frank, C. R. Fielding, J. L. Isbell, L. P. Birgenheier

inslabilih during l.ale Palco/oic deglacialion. Science
315: 87-91.

'^ : ' . . ■; ■,l!l- .,;; :i i: ',■, il:c

age of the angiosperms. Science 289: 291-294.

I I ' I! nil

,, Chichesler.
Cardinot. 2007. Mortality of large trees and lianas

N. M. Holbrook & M. A. Zwieniecki. 2008. Optimal vein

density in artificial and real leaves. Proc. Natl. Acad. Sci.
9140-9144.

C0 2 by the Cretaceous/ IV

release: A model-data comparison. Geology 36: 315-318.

g) 6: 301-314.

.i I I

in E. M. Friis, W. G. Chaloner & P. R. Crane (editors), The
Origins of Angiosperms and Their Ecological Consequenc-

, A. M. Zic- ^

and Cenozoic. Palaeogeogr. Palaeoclim
40: 67-101.

southern Africa and its paleoclimatic implications. Pp. 63-
86 in W. F. Ruddiman (editor). Tectonic Uplift and

• " -!

;.:■■:.;■,.-....

Lloyd, G. Lopez-Gonzalez, Y. Malhi, A Monteagudo, .1.
Peacock, C. A. Quesada, G. van der Heijden, S. Almeida,
1. Amaral, L. Arroyo. G. Aymard, T. R. Baker, 0. Banki, L.
Blanc, I). Bonal, P. Brando, J. Chave, A. C. Alves de
Oliveira, N. D. Cardozo, C. 1. Czimczik, T. R. Feldpausch,
M. A. Freitas. E. (door. N. Higuchi. E. Jimenez. G. Lloyd.
P. Meir, C. Mendoza, A. Morel, 1). A. Neill, D. Nepstad, S.
Palifio. M. C. Penuel.i
J. Silva, M. Silveira, A. S. Thomas, 11. ter Steege, J. Slropp,

.:■■.■::,! ■■.,;;;..

Andrade, K.-J. Chao. T. Erwin, A. D. Fiore, E. Honorio C,
H. Keeling, T. J. Killeen, W. F. Laurance, A. P. Cruz, N.
C. A. Pitman. P. IN. \ argas, H. Ramirez- Aigulo. \. Hildas,
K. Salamao. N. Silva. J. Terborgh & A. Torres-Lezama.
2009. Drought sensitivity of the Amazon rainforest.
5: f 344-1 347.

h i ,<v

1 I< Ml. I' III UN I

bot. Palynol. 66: 105-128.

& T. N. Taylor. L<J

G'lossoplcris stems with attached leaves from the central
Transantarctic Mountains, Antarctica. Amer. J. Bot. 80:
500-516.

control of primate diversity. Proc. Natl. Acad. Sci. U.S.A.
92: 7874-7876.
Recs, P. M.. A.

Pp. 297-318 in B. T. Huber, K. G. MacLeod & S. L. Wing

University Press. Can

ball. Amer. J. Bot. 65:

Nonmarine Permian. New Mexico Museum of Natural

species diversity: A hypothesis. Amer. Naturalist 111:
376-381.

patterns in biodiversity. Ecol. Lett. 7: 1-15.

K., D. J. Gower, M. Wilkinson, S. P. Loader, S. D.
Biju, K. Guillaume, L. Moriau & F. Bossuyt. 2007. Global

amphibians. Proc. Natl. Acad. Sci. U.S.A. 104: 887-892.

Epidermal morpholog> of the pinnae ol Angiopl<>ris,
Danaea, and Marattia. Amer. Fern J. 81: 44-62.

.h vie of the tree fern Psaronius. Amer. J.
Bot. 78: 782-788.
{oyer, I). I.., K. A. lierner, I. P.
J. Beerling. 2004. C0 2 as a primary driver of Phanerozoic
Today 14: 4-10.

57: 361-381.

Plant Physiological Evolution and Tropical
Biodiversity

uettpelz, E. & k. M. hv, i

R. Bown, T. J. Bralower, G. L. Chrisleson, .

Cockell, G. S. Collins, A. Deulsch, T. J. Goldin, K. Golo, J.

M. Grajales-Nishimura, R. A. F. Grieve, S. P. S. Gulick, K.

ECoeberl, D.

Morgan, C. R. Neal

Pierazzo, G. Etavizza, M. Rebolledo-Vieyra, W.
Reimold, E. Robin, T. Salge, R. P. Speijer, A. R. Sw.
J. Urrutia-Fucugauchi, V. Vajda, M. T. Whalen & P. S.
Willumsen. 2010. The Chic\ulul> asleroid impact and

112: 729-741.

7: 1322-1325.

adaptive radiations in the Orehidaeeae. PI. Phvsiol.
(Lancaster) 149: 1838

. S. Feild, Y. Yano & E. H.

& C. M. Berry. 2007. Giant eladoxvlopsid trees resolve the
enigma of the Earth's earliest forest stumps at Gilboa.
6: 904-907.

279-280.

forest. ISol.,1. Linn. Soe. 90: 231-241.
Tanner. E. \. J. & \. Kapos. 1982. Leaf structure of

! '

16-24.

Ecol. Managem. 198: 341-350.

T,IT,, : > i: l

IIS*' :;i "::■"! '• |: \ ' ,

Missouri Bol. Gard. 71: 551-576.

. F., L.

transport du

North America: Estimates from a stable isotope mass-

: :.

vidence from fossil
leaves and wood. Pp. 75-105 in E. M. Friis, W. G.
Chaloner & P. R. Crane (editors). The Origins of

bridge University Press, Cambridge.

, B. L. Otto-Bliesner & C. R. Scotese. 1999. Terrestrial

vegetation and ils effect-, on climate during ihe latest
mer. Special Papers 332: 407-426.

, ^., J. J

, U. Ko«

Ser. B. Biol. Sci. 276: 4295-4302.

(1 D. Bell. S. F.

Manchester & D. E. Soltis. 2009. Rosid radiation and the
rapid rise of angiospeim dominated forests Proc Natl

al wood anatomy. LA
irick. 1997. Plnlogei,
based on rbcL sequences. Int. J. PL

Sci. 158: 862-871.
,\ ill', P., C. C. L.l,,i,

Windsor, A. L. Allen & K. R. Johnson. 2000. Timing the
i i II ii I 1 ,

latest ( relac eous to ie< enl Science 289: 291-294.
\ilson. E. 0. II

opporLunilv. Amer. Zool. 34: 5-11.

2007. Steady diversification of derived liverworts
under Tertiary climatic fluctuations. Biol. Lett. 3: 566-569.

,\ing. S. I, <K H.-l). Sues. II
Ceno/oic leiiesliial < > .

Behrensmeyer, J. D. Damuth, W. A. DiMichele, R. Potts,
H.-l). Sues & S. L Wing (editors), Terrestrial Ecosystems

& L. D. Boucher. 1998. Ecological as|

Cretaceous flowering plant radiation. Annual Rev. Earth
37') 121.

.. .1: . II ■ : .

I. .11

Boyer & K. H. Freeman. 2005. Transient floral change and

■■ ':r ■■■■■ 'ilii'i. h .

): 993-996.

, : i„, i in. i

), C. Gomez-Navar

U.S.A. 106: 18627-18632.

Petrizzo, A. Brill, T. J. Bralo^
A transient rise in tropical

Bohaty, M. L Delaney, I

I). C. Kelly, K. Thomas, M. Nicolo, I. Raffi, L. J.
Science 308: 1611-1615.

-sity. Ecology 89: 248

. VI.. (,. Kh. I. P. M. Kccs. T. A. Rothfus, D. B.

FLOWER STRUCTURE AND Peter K. Endress 2

TRENDS OF EVOLUTION IN
EUDICOTS AND THEIR MAJOR
SUBCLADES 1

hi ,';:ilr:|f.l!'.

Myrtales) are supported by floral feal ause they characterize

i riles), it is shown that

In ', ,i, ill , I

grade of throe

<■;.';■ I ■■ , -:■ '.. :

1999; Soltis et al, »r both) (Fig. 1).

'H- I-''':' 1 ' ' l; ■

r floral structures,

i\e clades, the

(Judd & Olmstead, 2004; Hilu et al, 2008; Burleigh ■ i awn to the level of

et al., 2009; Moore et al.. 2009). Eudieots are the the orders. I I ul.ciades have been

;
species, over 30( ,

(Magallon et al.. I

> i .

eudicots (Donoghue & Doyle, 19; 01 onward; Judd &

>: Judd et al., 2008;
Fischer's rule, i

■ !■. ■■«.;■>■',. rr.-HuM'

also exhibit a basal grade, and th
two especially large clades, rosic

and Peter Steve

7/2009139

Ann. MtssouRt Bot. Card. 97: 541-583. Published on 27 December 2010.

quent organs, as explained above, and the angles of

li ■:■■!« ]-.•. .■!■■■■

, I I I II

■ ■ 1: . TM :■, II 1

Although pentamery in the perianth is by far the
i core eudieots, there are also

1999; Borg et al., 2008; Endress, 2008).

Polystemony is prominent in many eudieots,

in rosids (especially malvids) and some clades of the
. (iomales, Eri-

II, I ...l>.

commonly carried out by sepals and pet;

Conversely, both sepals and

1 Mi | i I .M

■■: III"' .. i! :■.: "i . :■ :l.
I,. I II il

nspicuou gan.

The question of homology of sepals and petals has
long been addressed, recently by moleculai

<>i I I'.' Mi 'I' " '■'■

-Mijlirr,! ■*< :): ' .

'•,MI,H|i;; ill; i

'I i'" ■

-I- ..ii i
Schoffel, 1932: Ren et til., 2010; RoMiceae

■ . '■;

Multicarpelly is also q

structure is the concept of sepals and petals.

contrast to stamens and carpels, which arc ea
defined by their specific male and female functii

Evolution in Eudicots and
Their Major Subclades

sterile tissue at its flanks and/or at the
iks or at the base of the

'lllls base). E. Ten

. ' ' ' : ':"i :ir.'Vi

■■■ :■! vu: in

In in iii

As the survey progresses, this classification may be

Iii'

clades of eudicots.

.!.:' ji l . :,!".. il

ciH'icoh- ,ir<i in i nl i \ II i I Ill i

1 1 i i I

■ < I > •■ UMli"

nucellus) (Fig. 3F). \n i.l.,tl i .lo<

ommonly present in ovules with a thin nucellus,
i especially in the states depicted in Figure 3B-F.

s are originall t 1 f I

; merely histologb

i

i n 1 1 I 1 1 1

iped rings around

: i i ■ i :■ . . i • ,

The basal eudicots are a grade of three to six main

■" I. mI ■

2009; D. E. Soltis el al, 2009): EL
Sabiaceae, Proteales, Buxales

I !i in I i in i

phylogenetic support of their

1 1!

i

i . 1 1 ■ , i

id Berberidaceae

.

Iress, 1986; Wu et al, 2007). ;

II . I II : , i, I

< III „.

synorganization of floral pa]

:'.,..ji..: ■•:'.. i,:-i . ■ :

Circaeasteraceae (Circaeaster

Eupteleaceae in i then especially

in the upper

„IC., •!,■•.■: <-.. . ,r

. . ■ : ' ■ iv; ■'.:■. <-i ,i .

.. "" : ' ' : .

I i I I! i ill

iminodes, stamens, or carpels),

'ii i

ill; ■»■.■■ !■.■-■;■■..

ceae and Papaveraceae are si

k\ and Ranunculaceae (flu

I," linn

al., 2007; W. Wang et al., 2009). floral merism is

more also oecui

' i i ill | II"

I ,1-

flowers evoked in two families of Rmiiiim
Papaveraceae and in Ranui

■ ,i:"' :;i —

present in Ranunculaceae (Ei

n: all, are on the

'i : ■■ II H ■ ■■ . :■■! Hi

:

■'•'.■ ■ '

Ranunculaceae (Kis

rris L. The two (or

on top (van de Water,

:, ■■[■:■■ ■..ril ■ , ■ ■ , . ' ' ■■■■;, -iivs ■. ■

ess, 2010).

SABlACEAE more detailed

nectary around the gynoeeium base is present in Sabia

in 1 1 1 1 i i i i

al., 2005). Kelatively elaborate floral monosymmetry. |»|»<)TK \l K^
is present in

■ ■■ 5 1 ■ : i -■ hi ,; ii,ihi'i

..||; ,,i , \U-<: ;: ' . ■

opposite organs partly fused with ally conspicuous apomorphy in a

i lilies among Nym-

I ■::■!;■ ■::■!■■■
;ii' >;■.-:■! >.!!■■■'

I n Is, and wind. How-
1 with the next outer petals of cc 1\ ate aestivation), no

:■. ■( I ilk- : ;r I ■
i ' i- 1 n I I i ii'

in i In

I i. , I ,

I mi I M l 1 1

.1: i;' In '.Ill r

.'■'■: I ,1:1 ;■:.■■ ■

......

' ■■['.'-..■■lii: II',.: |
I I I | 'I I I I ■'

although Lhc\ in al., 1997). Modern Platanaceae

i i i I I

, I i ■ • 1 1 i II " i i . i I i ■ i

:■■■■■ '

nil

. - II'.

I ,li , . .

ter et al., 1991; H. C. Wang et al., 2009). In BuxaL.,,

O I ID I • //-u- \ TT 1 l

■

"ii' UK K"

Endress, 2002a, b), and Didymeles (Sutton

5-merous flowers

i i 1 i lii II

i , ii , II i i i i i i i i i i I i

i -; . ■ . i . ■ , : ■

Balthazar ct al., 2003). Interestingly, in the Creta- ™ "'''''* ° r ^ lies

, , .. " . !l. 1 ' in," :."

■ , , o , , - , .. .

i • i i r-

"

1991). The male flowers of Spanomera are somewhat

Berberidopsk'l Iraene, 2004), Dille-

" ill; V. r ■'■

Buxales have predominantly decurrenl -

i lie gynoecium,
I 986; Vogel, 1998; von Balthazar & End-

ies in the floral

■;
Craene (2004).

i ill In 1 1 i 1 i ii

i 'I I • l

.Hi i ■ , I

; ".ir. ■!.;■ .; !■""

I ii ' II il

ii

(Kn.liv^ i\ l-cixhcim. 1999).

GUNNERAI ES

needs lmin

: I <• " ii : ■■ "■

.; ■; ii.', >■:■;■■!■■.' ■:■.<■.

. ,,-.|.: !■■':". ■■■,",-. I :" " . " ■ ■■,,!" - I! - ::■

| i., I 1 ill I I II II Hi

eudicots (Soltis et al.. 2003 1 Terence in behavior

. M. 1 i I II

" ill i" l; .'■!■ II i.'.

Wanntorp <S Ronse De Craene, 2005;
Craene & Wanntorp, 2006: G

' . ; i \>: mi.

ys fixed in

a species, genus, or even

t, in most rosids both

same indi

vidual (Endress, 1999,

tw

contrasting alternative

peatedly e^

olved in both rosids and

nt distribution in the

flowers, often function-

'*

ten with both protective

Evolution in Eudicots and
Their Major Subclades

Dilleniaceae have an unresolved position at the
base of core eudicots (APG, 2009). The flowers of

ie numbers ami

!!.'■'' ii: IV. !■■,■;!

Ill ' III.' I I.' i I -I

I I i 'I

|:|: r l-.i . '■■

unresolved topoL er subclades of

ceous (H. C. Wang et al, 2009). A

Saxifragales, the basalmost clade in rosids s.l. (not

' . II '• , |i.

I' I

i' mil i" ill

The woodv families have ;

' - II H, I i II i II ii

|ii i ii
few Hamamelidaceae), flora] nectaries are absent. In

i II 1 i i - '..-■,.

tors. Paeoniaceae
e of petals (the

Bayer, 2007) •: ii

II I I ii I

J'Oil J, lii II

the carpels (Cras :r, 1955); in some

..■r- ii,'.' '.'

■■:' '-(1 HI' I'-;:'. ;!■'. II 1 lni.'ii

Hufford & Endre: i Stumpf, 1991;

' ■-■, id Mir III;

Crassulaceae. Haloragaceae. Aphanopetalaceae, and
carpels in Pa i-caroae. Ovary

',,::,u. ■; ',«,. ■:■■ ■

:■ ,' . '.

Kuzoff et al.. 1 ■

ragaceae, Crassulaceae, and Ha

i .1 . I I - i I in ■

ress. 19,,: I'ncoi
the outer inte-um

"I. , !.:■<■ I;', h.li I
III i.' Ill ,.'%:ill1l' :

embryo suspensor

cells in members of coir -

• within rosids is
valvate anther d inelidaceae. The

: M !!i I I I i

more common i ind basal angio-

sperms) (Endress, 1986, 1989a, b, d;

Lon-Puebla et al.,

. -'..:.M.

gynoecium. Sepals are united and form a

t). Stamens are

1957). The carpels are congenii

villi & Posluszny, 1989). The

inly the inner forri

■!;■. :■. |n; I'.CC

between androecium and gynoecium.

1 :<■■■■, I.I, ■ -:■■■ .;.

)ighiales (COM) clade. Two or three

.!<!■. oil': II • I ■■■■:■ i'l,

.■■.II; I .':■!■ villi

i i:;v;-., I''V I, ,

■IJ..'.' I II :■ - i -■ ■

(Matthews & Endress, 2005a), and Gem

,:\.' ; i. ;!»■,•; i s

isition of Myrtales and Gera-
niales in the in,

■ •:-■. ■!'... !■■

I ,l ill

relatively strongly supported by molecular

■ 1-SlV.. ..!<■!, II ;;
I !

In APG (2009), core fabids have two large

fixing clade and

ceae are poly symmetric; those of Krameriaceae, elab-
orate oil flower;-

i ii II l II
■■ ■■,; ,m: '

it (Ronse De Craene & Smets,

■■■■ ,;.■: ; Mi ■ ■■■.■■(■•'■ 1 1 M I I ' . .

1 ' '

: >:onla L. (Nair &

<•; ;!.;■■ ; -■-• , II; v :; ■■■■

is formed by the i Krameria Loefl.

(Verkerke, 1985a; Boesewinkel, 1994).

I; Fey & En

-

ceae (Rosales) (Bernbeck, 1932). Ovules

II ' ^ ^

I > i i .1 i

better, non-porog ith delayed ovule

.' . '.:.-. : '*

" i ' I ' .

i, 1898; Murbeck, 1901; Shattu

development (Polygalace

:ae, Prenner, 2004a; Faba-

ceae, Tucker, 2006; Qu

Bello et al., 2007). Free

carpels are coin.

for Polygalaceae (Bello (

:t al., 2007); a sis

ceae and in three of the five

genei f S e ( ;

in all major subgrou
Polygalaceae p.p., Verkerke, 1<
(Rosales), Arora, 1953; Begonh

'rakash, 1987) and al
Polygalaceae (Rao & Roy, 1981)
(Heo & Tobe, 1994). Zigzag micropyles are pres.
many Fabaceae (Prakash, 1987) and Polygal,
(Verkerke, 1985b). Seeds with arils occur in a nu

(Bello et al., 2009). It consists of fou
(Fabaceae, Polygalaceae, Quillajaceae. Su

■

Ii i i' I I

ly is predominant (all
3, Barbeyaceae, Di-
Elaeag: 1

ion to keel flowei

hofer & Weber, 1999). Presence of a single

in\- .;f o-.-i

Kn^areae. JuelL
has a considcral

umber ranging from one to

M Mi'.'' ' ■.'■■■■

Evolution in Eudicots and
Their Major Subclades

urbitales and Fagales there is a trend I

' ■ II : " i :: - H - <

ill' I . '..I! I

■.'.:;■!.■( ■
i II I, i

I ales, in Datisca-

thews el al.. 2001

& Endress, 2004). Unisexual
ules and consistently

I

! ■ i .1 flu

II >!; ■ n; " ' '

■■■:.:■} \: <M- .■'■■

■ "i • i i in

both orders. In addition, sometimes the flowers have a

• -.... • ■ ■'■■■; ■'■'.■ " ■•

I

stigmatie branch i orders (several

II 'II . 1, I i

e ol Fagales (Manning, 1940;

, .. . ... ..

trend to unitegmy (most Fagale.

ii I

thews & Endress, 2004). Fagales have a

'! Kll : I r- :\

diversification of flowers at that Lime (Ilerend.
al., 1995; Sims et al., 1999; Ml
2001; Friis et al, 2003, 2006a, b; Takahashi

Kndress c\ Matthews, 2006b) is

•I ..i "I-

■,

I is present in

V; ' > ■ ■ ' ■

2008; Oxalidaceae, Luo et al., 2006) and in four

.•ae, Shore et al,
2006), and even tristyly occurs in bolh order.

'. 1 . I . ' I !.

i ; (m. ■

all three orders

I

l.iiil . .,

endothelium (Endress & Matthews, 2006b). Equally

■ ii in 1 1

common (Endress & Matthews, 2006b). For a
Endress (2005a).

'arnassiaceae arc c

•phology (Matthews & Endress. 2005a) and have

n incorporated into them (APG, 2009). The third

:rre distinct. Flowers

2005a). Stamens font

■-.!'■ r .
i ■■!■".: ;■■■ \-.-i "■. ii .

■ ■ ;

The order consist;

supported. The flowers have predoi

ews & Endress,

■:', li-il'!, ii ■■ ii:

'■. '\\: ■:.::

tion is commonl) valvate, and ihe sepals

Mf-n Hnl>. — (Fndrrss, 1 I with an obturator,

: ," I :"!'" ';"->:. ' ..,.;,,.■.,■,,.,-, n ' .

there are I wo or

iii ! V I..

*"ij'5<M|' I; l; :

'■ ' I I '" I I" '

i '" Ml i

! 1 i,i'

■vi-, i
Davis, 2009). The families are more or les* well Snpindnlo. and llu- rccenth recognized lluerteales
the order is poorly
Tobe, 2006; Korotkova et al., 09; H. C. Wang et al., 2009) is

.. ..:■,'! ..■!.:■:■..■■.

i ;■■'■■ iim:, ;■ (,;,.
' ' )<l;i; II II,' ■,.'! ;.l||,

2003; Matthews & Endiess, 2008, in prep.). The ports a rolalu chide with malvids

realization of tin

" • , i. i i ill i m 'II v ;

small-flowered Kup

2008; Barkman et al., 2008: Davis, 2008), was found in Burleigh et al. (2009) and H. C. Wang et al.
on the floral (2009).

1 1 1 1 i i i - I

: : :

: . , ) occured in core

:.■;]!■■-■ ,■■■■ ?■■: !;',': ,

; (not in malvids),

•stricted to malvids,

bidirectional, which, e.g.. allows distinction of i -p.; /hang et al.,

/ ' . . . ■ .

1999). Synandn occurs in representatives of more (Ronse De Craene & Haston, 2006). as well as in

',1 '',,! In, I

(Fig. 7A-C) (Euphorbiaceae, Premier el al.
Clusiaceae, Leins & Erbar, 19

, ■■■ ^ ; ■, ^
• Hi I , ,1 ' II i II , II

Evolution in Eudicots and
Their Major Subclades

& Thome, 1984). lmon (Fig. 7D-F)

Dahlgren, 1968; Schonenberger & Conti, 2003). The

:eae (Tiagi, 1969) and Onagraceae (Carl-

' - I II i , i i,

II , , II | i

Raven, 1987, 1990, 1996).

: \ .!, I i I , ■■ (

.:

.in in ill i i

Oh & Potter, 2006). Gynoecia are a,

iin I i n II < i

■ ■ ' I 1 ii

■■■->'■"■!.■. I l->' :'l ■! ) ri I ■.

><-: r-lllla

,

2005b).

Picramruales are a new order (APG, 2009) based on

I ' Hi

i, syncarpous, with two

II ' i

(e.g.. Harms. I

Endress, 2007, 2008, 2009), combined with hetero-

(Fig. 8A-D). Pel; protective organs

incurved tip, [Ba

ii

ii. '

in hi

I in at least four

& Bouman, 1978; Bachelier & Endress, 2009).

The flowers in this new order of three familh
descriptions (Worberg et al, 2009) (see also i

. ii; „l v.. II nr . ■ ■ : ■

(Fig. 8E-H). Flo red with double

.■ [.,:■ ■■:■.!< a .v.

| Ma; I.::.| , "

. ......

' 'nil • ' i<»

,ii, ■!

■■■;.: :ili,l! .•

>■.'•:■'■■■ -.■A< '■ ■ •'

Iii', ' Hi i h ■

-

i>ii and forms a <

. . !: ..,,.,. .. .. : ,.
MALVALES oideis and

2009). A trend towa

rends s. str. (AFG,

■ I Ill 'il IN 'I illl li lillllMIII ill II I ill I ' i,l I 'I II Ml III I III I I I III . ' . '•..

meristem or on fi

.ere is a tendency
! . i! , i i i

i ill i, i in! II

; " ' ' ■ ■ i ' i i

(Endress & Stumpf, 1990; Bayer & crassinucellar ovules). More common are weakly

: ^ : ■ : '

; (von Balthazar & Nyffeler, 2002). Thus the lar , a nd redi ovules. It is of special

in androecium is a liol spol region of interest that this is also true for Santalales and

wy events. For gj their unsettled position. The ovules

)hyllales, i

-s in lamiids: Vahliaceae and

■e below). If there are two
-vie i* consistently formed by
.-:.■.■

ucellar beak is present in some || ee |_ l977 . antalales, Fagerlind,

Malvaceae and Thvmelaeaceae. In the I i 7() . Ericales, e.g.,

seeds, a bixoid eh:.

nceae, Cista-
ceae, Dipterocarpac<
1998b). which form: -- (Nickrent,

alaceae and Of the two opsi dales, the floral

Thymelaeaceae (Horn, 2004). There is a vascular
bundle in the outer integument

paceae (Rao, 1955) and Malvaceae (Rao, 1954). that of Berberidopsidaceae (van Heel, 1977; Ronse De
Nectaries are pre:
multicellular hair:.

ogel, 2000) or l y known (Ronse De Craene, 2004). Berberidopsidales

"> il! ' '

004), but are
lacking altogethei in Bi\aceae and most Cistac eae s \ N l\l\lts

:-M:lf .1; ,11

reward (Vogel, 2000). Apodant

:

(APG, 2009), fluctu i. The flowers are in general small and inconspicuous.

bird-poUin;

Evolution in Eudicots and
Their Major Subclades

insistently valvate. Ned

ngs around the gynoecium. There are

is affected. The sepals, still

case (female flowers of Balan

De Craene, 2009) the gynoecium is

ihological space of the gynoecim
disappear (Balanophora J. R. Forst. & G. Forst.,

1913; SanU;

; with a luic-ellus

(Faji.-rlind. 1947:

completely tenui-

.sperni hailstorm

occin in all i i ceae already the

embryo sacs behave like haustoria); in some families

micropylar haustoria also occur (Skottsberg, 1913;

969 1. Molecular

ic gynoecium and

i I "i

i i i ii - i i

"i i ' In i

develop in the compact gynoecium becaus

■ ■■■■■< •■ <■■ > ■■

Jol.t-i t : X: ; . .

li III i.K |
I I •

1990; Kbenvein et al., 2009).

- ■ ■;■ '"ii': '

lies of the latter, Po
were also somcti
^llales eailiei. ( ai
erized by floral structure (Eckardt,

(iw,,-,- ,, r ■

subclade has I ly shared floral

pons in I i.i

aceae, Hofmann, 1994; l\vci

De Laet et al., 1995; Pofy-

l|i," ,11111.;' Hi

et al., 1999; G

J - i
el al., 1995: IV

- i ill

I SI. I i |l-' .

As Santalales, Caryophyllales are also character-
families, but in
t t the petals are lacking (and not the sepals).

(Dickison & Mi carpaceae, Ama-

ranthaceae, Gise I aceae. Sarcobata-

, ir ■:. .■!:■; :;.:

most likely basal in Caryoph

some families, the colored peri;;

caceae) (Rohweder & Hubei

■ . i 1 ; I

: i v .1"; ■

Evolution in Eudicots and
Their Major Subclades

periphery of the inflorescence; [he petals ma\

■■■:■■ '.'i' >i '"I

■ ■ :■ ■.r:.:-:'i I ! " ■• ■

■

UUu

: ■ . . . . .

• .,,-, ,

asterids, Lamiales, Gentianales, and Asteraceae,

two carpels. They also have the most extre:
carpels, more rarely five or even more, and more <

i grade, have r

iii
More often than terids) there are

■ '>,! i;;'i:il '. ill,
'in I i:i!:'i

have more than two carpels, mostly three to five.

at share structural patterns in detail
& Grenhagen, 2005;
merger et al., 2010). An
>clade I of Marcgravi

The unusually

''! ' '
i I i i

■ ■■ : >• ;■,',;■ "
W I led.. : .

Tsou, 1998). Subclade V p.p. has

(Stevens et al., 2004). In suhcladc VI), nectar is not
produced (except for some Sarraceniace;

;

ii i I in ill ,in ; , 'e:. ii i .

lenberger & Friis, 2001). In subclade III,
itral placenta are

CORNALES

i Coris L. (Myrsinaceae). Otherwise,

re either inconspicuous areas of the upper

. , .

i; ' ■■

1 ii ni ' ill

fiord, 2001; Ge et al, 2007).

er integument is

i i II . i' ' i Ii

ill i ii

subclade TIT but not Sapotaceae (e.g., Warming,

' ,;iir,in.:,i;il.

and some Nyssaceae [Tandon & Herr, 1971]).

1968; Rao, 197? „ik Balsamina-

ERICALI"

(e.g., Tsou, 1994; McAbee et al., 2005). Ovules are

berger et al.. 20(

ill ,11 II I ■ I

I I I ' M

ide Va, the outer or

■ . ■: ■ ' '

• >■ ■ 'i;i!'!'

.: Kriis. 1985;
Nixon & Crepet, 1993; Kell!
nenberger & Kriis. 2001: Crepel el al., 2004;

rids, both < i { i I I fit

Is and with some \;

;

aginales (APG,

/' , ' .■■(.: I .- 1 1 - - : ■ .. ,1 '

irbar and Leins
(1996). However, this feature is probably a mere
consequence of a superior ovary, which is

1994), Rubiaceae (Erbar & Leins, 1996), and

so found in many
tapetal (and not illen sac placen-

« 1 ! ;;■"'! i i. ii i
Convolvulaceae). Petaloid se

The flowers of the small order Garryales are

i [■:.:;■■ i .■ I. ■

' > I

1 I i i , i

Eucommiaceae also lack sepals. Ovaries a

i,: I, i i

icubaceae, Sato,

Tli ere is a conspicuous [rend to form mom

especially in Lamiales (Kig. 10) (Reeves & Olm;
2003). Monosymmetry is especially expressed i

ead et al., 2001;
Tank et al, 2006).

s are most common, in

lta:'-.i i; ■

ress, 1999; Mayr & Weber, 2006). Flora!

il ) peciall

the concave upper lip (Fig. 10) (Endress, 1991:

V..-L-.T. :•:
2007). The

(Endress, 1998, 1999). For

■king in Lamiaceae, Acantha-

' ■; ■•■■'■■■' '■ ■'!

(Endress & Stumpl', 1990). In certain cases, ihe

:

ili i

. .',:! i, ..: ■ II „ <U-.
not support a pos :eae or Bignonia-

(Tank et al., 2006; Albach et al.. 2009; Xia el al..

' ^ i i J. i i - ■ iv>.

i i II

->■ i: ■>

1998; Phrymaceae. Kckardt. 1937:
Bocquillon, 1863; Plantagii

.■■ii'! ;ilh',i» .1 n i

. .':■ 1,1 .':■... I'.i

stamen and one of

'I I. whereas in ll

c/r?V/ ham.. Ipomoea
roin, 1992).

there are groups with the coir
zone and there

/ .' in

:■;■.) a c i :r. ;:,. T :

Evolution in Eudicots and
Their Major Subclades

1985), Gentianaceae (Killing el aL 2009), and subclades.

2001). The ovule; res. CAMPANULIDS (EUASTERIDS II)
They are tenuinuce . lenuinucel-
. , ■ - J !. i ; —
but an endothelium is lacking and endosperm w
haustoria are alj
I! .

■ ■, : ' in.-.. /M'.rn.
Gentianales earli i lies, sueh as In addition to the pa

Menyanthaceae (<■;

i [ lunulids are char-

.;n-l ." .■;■■!! ! ' "■ '"!■■■:■ '

Inoue & Tobe, 1 99'

Polypremum L. (eai parent (Erbar &

endothelium and a haustorial endosperm (Moore. I«'i"s, IWfi). This is

! n; v.-.- ■
BORAGINALES f1oral a P eX becomes

! I

onl) short free |

nl 'i

wren early and late
and Lennoaceae an e primonlia: either

I! 1 ' ' I , II L i

^■. . ■ : ■ ■ ; ih.; ;

• . ■

nil thus have a

>■■ i.s, : • ■-. •.-.:'.''....•

' i i, I ii' I

(Asteraceae, Calyceraceae, Bru-

■ m! i i ■' ! I " |- .i'
V:: . l'. l :-(,-. .: • .: , \ ' i-T ;

The unplaced famili some Pittosporaceae).

II,': nil a,r; <■.. '

' ' '• " e \0UIFOI I VI FS

»mic ovules

I ' !' - i - i i I "i

. i H,

:.:•< -!|

to buzz pollination are almosl

; ■ ■■ ■ ■' ■ ' . ■ ■ '

egument, not only
endothelium.

ESCALLONIALES 1915) and V .lit, 1921; Inoue &

Tobe, 1999); esent in parallel in

The two families

,,;, a .HI.,

petals, which tend

common, but were; not found in some families.
I an inferior ovary with more

J unstudied.

The assemblage of Bruniaceae. Columelliaceae.

ASTERALES mi males (APG, 2009,

! i. -I

Asteraceae, the most species-rich famih of tinctures. Shared

Asterales (and of all angiosperms). Iiaxe attained ( .h am( . tt . r , „f a ll three families are slight floral

the ability to pi;

especially in the largest subfa

et ah, 2008; Funk et ah, 2009). Although this their flowers to date.

\ersalilit\ is also

campanulids, it becai

aceae. A striking

II ' I in

upward b) elongation at the male - i

" ■ ■ ■:■:*. . !'=". h.
at the female stage (Erbar & Leins, 1995: to form polystemonous androec

androecium and ii so 2007a). Commonly, there is only one o

that pollen presentation on the upper part of the style r even per gvnoecium (Karehed

- : *■;■■', .:■!.■■■■. '. til ,..■.:

Vijj;\, ■'..■.; .-■. : ■.■■.Mh li.l.ii..!!'. ■.:!..■■■■. : I II - ;■ ■ ;,■■;, :,ih

uon. Some of the
■ ii ill their floral

ceae, Rosen, 1932: sen, 1946), phyllaceae).

i in |)||>s\(\ihs

lominantly monosymmetrie in

3 (Alimov

Volume 97, Number 4

Endress

2010

Evolution in Eudicots and

Their Major Subclades

moiioswumetn in Ca mloliaceae may he based on

stud at hi her systematic lev

nth & Donoghue,

features of imi

, ith larger clades t

i.hh ...IT : , ■

ment nuinhcr a

,,,.! ,,: i.

in at the apex, fh

•,ree and directioi

pioieclive in hud (Roels & Smets, 1996). Floral

-encc or ab.enc.

hairs on the corol : .-a-pensor ma) be

»: :l|>, II ii i .:■ ■■ I .VI .,

asterids (Wagenitz & Laing, 1984). Carpels ( el has been consid-

are weakly crassinucellar in Viburnum (Ado the proembryo, Albach et ah,

/..... , ;' ■ -in- i !i-: ■■:

nucellar.

I I

PARACRYPHIAl RS

'ii i ni i i, . II
' ■■'■■' ' I

1 e in development, at

parts. Sepals are

more than 10 (Gil;

a (Crossosomatales, Sapindales p.p., Malvaceae
also increased, up irthews & Endress,

I" ' '' i

shaped with a

Another unusual feature in Paracryphiaceae is that

imi el ah, 2003), and some
from their allcrnai

elopment in flowers

e not been comparatively studied previously. It

(I in basal angiosperms has been re< ml study that petals

. . - • nl

monaceae in M in 1994) are not retarded in development but overtake the

also tend to have broad (nol narrow I

ovules, and in O may even be clades show a

•' ^ ' ' ^ ; .

Mat I hews & End-
support a close rela r & Endress, 2009;

structure and de

badly needed. facet to the old and

w I) Outlook needs to be e:

developmental detail.

: Hi Hi

the characterization of larger clades (from the top of
chy downward). (1) Structural
features of the sp

1 are a promising field of poll

elaborate monosymmetric flowers i

(feature 9) in

■■> ■■> ■■'

Fabales of the nitrogen-fixing elade, i

.,i 1 ili

and in core campanulids. It is of inten

»t to explore to

separate work.

across eudicots or across subclades

of eudicots are

based on the same genetic machinery

floral features m

they may be (e.g., Ci

dwu-sed for s;-

appears that genetic systems for speci

fie features are

a position in

are not manifested there. An example

structure responsible for floral monosy

groups of core eudicols. which was

earlier in eudicot evolution than in the

with monosymmetric flowers in which

detected (Cubas et al., 2001; Howart

a & Donoghue,

•articular features

ill ( < II ill I ' ..* II '

■ Mill V.. H-|; M

the generic level in spur evolution of Hale

i; .■! ■ ■'!■..•■■■!• = .;i i in

Mil '"'. ,m ' . .

tematic level- i

these, in addition to ecologica

. !i.-; i. Til

|.,; '■ li 'i '

rovation in this clade. In

,,,,,! II, 1 ill Mm,

.symmetry is more elabo-

rate and has been a key in

novation leading to great

lomenon apparent in this

•ily active or unstable as

likewise regions that are

evolution. For instance,

dyna 11, LL -n

floral features
;ists, embryolo-

atures of parallel tre
r and in what aspect:

■nlal genetic eontex

,, 11:269-272.

'.Ibid, I). '': ' ' . . '

ml 1 i 'i I hi' i ' i i i i i I

:»: 212-262.

, K. Yan. S. 2009. Phylogenetic

placement of Trlaenophora (formerly Scrophulariaceae)
with some implications for I he phvlogcny of Lamiales.
Taxon 58: 749-756.

Science 257: 1491-1495.

. : ■■.:■,,: :,:

^ iko\l(\ (((liloi). ( ompauiti\( Fml)i\olou,\ ol Howciinu,

. 1987. Aucubaccac
Comparative Enid

in " ..hi ,

Salpiglossis (Solanaceae) and the oblique gynoecium. J.

plants: APG III. Bot. J. Linn. Soc. 161: 105-121.

Evolution in Eudicots and
Their Major Subclades

:

Lamk. Phytomorphology 3: 88-98.

'.,.1, i/i i

Sci. 168: 1237-1253.
& . 2008. He

•

..hi. mi !

Bot. J. Linn. Soc. 159: 499-571.
Backlund, M., B. 2000. Phylogenetic

,im, G. Coal, H. B.

Groom, N. D.

Mitochondrial DNA suggests at least 11 origins of

I i if

in parasitic plants. BMC Evol. Biol. 20(

, M. BemliJ

Madulid & T. Schumacher. 2008. Acceleraled rales of

Biol. 18: 1508 ]

■-.■■.

■!

117-4(4.

Kubitzki & C. Bayer (editors), The Families and Genera of
Vol. 5. Springer, Berlin.

I the species-poor relalives oi Legumi-
nosae and Polygalaceae. Ann. Bot. 100: 1491-1505.
, A. Bruneau, F. Forest & J. A. Hawkins. 2009.

J. A. Ha

in Polygalace<

ales. lnl. J. PI. S
Amer. J. Bot. 62: I

: ■;... I! i,i ,, . ■ ,i I.

remark on embryogeny in Pholistoma. Amer. J. Bot. 96:
565-579.

:<u II :: , I'. ,-;-.,,

Bernardello, G. 2007. A systematic surve) oi floral nectaries.

' !■■ ■■:,■:..]

1-100.

'■ - ■■ ■ ,!l ■!.:■ Hi-. :,

ment and systematics in Flacourliaceae s.l. PL SysL. Evol.
215: 141-155.

■' ,-,!■,.,, : ,!

& M. Gupl

wicklung. Flora 88: 253-318.

Blarer. A.. I). Mckrcnl «K I!

'■mm " ■■ii,l '"i ■ " "■■ i ! i ■!•' ■

15: 119-142.
Bailliere. Paris.

.1 morphology and Boese
:eae (Sapindales), rek

I'.'
niales-Polygalales assembly. Acta Bot. Neerl. 43: 15-25.

. I <■■■":■■■

& F. Bouman. 1978. Dcwl

- , i, Mi;:, ,:,;;., J ; , | ■

Glycosmis cf. arborea (Roxb.). Acta Bot. Neerl. 27: W-71).

& \\. Bel.
Geranium pralense L. and some other representatives of the
7: W 78.

:

: ac). PI. Svst. Kvol. 251:
53-70.

Andreasen, M. Hjertson, J. Lundberg, M. Backlund & B.
Bremer. 2001. A phylogenetic analysis of 100+ genera and

: ,. , " i ;;, ..mm:

137-169.

Breteler. F. J. 2<

Cassipourea (Rhizophoraceae) in continental tropical

idcnhlicalion ke\s. and desci iplion ol two new species.
Edinburgh J. Bot. 65: 407-121.

I 111 : li I!

Crawley. A. Dhingra, K. Hilu, P. S. Sollis & 1). E. Sollis.
2009. Phylogeny of the Caryophyllales and the evolution of
the perianth. Int. J. PL Sci. 170: 627-643.

. ' ■:■■ ;, !:,!' ,.■:.-,■'

phylogenies with incomplete data sets: A 5-gene, 567-
td\on diidhsis ol angiospeims. BMC Evol. Biol. 9: 61.

I I

Les, B. D. Mishler, M. R. Duvall, R. A. Price, H. A. Hills,

Y.-L Qiu. K. A. Kmn. J. H. Rcllig, K. Conli. J. I). Palmer.
.1. R. Manhart, K. J. Sytsma, H. J. Michael, W. J. Kress, K.
A. Karol. \\ . I). Clark. VI. Iledren. I!. S. Gaul. K. K.

Furnier, S. H. Strauss, Q.

Soltis, S. M. Swensen, S.

Quinn, L. E. Eguiarte, E.

Golenberg, G. 11.

Graham Jr., S. C. H. Barrett, S. Davanandan & V. A.

Albert. 1993. Phylogeneti

hen, L., Y. Ren, P. K. End

ress, X. H. Tian &

2007. Floral development

of Tetracentronsinense (Tracho-

ma. PI. Sysl. Evol

264: 183-193.

). C. & J. F.

' !:■,, ' i.!i M .

439-441.

■' f ■ i i ■ !

reproductive outpul in

(Erythroxylaceae). Biol. J. Linn. Soc. 88: 465-474.

la fleur et du fruit des Convolvulaceae. Bull. Mus. Natl,
ziana 11: 75-105.

I -MM II

2009. An ortholog of MIXTA-like2 controls epidermal cell

. •:.;: , ■: Y"^.

m.I,: hi, I

23: 417-438.

. 1916. Zytologische und embryologi

Svenska Vetenskapsakad. Handl. 56(

& R. F. Thome.

...1. 71:633-6'

was recent and rapid in the world's largest flowers. Curr.

102-R1104.

& M. W. Chase. 2C

—

Donoghue. 2005. Explosl

Amer. Nat. 165: E36-E65.

, M. Latvis, D. L. Ni

Baum. 2007. Moral gigantism in Rafflesiaceae. Science

315: 1812.

1

ic Embryology of

sperms. Wiley, New York.

I)c Block, P. & A. Igersheim

.. 2001. Stigma of

genera Rutidea and \ichallea (Rubiaceae-Ixoroideae-

i-hh modii'iec

Sc-i. 162: 567 578.

S. Blackmore & S. H. Barnes (editors), Pollen and Spores,
tion with molecular data. Int. J. PI. Sci. 161: S121-S153.

I()()7.
Entwicklungsgeschichte und systematische Bedeutung

II 12.

Evolution in Eudicots and
Their Major Subclades

Deutsch. Bot. Ges. 68: 167-182.
embryology of Eucomm

::

I In I' I il !

".. Syst. Eve

trospermen. Bt

sLand. Hasellonia 8: 2-9.

& P. V. Bruyns. 2000. A r

Apocynaceao s 1 . Bot. Bev. 66: 1-56.

melidaceen und Betulaceen. Bot. Jahrb. Syst. 87:
431-525.

'..■:■

polyandra Sieb. el Zucc. Ber. Schweiz. Bot. Ges. 79:

he Bedeutung. Bot.

: 436-457.

Fagales-group. PL Syst. Evol. Suppl. 1: 321-347.

Trochodendrales. Ann. Missouri Bot. Gard. 73: 297-324.

, -II ,

08: 417^38.

didaceae. Taxon 38: 371-37*

n of the
the lower Hamam<
Evol. 162: 193-211.

. l ( >;;<)<-.

perianth in Achlys (Berberidaceae). Bot. Acta 102:
159-163.

II,. I;,:,!,.,.

Hamamelidae, 1. Clarendon Press, Oxford.

]■■.-;:■ ■
ceae. Pp. 193-200 in P. B. Crane & S. Blackmore

■ 'liii'ir:.: !'/ :i! ■■

.1990. Pali <-

surroun

S106-S122.
. 1994. Di

. 1995. Hoi

. . ' ■■ • < ■:. ..

for the next century. Pp. 99-119 in K. Iwatsuki & P. H.
Ka\en (edilors). E\ olulion and l)i\ ersificalion of Land
nger, Tokyo.
. 1997b. Belationships between floral c

ceae). PL Syst. Evol. 20l

133-140.

, ,,, I ; . I

Biol. 4: 86-91.

; . ■ >. : < = ! i;

291: 105-115.

2002 M 7 1 I j md angiosperm syst

f',: 545-570.
. 2003. \\ le" morphological

plnlog.MiclH anahsis cnldil." Pp. 131-164 in I. F.

Stuessy, E. Horandl & \. Ma\ei (editors). Deep

Plant Systematics. Regnum Veg. 141. Ganlner, Ruggell.
floral morphology. Curr. Sci. 89: 749-754.

Evol. 175: 101-114.

.'■ : . "• :' . of '.i:,i,,.,.|

structures in "lower" Bosi

1107: 217-293.
& A. Igersheim. 1999. Gynoecium d

m stenotics of the basal eudicols. Bot. J. Linn. Soc. 130:

305-393.
& E. M. Friis. 20( 1

& M. L. Matthews. 2006a. Elaborate

.1.6:257-293.

I " ' II . , ■!

Biol. 10: 52-57.

and its initial specializations. Amer. J. Bot. 96: 22-66.
, M. Jenm & M. E. Fallen. 1983.

' >:>..,:: ■ .;. '.: :! I

Bot. 3: 293-300.

, P. Baas &

and analoim: 50 .e,n m

12: 417-451.

■'■;.;■,: i

nocleaceae, C

' . . . '. i ;i

■ . ... ,

109: 427-440.
-

Biol. 1:389-402. ulai i. I. .« in < l<. pollen m.,i|

: ,my: Evol. 263: 77-92.

Ganders. F. 11. 1979. The biologv of heterosis. JNew
. 607-635.

: , ' ■ ,i ' i ,,, i , , ii

. 1945a. Ban <l Ge, L. P.. A.-.M. Ln & C.-R. Cong. 2007. OnLogeny of ihe

PL Soi. 168: 835-844.

— . I

development in Parthenocissus Inserla. Canad. J. Bol. 67:

gische Studien'in der Familie Olacaceae. Bot. Not.

1356 1365.

1947: 207-230.

...I. Jahrb. Syst. 58: 244-248.

.

Tidskr. 42: 195-229.

alien, M. E. 10

systematic position of Allamanda (Apocynaceae). Amer.

J. Bol. 72: 572-579.

Jahrb. Syst. 106: 24

'7: 101-206.

1 mii i ; i

Hakki, VI. 1. IT

Hot jahil) Sxsi. 02: 178-330.

Hall J. C. H. H.

i flowering plants. Evolu-

ml Syst. Bot. 29: 654-669.

Merkmalen der Angiospermen. Ber. Deulsch. Bol. (>s. 90:

369-384.

& P. K. Endress. 1990. Origin and e

... . „

Jol. (,es. 76: 70-72.

lilqiusl. 2000. Floral

in plant PI. Si

Suriana maritima L. (Surianaceae). J. PL Res. 107: 29-37.

Evolution in Eudicots and
Their Major Subclades

nian (Lale Crelaceous) of cenlral Georgia, USA. Int. J. PI.
Sci. 156: 93-116.

■.».!.!:.

"Umtiza clade." Int. J. PL Sci. 164: S393-S407.
Amer. J. Bot. 90: 1373-1388.

1 , In, i

extinct taxa on understanding die earl) evolution of
260: 141-169.

!■■(/. ..I. ■!..

megagametophyte in the genus Ilex L. J. Elisha Mitchell
5: 107-128.
Hiepko, P. 1<>.

Paeoniaceae. Ber. Deulsch. Bot. Ges. 77: 427-435.

of developmental genetic dala to reconstruct perianth
evolution. Amer. J. Bot. 96: 83-95.

II. L A. Alice, K.
Evans. H. Sauquet, C. Neinhuis, T. A. B. Slotta, J. G.
Rohwer, C. S. Campbell & L W. Chatrou. 2003.

tion. Amer. J. Bot. 90: 1758-1776.
, C. Black. I). Diouf & .1. G. Burl

Pp. 123-166 in H.-D. Behnke & T. J. \labr> (editors).

Wall, ex DC. ini Vergleich mil

Dipsacaceae. Bol. Jahrh. Svst. Ill: 499 553.

Syst. Evol. Suppl. 9: 119-131.

I ! i , . I

■I ...' ..

402^19.

stemonous Hydrangeaceae. Amer. J. Bot. 85: 1057-1067.

:.■.?■.■

geeae (Hydrangeaceae). Bot. J. Linn. Soc. 137: 139-187.

subfamily Loasoideae. Int. J. PL Sci. 164: S409-S439.
& P. K. Endive. I WW. The ,|i x «.,,i

dae. Hoi. J. Linn. Soc. 99: 301-316.
Hunziker, A. T. 2001. The Genera of St

lluggell.
lgersheim. A. 1993. G

>1. 187: 175-190.

- cK P. K. Kndrcss. 1998. Gvnocciu

tematics of the paleoherbs. Bot. J.

. 50: 75-79.

. Evolution of petal identit)

alternative to zygomorpb

2008. Evolutionary
102: 153-165.

be Delphinieae (Ranuncu

/ .',.'. •,■!■■.: i<-i .-:?■■■:■

Int. J. PL Sci. 170: 794-813.

Ini,

Int. J. PL Sci. 166: 3!

(CYC/TB1) clade reveals duplications predating the core

Huang, T.-C. 1980. The Apocxnaceae of Taiwan. 2. A
pal 1 1 I idy. Sci. Rep. Tohoku Univ., Ser. 4. Biol.

39: 75-102.

104: £
Jager-Zurn, 1. 1965. Zur Frage c

Bliiten- und Infloreszenzmorphologie. Oeslerr. Bot. Z.
112: 621-639.

.. I'. ; ' .'

B b 1 Malvaceae s.L). PL Syst. Evol. 275: 69-91.

::::.. ■■■■ii:..

S. F. T. VI ere I.

iolec. Phylogen. Eve
. Species Plantarum:

. , !
'"
of the Sanlalales 1. Proc. Natl. Inst. Sci. India, B
26(Suppl.): 199-220.

lie anahscs based on moiphological, anatomical, and
embryological fealures. Brillonia 45: 99-114.

mpbell, E. A. Kellogg, P. F. !

Donoghue. 2008. Plant

. ■ : i I M ..1 : ;!,

kad. Handl. 58(5): 1-81.

nim Hook. I: A

Edinburgh J. Bot. 62: 127-144.

flower morphology in Gentianaeeae-Suertiinae and ihe

■:■■ W.

■ . ' ::,•■ !V ii,i

Morinaceae. Nauka, Leningrad.
. 1984. To 1 1 ,

(Escalloniaceae). Bol. Zluirn. (Moscow & Leningrad) 69:

1304-1316.
. 1985. Zygophyllaceae. Pp. 145-152 in T. B.

Batygina & M. S. Yakovlev (editors), Comparative

Embryology of Flowering Plants: Brunelliaceae-Treman-

—

Davidia in mineral a (l)avidiaccac). Bol. Zhurn. (Moscow &
AY.', 212.
& V. A. Konnova. 1990. Embryological c

Biebersleinia. Dokl. Akad. Nauk Tadzhiksk. S.S.R. 33:

193-195.

seed. Bot. Zhurn. (St. Petersburg) 83(2): 9-20.

gen an Rosaceenblulen. Bol. Jahrb. Sysl. 93: 175-246.
Kapil, li . A . II

• ' ■

" i'. ; '

Embryology and systematic position of Garrya Douglas ex

. 2003. The family Pennanliaceae and lis
relationships |o Apialcs. Bol. J. Linn. Soc. 1 11: 1-21.

45-62.
. 1982. Eml.r

Cim, M., M.-L. Cui, P. Cubas, A.

ferred between species. Science 322: 1116-1119.

CisslingJ.. P. K. End

■ . ■ .

Korotkova, N., J. V. Schneider, D. Quandt, A. Worberg,

Zizka & T. Borsch. 2009. Phylogeny of the eudicol or,
nalysis of a recalcitrant clade w

sequences »l die pelD group 11 inlron. PL Sysl. E\

282: 201-228.
Kramer, E. M. 2009a. iquilegia: \ neu model for pi

development, ecology, and evolution. Anriu. Rev. PL B

60: 261-277.
. 2000b. New model systems for the study

— & V. F. Irish.
men developmen

je, J. 1942. Staphyleaceae. Pp. 255-321 in A. Engler &

era of Vascular Plants,
nger, Berlin.

(■.>■. ■.!=.,, 1 1; < ■■■■.•:.

: ,:. ■: ■ .ii ■. ■;:;..■ .!

licdtion. Ssl. Bol. J J

■.■:■:.-. i '. '

,ch. Bot. Ges. 1

1988. Das zentripet
ahrb. Syst. 109: 555-
— &S Schwitalla 1985
E ge B e k igen

Bliitenentwicklung von
Pereskia. Beitr. Biol. Pilanzen 60: 313-323.

ii 03: 157-178.

>ecia in Dilleniidae
and some remarks on iii
104: 336-344.

''

Bot. Jahrb. Syst. 127:

■■■■■■

, A. \\ allej

Interpretation der Cai

Evolution in Eudicots and
Their Major Subclades

Aquino. 2008. Biologia reproduliva de Ruiirea inciuta
Planch. (Connaraceae). uma especie heterostilica de

2005. legumes ol the \\ mid. Fundi Botanic Gaidens.
Kew, Richmond.

cium of Pyroideae and Amygdaloideae (Rosaceae). Bot.

Jowl. D. G. &
Evolution and Function of Heterosis h. Springer. Berlin.

Sluessy & R. J. Ba^i (editors). Systematica. Evolution,

Luo, S., D. Zhang & S.

S. Renner. 2006. Ox

< "1

98: 459-464.

Macdonald. A. D. 1980. Organogenesis

of the female

Magallon, S. 2007. Eron

the core eudicot floi

xifragales). Syst. Bot

, P. S. Herende

decandra: Floral re.

nains of the tribe

gia, U.S.A. Int. J. PL Sci. 158: 373-394.

, P. R. Crane & P. S. Herendeen. 1999. I

tionships within Sennc

i (Leguminosae,

>lutionoffl. 1 neti

[. Bot. 93: 288-303.

lartinez-Millan, M.

■hisciculandncus gen.

et sp. nov., a

>wer from the Rantan

nian, Laic Cretaceous).

:

sliuctuie and sWemii

Connaraceae, Cephalotaeeae. Brunelliaecae, Cunonia-
ic, Tremandraceae). Bot. J. Linn.
Soc. 140: 321-381.

Cucurbitales (Corynocarpaceae, Coriariaceae, Datisca-
ceae, Tetramelaceae, Begoniaceae, Cucurbitaceae, Aniso-

<"
svslemalics in Celasliales (Gelasliaoeae Painassiaceae,

Lepi<lol,olr>aceae). Bot. J. I inn. Soc. 1 19: 129-194.

•"

ceae. Ixerbaceae, Strasburgeriaceae). Bot. J. Linn. Soc.
147: 1-46.

- :

162: 963-983.

& B. M. Johri. 195(

.. J. PI. Sci.

haceae. Bot. Mag. Tokyo 69: 410^23.

.' ;..■,.!:■■

Univ. 27: 121-136.

i.l i, in 1 1 lolecularphylogenetic

Gaz. 152: I

W. E. 1940. The morphology of Lr
Juglandaceae. 11. The pistillate flowers and fruit. Amer. J.

:

■:-' In i. ini '.

. 1934. Etv iogie der Zygophyl-

34: 409-422.

grenzung der Reihen IV i
Not. 1936: 161-212.
. 1939. Coni ry°Logy of the orders

. M

Bot. Jahrb. Sysl. 89: 210-271.

343.

\L. H. K. Kuzoff & C. S. C.

i:.74-f684."
:

heath Acrotriche serrulata (Epacridaceae). Vnn. Bot. 57:
155-164.

. . ■ i ::-;■;;

.. ■. . i. " ■', :. ;■■-..
383-396.

family. Ann. Bol. 92:

and systematic position of Picrodendraceae (Euphorbia-

, ' (

Soltis. 2009. Phylogenetn analws ol 83 plastid genes

Natl. Acad. Sci. U.S.A. 107: 4623
Moore, R. J. 1918

ceae. II. Embryology of Polypremum procumbens L. Amer.

, i".

& W. Heins. 1979. Vergleichend-anato-
Trop. Subtrop. Pflanzenwelt 26: 1-53.

? y 13: 197-205.
Blanches bei der I

parasitas. Pp. 29-56 In J. A. Lopez-Saez, P. Catalan I
L. Saez (editors). Planlas Parasitas de la Pem'nsul
Iberica e Islas Baleares. Mundi Prensa Libros, Madrid.

: . :

, . . . .: • :.:

flowers of Kriealean affinity. Amer. J. Bol. 80: 616-623.

. ■• i /■' ■;■: .

Divers. Evol. 128: 247-268.

1 (.5-1 78.
Oh, S.-H. & D. ] n and phylogenetic

Syst. Bot. 31: 730

.:■; I; : . . . .

CRABS CLAW sequences. Taxon 57: 434-451.

i I I

27: 389-398.

1994. Reproductive structures of an extinct platanoid from

the Earl\ Cretaceous (latest Albian) of eastern North
Amrrica.' ««. Palaeol.ol. Palynol. 80: 291-303.

. . .. ' : '■•• .'■

; : I .

.«. J ■ I .

I' I ■ '

I! , ■,'.!:■ :■■■■.:■..

-

278 in C. H. ices in Legume

2004a. Floral development 'in Polv

with Leguminosae.
. 249: 67-76.

' ' .!<;■.

VI.

! . " , i! I!

Opera Bot. Belg. 7: 369-402.
Qiu, Y.-L. & G. F. Estabrook. 2008. Inference of
phylo; n t 1 itionships among key angiosperm lineages

Syst. Evol. 46: 130

.11 i,-,.
Soltis, M. Zanis, E. A. Zimmer, Z. D. Chen, V. Savolainen
& M. W.Chase. 1999. The ei

402: 404-407.

Evolution in Eudicots and
Their Major Subclades

. L. Li, B. A. Whillocl
Bernasconi-Quadroni, J. S. Rest, C. C. Davis, T. Borscl

■ ' .: , ". ' . ' ". ..

J.J.Cannonc.R.R.Guleh. \l.Poucll.\.Saw,lainen.l
Chatrou & M. W. Chase. 2005. Phylogenetic analyst

Int. J. PI. Sci. 166: 815-842.

. Hendry, R. Q. Li, D. W. Taylor, M. J

, Z.-J. Li, H.-L. Char

: 145-153.
. Endress. 2007. Floral

Hudson & Z. Chen. \n

from nucleotide sequences of four mitochondrial genes. J.

(m press)

the life-historj oi Vahlia viscosa Roxb. and lahlia

.lian Acad. Sci., B 15:
83-105.

.' .

Phytomorphology 7: 24-35.
. 1959a. Morphological and embryologii

phology 9: 20-33.

. II ' ,. I
Industrial Research, New Delhi.

I 75: 160-166.
in Polygala Linn. hid. J. BoL. 4: 115 121.

:

1966(1): 1-117.

(s [o Lind( islanding icgulaloi\ u,< n< lamiL diwisih. alion

Evol. 20: 1997-2009.
Reidl, G. & P. Leins. 1"

libuniurnjarren Slearn. BoL. Jahrb. Syst. 116: 1-9.

■CI, I •■■!< I M,„: ■ 'I, ■■,.■:■! : ■

trie der Bliite. Flora 121: 77-124.

biological obsen
iaceae) and other

Grimm. \. kocyan & R. E.

.. - .il.nologie (

order Dipsacales: A iiHillidisciplinarx approach. Doctoral
Dissertation, Catholic University of Leuven, Leuven.

&E. Smei

203 21!',.
rospermen-Studien 4. Morphologie
and \natomie der Bliiten. Friichle and Samcn hei

. -:: "•■■■■:■! : .
.;: ■

A ■ M > !

A crucial link in [he (solution of [lowers in ihe core
eudicots. Ann. Bot. 94: 741-751.

.. :>>.>•><

Bot. 100: 621-630.

in I ■
eudicots. SnsL. Bol. 3:

.'

II I II M ll Mil 1,1 | I , ;»;:•. II II II II

origin, and taxonomic significance. PL Syst. Evol. 191:
83-104.
& . 1995. The i

Selmeid

aceae. Syst. Geogr. PL 70: 155 I

osinolate-pioduciut; [

.■■;;■:.'■..

.271: 7') 91.

Int. J. PI. S«-i. 171 .
—
development of Pleuropetalum darwinii, an anomalous

, H. P. Lin, . L. Smets. 2001.

—

: :

233: 105-126.

Uruguay and S Brazil (Gunneraceae). PL Syst. Evol. 248:
219-241.

(

some Dilleniaceae. Bot. Not. Ill: 495-511.

71. Kmbnological slud> in \u, i
Thumb., with special reference to the unusual 1 1 j. L

of the embryo sac. Sci. Rep. Tohoku Univ., Ser. 4, Biol. 35:
201-206.

basal cauline placentation: Ha.sclla rubra. \mer. J. Bol.
75: 918-927.

J.-C. Pinlaud, M. Powell, M. C. Sheahan, D. E. Soltis, P. S.
Sollis, P. H. Weston, W. M. Whitlen, K. J. Wurdack & M.
W. Chase. 2000. Phylogeny of the eudicots: A nearly

Schick, B. 1982. Untersuchungen iiber die Biotech

Schnell, R. 1960. Note ■

'. .i,< -., (;:,[:.

Bot. Etat Bruxelles 30: 357-373.
Schoffel, K. 1932. Untersuchungen iiber den Bliitenbai

ceen. Planla 17: 315-371.
Schoncnbcrger. J. 1999. Floral structure, development
ac). l*>ol. L Linn.
130: 1-36.

. 2005. Rise from the ashes— The reconstructs

111. Sci. 10: 436-443.
. 2009. Comparative floral structure and system

Sci. 170: 1132-1167.
& P. K. Endress. 1998. Structure and developme

» 465.

— & E. Conli. 2003,

, .■'!:!!,,„ ,:: ;,;,
,1 :

— & M. von Balthazar. 2006. Reproductive structures

■ . ■ . II :.>»..:■■:■ '. .■,:!■;

.spccls. PI. S\st. Kvol. 260:87-100.
— , K. R. Pedersen S

,. \ .. •■ . ■■

, M.

von Balthazar & K

437-448.

;ny of Oleaceae

I. 1998. Ovule

i in (lowering

...i„i

ew approaches and concepts. B

. Bot. Gaz. 40: 209-223.

the origin.

I!

Rev. Palaeobot. Palynol. 106: 131-151.
Singh, B. 1961. Studies in the family M

Evolution in Eudicots and
Their Major Subclades

:

Univ. J. Res., Sci. 3: 324-341.

Sludien [ibcr die M\zodendiaeeen. kungl. Swnska
Vetenskapsakad. Handl. 51(4): 1-34.

the floral nectaries in the Magnoliatae (dicotyledons). Bull.
Jard. Bot. Nat. Belg. 56: 51-76.

., I,! ; ,;•. '

157: 621-631.

Nuralie\. 2007a. FW<

, G. V. Degtjareva, P. K. En

H. Samigullin & C. M. Valiejo-Roman. 2007b. Inflores-

Sci. 168: 801-833.

Yakovlev (editor), Comparative Embryology of Flowering
Plants: Phytolaccaceae-Th\ melaeaceae. JNauka, Lenin-
grad.

:'.oln-. iv i.. : . . . ■. : ' ■. "

' ■: !'!- i: • >■■«■ .!.

277-293.
p.:

M. Zanis, V. Savolainen, W. H. Hahn, S. B. Hool, M. F.
Fay, M. Axtell, S. M. Swensen, L. M. Prince, W. J. Kress,
K. C. Nixon & J. S. Farris. 2000. Angiosperm phylogeny
inferred from 18S rDNA, rbcL, and atpB sequences. Bot. J.
'•: 381-461.
■■. : ■■•.■! . ■■

Sollis, L. P. Ronse De Craene, P. K. Endress & J. S. Farris.
2003. Gunnerales are sister to other core eudicots:

Bot. 90: 461-470.

,. \" : :■:. .

phylogeny inferred frore

i multiple genes as a

, S. F. Brockington, M.-J. \oo. A. 1

Lalvis, M. J. Moore, A.

in. 1 i i , ill in

angiosperms. Amer. J. Bot. 96: 110-128.

96-105.

Slaedler. Y. M. & P. K.

Endress. 2009. Dive

ol core Laurales (Gomorlegaceae. Alherospermalaceae,

Stephens, E. L. 1909. The t

sue. <hllp:vvw

iearch/APweb/:

..I. i ,i,i. .„. :. i . r

R. K. Crowden, A. S. George, G. J. Jordan, P. Ladd, K.
Lemson, C. B. McLean, Y. Menadue, J. S. Pale, H. M.
Slace & C. \1. Weiller. 2001. Ericaceae. Pp. 1 15-19] In

Planls, \ol. 6. Spun

M „., . I MM

61(14): 1-56.
. 1928. Die nophyllum alterni-

I •

ress, Oxford.
Cansjera rheedii. Phytomorphology 10: 397-409.

■ I., i: ih. Ill ill.

.s. Int. J. PI. Sci.
169: 1288-1303.

phylogenetics based on rbcL, trnL-Y, and ndhF sequences.
Amer. J. Bol. 89: 1531-1546.

,;,

Conli, J. Walker & P. G. Wilson. 2004. Clades, clocks,

hemisphere. Int. J. PI
Takahashi. M.. V vn c\ P. R. Crane.

2008. Fossil flowers or Fagales from the Kamikitaba

Japan. Int. J. PL Sci. 169: 899

hi In ,1 ,i \. II . ' II II rani;.. | ,in i In

Bot. 49: 505-514.

Tank, D. C, P. M. Beardsley. S. A. Kelelii

i. [i lull I
iaeeae s.l. and [heir cm
19: 289-307.

mbryol

application to the syste,

' >_>: 351-367.

-K ,„h

|)(.sili.)n.)[//r/r/ f v>n/s(MMldl(s) Amer. J. Bot. 74: 197-208.

31: 119-127.
& N. R. Morin. 1996. Embryology and e

literature. J. PI. Res. 109: 425-435.
& P. H. Raven. 1996. Embryology of

•:..;.■
ties. Amer. J. Bot. 95: 1475-1486.

ceae sens. str. J. PL Res. 119: 599-616.

and systematic* of Lecvlhidaceae. Mem. New York Bol.
Card. 71: 1-110.

linandra, Cleyera and Eurya. J. PL Res.
108: 77-86.
. 1997. Embryology of the Theaceae

Amer. J. Bot. 84: 369-381.

. I II I ill i I I. I i , n Hi i i

(Theaceae). Amer. .). Hot. 85: 1531-1547.

evolution of the Lecythidoit
Bot. 94: 716-736.

e (Lecythidaceae). Amer. J.

ialion and development in

131: 911-926.
. 2006. Floral

,11 if i

lea 13: 177-394,

3 . Blumea 23: 349-369.

Sysl. 109: 17-23.

. 1995. M<:

vitifolia Willd. and Malope trifida L. (Malvaceae-Mal-
i::5 |«>:;.

,ul seed coal

— . 1985k

Crassulaceae et Saxifragaceae. Comples Rendus du 93e
Congres National des Societes Savantes, Tours 1968, Sect.
Sci.. 111. Biol. \ eg.: 521 546. Bibliotheque Nationale, Paris.

I I

. 1997. Remarkable nectaries: Structure, ecology,

.. IK 1 ".'. .

Flora 193: 225-248.

:■>.>:<:,:. '
lato — A conspectus. Kurlziana 28: 155-171.
. i, II, ,
inflorescences and flowers in Buxaceae and the problem of
perianth interpretation. Int. J. PL Sci. 163: 847-876.

& K. ^1! n androeeium of

Schonenberger, M.'von Balthazar & M. L. Matthews
(editors), Flowers: Diversity, Development and Evolution.

& J. Sci ,ral structure and

organization in Platanaceae. Int. J. PL Sci. 170: 210-225.

..■:;. if :

, J. Schon

Dipsacales und ihre systematische Bedeutung. Bot. Jahrb.
Sysl. 104: 483-507.

II II, In „ I, .

W. Kadereit & K. Kubitzki (editors), The Families and

" , Li,:,-,. ...-;

ills on the systemati.

787-794.

C. f). Bell, S. F.
!■;■*■:■! c-.. '

Manchester & D. E. Soltis. 2009. Rosid radiation and the
rapid rise of angiosperm-dominaled forests. Proe. Natl.

i II

Evolution in Eudicots and
Their Major Subclades

' ■.■!;!!.:!■■ ;:,■)■: !

the eudicots. Amer. J. Bot. 94: 1828-1836.

,, i! i,,. 1:1
,.:

de Fovule. !

' ' •' . ■ : . i - 1 • ■■ ir .:: <

Vascular Plants, Vol. 7. Springer, Berlin.

I ' M 'l M> ' '' ' I

ceen. Abh. Akad. Wiss. Lit. Mainz, Math.-Naturwiss. Kl.
1955(11): 1-20.

Veber, M. &
Ophiorhiza (Rubia

i 107: 257

asymmetric flowei ol

Vicieae) and ils visrloj ■
& R. Class labiate flowers: The

i

& A. Webe of the Polygalaceae

nison. Bot. J. Linn. Soc.

129: 207-221.

... ,,j
ieleien<( to lh( |)Li( em< nt ol Dipsacales Li\on 57 5 5-65

Div. Evol. 7: 55-77.

, M. H. Alford, D. Quandt & T.

Huerteales sister to Brassicales plus Malv;

A-. I!-. C-. and K-cl.i-

& C. C. Davis. 200

Bot. 96: 1551-1570.

Z., Y.-Z. \\ ang & J. F. Smith. 2009. Familial placement

96: 519-530.

. . i :, :i
function and evolution. PL Syst. Evol. 6(Suppl.): 1-268.

. BMC Evol. Biol. 7: 217.

ASSEMBLING THE TREE OF THE Thomas J. Gwnish? Mercedes Arm,

MONOCOTYLEDONS: PLASTOME
SEQUENCE PHYLOGENY AND

i . ■ i 1 ■ i 1

EVOLUTION OF POALES 1 Wendy B. Zo G. Briggs,* Melvin

R. Duvall, 9 Michael J. Moore, 10 J. Michael
Heaney, 11 Douglas E. Soltis,
Kevin Thiele, 13 and James H. Leebens-Mack 3

' . ■..'■■ : ■ ■ . . ■.

'. .-

i ( ommelinid orders with n
:s allies) are well supported as siste s a xyrid clade (Erioc

1 This research was sup] ience Foundation (NSF) g

.> 1.1' the Mcii

provided access to data

11 "

',". ! !■■ >■>' -..r.i

: ■.■■■,■,!■ .!■.■! I , ! i i i I
'.■•'. ' '.

I :i ii !!.,! ■ in • i c

: 0()()2, U.S.A.

" ..:.■■ . r,\

5 Department of Biology, Pennsyh an 1 6802, U .S.A.

, ^ :<:,' ■:■»,.■

8 Botanic Gardens J ulh Wales 2000, Australia.

! i , I i III

'"Derailment of Iholo^. OIm-jIjii ( olle S e. Ohe.lm. Ohio 11071. U.S.\.

1 '

12 Florida Museum of

"Western Australian Herharium. Perth. Western Australia 6983. Australia.
■, 72010023

ri Bot. Card. 97: 584-616. Published on 27 December 2010.

Key words: Commelinids,

i '!

Monocots — with ca. ■

• ! : !"■': ■■!■■ " ' . .

>erm Phylogen

most dherse, inn

ind economically i
angio<-permr.. Since

ried, ecologically

;i .il.il

. :

ill I I

/ , "

i I !l li urn l i ill a i n I I ill I 111 I I I IN, I III II III i I

evolutionary biologists.

Over the past 18 years, molecular systematics has

, , ' ■ ,'l !■■' -ill . V

b, 2000, 2006;

l: .:i ;i .<!..

1999, 2005; Brem .™ s et al., 2001;

'■I •' V ' ■! .

Ill

onships to each other that remain i

included the validation, to a large degree,

l"l I i I 'I .1 I" i I

i I in

InI II

; li-; . ill i ...'.?;

ia, b, 2000, 2006; Zomlefer, 195

of the aquatic la

ma mm. 1976; Dahlgren et al.,

: : ::

i- i
i nil i \-. I li i II in ■::■" ill v. -v-v "., ' ';. -

Chase et al. (2006) provided the most powerful

■.■■:; ,< ll'i; II 'i-iii; :'.,
. ■ ■ .

lid clade (Chase et al, 1993, 1995a)

parsimonj (MP) analysis,
ster to all other in,

and their allies). on Chase et al.

' ' ' ' ' ri,...:l !i':i ■ .::

), 2009, here reco ships within orders

plastid genes (rbcL and nuitK) for repieM n' i i . I nmelmid- and \spar-

ca. 2400 monoeot geneui. I he-e efloit- aie eomple- > .juenced included members of

while the Europeans link our backbone phylogeny to .-'iigle lamilies in

.a. We are jImi c ollabo- Arecales and Dasypogonales (Dasypogonaceae sensu

w Angiosperm Phylogeny Group, 2009). Nonmonocot

sendix 1). We used
leled amount of gr
plant genomes obtained in our AToL projecl et al., 2007; Moore et al, 2007) as

'!- : '■ i -■ ' ' '■ er>''

any major plant group studied to date.

In this paper, we present a demonstration of the plastome SEQUENCING

focusing on relali,

Poales is Lh ' e « ies - Following methods described by Jansen

I,., Ho.sta Tratt.,
quenceofitsinelu

I. ....II I . . ' '

The 83 taxa include.

Group (2009) (Appendix 1).

vere generated

for each taxon. De novo assemblies

of sequences

1 i ip

:■■, :' I -lei

2004). Resulting assemblies were in

Consed (Gordon et al, 1998) an

3S were anno-

.. I.'! i U : 1 .; ',:

;rver (<http://

.

' : ■ ' . . ' HI '

(Ratan, 2009;

available '

. ill i.i i I

f closel) rela

genome sequences were used as alternative references

i i , I

tated and extracted from the resulting contigs using

DOGMA. DOG\l through BLASTX

o acid sequences

rare sequencing

i In.. 1 ii .

. ! ir i. ii:' ■

■ ■ ■ ■ '■. .'II Hi II. ' r-

. I".'.

' ^ . i I i ii! . i '

Ucata (Hook, f.) Newell & B. C. Stone
. mry direct sequencing. All gene

-
I i . . i i

with a total of

i'.) ! .'.i:;i ,ii ■■}

and alignn

:■!-.( .,■:■..■:

lences extracted from DOGMA
) multitaxon fasta files
lign gene sequences using MUSCLE

(Edgar, 2004), and to
N file. M g g

concatenated alignment.

■•' i" ■■.:> IT..'. i i i;

■ I v>'- 1 1. Ms- ■■■■.

. , ,,, .

Gapped cells were treated as missing c 1

lands of equally most parsimonious trees
searches seeded
iploying tree

i ■ t i . . I " . '

, ' ; , / I I

il>i ... ihli-lllll

homoplas) in the data (Givnish & Sytsma, 1997).

• ■•:■ I- ;i;.-;i.!|.:-v
: ' IIMili'- "■ -I. ' '•

2004). A single; i was modeled as

was modeled using the discrete a

son & Maddison, 1992) to infer an.-.

i n

i -Live ecologies, we separated

n ii I

sampled (a suJ

I i + the PACCMAD-BEP clade
-

loideae, Centothecoideae, Mi-

-i . .. -.:■::■■'

:

' in ii ,11
Clark et al.. I9«;

son et al., 2007a, b; Bouche-

drained or (In )

,,!(■! I ' ii i

|( i: I' ■: - >, ' Iclirr :

(1985), Givnish el al. (1999, 2000, 2004, 2007),

ii I iied as ingroups

;

i i

. I! , iii

II., il U: . , ^ . . .

et al, 2007; Moore et al, 2007; Whitfield &

■'-■:■.(■ ■,

■: ' I >' " H .11,1111

et al, 2000. >

,, ' ■ i I I I

es within those families (Appendix 2).

van der Pijl, 1979; Regal, 1982; Cox, 1991; Linder,

1998; Weller et al., 1998; Givnish et al., 1999; Cully

)08). To evaluate

tests of correlate*

■: .

. IDMH..;. I oil i <,■■::■

:

u\ models (Pagel & Meade, 2006

■■■ i I -Till hi"!'

i : i ',v,

I i ii 1

I ' I 'i '

all laxa in the ML tree (see

i I i

■■'■I' I I' ". ',

ll Hill I, i,i I ' I i

V' 111 III V, 1 lh.

plants via nV

(1971, 1979), Henderson (1986), Stiitzel (1986, 1990),

ListabarthllO"! ,.

: ,

;-i ,..,... ,.i :,i
et al. (2009) (sec; Appendix

-ps (Fig. 2). ()\erall, ihere were 25,107

MP plastome phylogeny

Length = 152,366 steps

CI = 0.384, CI' 0.31 8
83 taxa (68 monocots)

109,1 34 aligned bases

25,107 informative characters

graminids

100

100

100

cyperids

Hordeum
Triticum
Agrostis
Bambusa
Oryza

100

WrSaccharum
Mf Sorghum
Zea

■ Eieusine
Pueiia

Anomochioa

100

94

Streptochaeta

— Ecde'tocoiea "|

GeorgeanthaA

100| Join villea piicata n

{

restiids
xyrids

Joinviflea ascendens
— Fiageilaria

100 i Thamnochortus

Centrofep/s

{

Abolbodo

Mayaca
byngonan thus

100 r

Spargan/um
Typha
l Oft- Neoregelia

mv-Puya

1 00 Jr Pttcairnia

Fosterella

Novia

Brocchinia

81i — Chamaedorea

1» fElaeis
Li

Ravenea

100

52

100

100

100

94

100

100

Potarophytum

Thurnia

- Cyperus
Juncus

Musa

Belosynapsis
Trade scantia

Reneaimia

Dasypogon

King/a

8&- Hesperafoe
.M- Yucca
m M\-Hosta
loon Chlorophytum

Albuca
Asparagus
Lomandra

Nolina

Agapanthus

Phormium
Iris
Curcuiigo

Neoasteiia

1 00 j Apostasia

■ Phaiaenopsis

Dioscorea
Pandanus

Li Hum
Lemna

100

I Acorus americanus

' A corns calam us

— Anethum

Panax
Heiianthus
Coffea
Spinacia
Cucumis

Populus

Medicago

Buxus
Piatanus
Nandina

94

Calycanthus

Liriodendron
Drimys

Amboreiia

lliicium

Nuphar

Piper

1000 changes

]

]

]

]

Poaceae

Ecdeiocoleaceae
Joinvilleaceae

Flagellariaceae
Restionaceae

Centrolepidaceae

Mayacaceae

Eriocaulaceae

Xyridaceae

Cyperaceae
Juncaceae
Thurniaceae
Rapateaceae

Typh

Bromeliaceae

Poales

Arecaceae

Arecales

~\ Commelinaceae ] Commelinales

Mu5aceae
Zingiberaceae

Dasypogonaceae

J Zingiberales
] Dasypogonales

Asparagaceae

Amaryllidaceae
Xanthorrhoeaceae

Iridaceae

Hypoxidaceae

Asteliaceae

Orchidaceae

Dioscoreaceae

Pandanaceae

Liliaceae
Araceae

Acoraceae

Asparagales

- Dioscorea I es

- Pandanales

- Liliales

- Alismatales

] Acorales

Eudicots

Laura I es
Magnoliales
Canellales
Piperales

Austrobaileyal

Nymphaeales

Amborellales

|.:i f ■!■ ;'-:^l

■:■■, ■ i ■■■.,. »!■ ■
, . ;

< 1 1 i I I i

100% bootstrap , sister (with 94%

I, ;i..| J

unit node, lminch lengths averaged 1734 ± 170
(mean ± SD) steps for palms, 2112 ± 103 for

ids, 7821 ± 1102

1416 for graminids. Rates of plastid sequence

<"■:'! mux :.- ,

:

ML produced a single, fully resolved, well-

'' ii.i i

■'■■■'■: ' iMill''

■■i .... :•■'!:■: >■■■

trap support as being mono-

commelinids in the for both had highly infertih

' .' i"' - >"■

the ML tree was generally higher than that for the

100% bootstrap support; Mayaca of Mayacace

ii i' i i i i i i

I ,. B. Sm., B. melanacra L. B.

iMi et al. IW7. 2007) Low-nutrient

ACCTRAN. However, infertile soils are more likely than

to favor fir,- (Givnish. 1980). the mfened

2000, 2004, 2007), as do sedg

'iv :.,„<.' I. ; i . ' '

....

running from Fh ilka through the

that the ancestral habitat

. S ,, !/■■■

ML provided a :h more strongly

, . i . .... i ',

. !':;■:■■ !■■■:■

sister to Dasypogonales with 86% bootstra

: -y, I ...;',. i'.t
I ill,! I ..ill. I

from Bromeliaceae

e, Cyperaceae, and Juncaceae

ly,t} 'Villi II II IK-;, in or< I. n II "I I II ill i" ;.. '' ' ...

through Poaceae) typically

i in. ' . i :■. ■'■■■

I i I ' 1 1 'I I I i

2.

r

v

•re

.3 t t,o2

a
I? a?

s <*

d
c

QJ

s

ra

a. nj
a; a>

re

c

u ><

01

u J®
ra 3

ra ^

s*

re a>
u a>
re

ra

'a

Si?

k_ fC

aj

ra

u

r-
CL

HI
ra

8

fa

"aj
E

o

1—

£3

in

S3

a>

E

£
o

re

t

C

E

E
o

.2
2

c

N

OJ

ra

OJ

a>

u
ra

fO

w

a»

1

ro

V HI

y>

Cr>

=3

c

VI

o

O

a

ra

ai
u

3

r

1 1 1 1 1 1 1 1 1 1

N

1 1 r

ra

m
u

ra
C
O

Cm

o

ra

Q

cn

ra
£1

<

VI

2

Q.

0J

ra jl

<T5

m

ra

8 Si

p

X <

VI

Of tfl vj

« « *

41 ID A3

1 1 1 1

VI

8

ra

U

o

o

ra aj

qj ra

u a>

ra u

<L> <U ro

ra s e

<l> R ra

<e

u

ai
ra

OJ
u
ra

8

o
<

1 1 1 1 1 1 I — I 1 1 1 1

1/1

n o

1/5

2

OJ
vi

Ml

3

VI

in

§■

5

o

c

o

a

E

o

+

cc

ro
CO

CO

so

s

E

g

i-J

5

1

uo

.£

p

u>

9.

O

c

Cl

C

<C

CD

8

E

0)

U

o

"g

£

'3

Jj

00

o-.

o-.

5

^
JG

I 1

c
5

^i

E

>n

§1

s

01

a

li.J

3

eg

r

^

0^1

s 1

ij

■s

G

Q

a

S

'^-.

-3

s

s

E

fc^^

Q

QJ

Q

E

^J

C3

VI

"^

5

g

\J

^^

li II Ml' I '

the commelinids.

( I

: • ' ''.... ' '

been resolved as

;>; [hem anew.

, habitats. In l J liate relatives, there

V»: '■ ': ■

lining the pollin

ML analysis of 81 coding regions from the plastic 1

■■':«■ '>■■■ P^" 1

i ■ nv u ■

phylogeny to date of Poales, the commelini

:

1 , ' , i i !

ML general]) outperforms MP in re<

: 'in: Hi . ( ■«-.

and MP trees differ are just those with very short and

1 i' (

<. u It.-ii:'. ':■■!.

Pollination mode

□ Animal

a □ Orchidaceae

.;.■!:. i:

■ :■• ■■'*: ■' ■'!!■■■

:: : :»,:;:! '.:■:,

RELATIONSHIPS WITHIN PO A LKS

.;, with strong graminids wit ' h 100 % SU pp 0rt , followed by Mayaca-
support, Bromeliace

h of the branches

, of xyrids, relative

, based on the ML
for any family will. , r . w i tn a need for

ships among these h( , lp break up the

iy. Givnish et al.
plastid rbcL and mitochondrial atpB to place Rapa- (2005, 2006) and Chase eL al. (2006) both placed

ierlo each other in

genes, placed Rapateaceae alone as sister to all other t ]
Poales, with Bromell

followed by Erioc;.

'"■ '■ V

however, was qui U |

used ndhF sequen ,se of Givnish et al.

Typhaceae sister lo all oil..-.- , „„, i M( ,|, l( |o Eriocaulaceae.

Rapateaceao. Christ in «-t al. ■

rk'L to reach a simil, ; cr lo the cyperids, with the

; :■.!■■■: ■.■■> ■• II ■ ■

Only Chase et al. ! ter to the restiid-graminid clade. We note that

recovered the bran.;

ids. but excluding
had low (lc-> than r>0%) bootstrap support for the Flagellaria (Rudall, IWi

rids (see above) do
placement. When we exclude all
s wrid placeholders,

and branching (

r. ,i ■.Jim;: ■■;

lade. Christin et al. (2008)

' riocaulaceae and Xyridaceae

1 I f Dahlgren an<
Dahlgren et al. ( h et al. (1999)

and Rapateaccae. Ml l'i\

isitions ill Ike

' ■: "•'■.: ■'.;■(■■•.. :n |<1

I " I I II I

(.'IK'mH... ii tin

nolecular data, has usuallj b

■ • ■'"

al, 2000; Bremer, 2002; Michehw.geli H

I hi

!i)9) regarded its
position as unresolved.

■ Mi; ..■!■'. . I i

'. ■

mented bv Bremer (2002), Chase et al. (2006), and
Graham et al. (2(X)(>|. but eoiillirts

Ihivn, : ;'.. \\ .Mi:

i-.- "■:; ; '■:■;■;
al. (1992) disc nversion in the

■ 111-. .: Mir

ill'.; :\ ill ' ' '

■■■■1- : I .. 1.1 lllill

, . I in |i in

'. ' ■■•■■■■' I f„ .., ■

J. ... . M

ami short crl -

exclude Ecdeiocoleaceae. Although adult

; . 1.1..- Irs- ;•!

I 'II | II I I I

II I l-ir <■■::■■■,

highly reduced Ecde

Within Poaceae, our data confirm that Anomochloa

grass-type spikelet found in all grass

...

- -

■ I ■ .'I. <

al. (2008), and S=. (2010). We hope

i i i I

II Mil I 1ft .1)1.111 I i III I III II , ' .

The ML phylogeny presented provides the first

1 •' !■ , HI '.

. In, I I

analyses of broad among monocots

and Davis et al. (2004) came closest, placing Arecales

weakly supported topology

II , hi .11

in. I

I . : :.M i

possession of (1)

|| i !

:

■J- '. : r,!,',-;i;'.

Viusaceae, and scattered cases

\ :' lM, ,.|. II I

. ,. ., \<W\)

■'..■[.. I !,!;■■■.■■

pogonales is supported by the possession c

habit in all of ill.

ibitat of Poales appears to have been

'...■.,■ I I I; ■■■:■

■ i et al., 1999; Linder & lii

'J il_

are associated with forest u

(Fig. 4A), which II high frequency of

ion within the order.

Al al'. '.-',■■ I >a; ■.<■■!

:aceae, and the PACCMAD-BEP clade of
Poaceae (Fig. 6). i three origins of

(1999) and Lindei and Ku.lall (2005). Partly, this

villea, based oi reng and Davis

i I ■■■■■-■■■. |. Vi ." ' ' i: \ :■■::■ i'ai;'

Anomochloa, Streptochaeta, and Pharus P.

• ' " '. ' ' ■:■ la. II

II, a-.; ■•■i'l.il.i---.

II ; II i .in I

>81; Soreng & Davis, 1998). In

! I :'T ■ ' 'I II .: ■■ ; ■

: : :inr i'ci

associated with i Poaceae (Page,

' .1 I I ■ M

':. ' ' . I !"

■.,i- I. VI-'. " I, '■

woody Bambuse; Calderon, 1971,

^'. ' . [■■I,| : ,| ,,

1992; Soreng & Davis, 1998): the placement of

ade (Grass Phylogeny Working

Group I, 2001; Bouchenak-Khelladi el a I., 2008)

forest understories and light gaps — clearly

would be an add!

supports separate origins of wind pollination in
Mr and the PACCMAD-BEP clade of

■■used on our phylogeny (Fig. 6).

■
dut-Liuii, and habitat openness (Table 1). Wind

i II II . II

I-. : I; ''I;: i. '
.■! ■■ ! i'i ■!■■■■; ■

1998 Culley (l il 2002 Lindei & Rudall 2003
' Uarrell, 2008). Il should bo
is no need to invoke reevolution of petals

I ". . ■ "i • i, ili

i i ted by animals
up to the PACCMAD-BEP clade (Fig. 6).

n and unisexual flowers — and their

< i • , ' ; I i ■ ■ :

nated taxa (Giv-
use unisexualitv

\ If i

1980; Lloyd &

and P < 0.0002, respectively) n

Habitats that are open and windswept — even if only
■ man & Barrett,

:. ii !! 1x1111 i , il i ■ ■

II '■ III «>|:M

ae, Mayacaceae,

:
nism in the orde

iml the cyperids in open

PACCMAD-BEP clade of Poaceac in open, often

forest understories and edges in Flagell

(see Soderstrom and preceding

. : ' ; ■:■ ■■

uresoences (e.g.,

Conversely, in some (but 'not all) amm
species, nectar serves as an attractant. The

■■■:■■. •■

,' : ' ,mhI. i ! , .

'•' " I I'.i " Il

nturelli & Bouman, 1988) of

1 I. I l'.);.,l-;.-,.

' 1 I I I I '

' I I

id

ae, variously associated with petal ap-
1986; Rosa & ': V; Ramos et al.,

II l!X-!i.;r;i-:

i 'I

II I llr, I

(",:.-: Ill I-...

il [■•! ■. ii :■ l ];,;•■

pollination median

be 11

and P < 0.064 for

il. ■■■■ :.

! !!■,.■ [■■Mi -

pollin,

fleshy fruits at that It
1995).

iven that both traits are

•: .

,-i : I . .-i k:-.-i.

partK linked Regal (1982)

> Ji'i. :■>;:

1,1 • IN,

■:'!!:■ ',■!.■'■■

: ' ::■■:!. m: ■■

pollen:ovule ratios (Cruden, 1977, 2000).
But why have Poales

i • i I . i

■ ...

: ill.- II" VI'*'.
VI '': IV-KI'.I "I

>■■■■:■■'■, ■ . : '■;:■!, ,!!■■.■■■ '.|:':t

jll;si ih:;.! . i ,;: ■-■■ .- :'.: il; ■
i ML, Mil I I

assurance— without
l evolved five times idvantage of inbreeding associated with self-

mivonments where

! , i

spatial autocorrelation of po<

flowers, lack o'

positive feedback (

''-' - ■ ■ '

& i -i mi.. . .■■:'..■ ' .

few other species are adapted;

tous spread, and

■■

r growth i

' i." -ii <i.i- ■•;■ i<-r a

." (■.(■ (Hi .-■ :i I- ■,: -.- il ..

I II i ill I ,'

flooded or burnt hurniaceae forms

■■ i ' .1 . ''HI

■:. ' . .4 Mi!.: '.; )>•

' ''-ii.ll ; ir<-.

frequent intervals.
Retention of animal pollination by Kriocaulaceae.
Xyridaceae, and Mayacaceae despite their

in i . 1 1 1 ■ I
reflect their occur
poor soil. They usually in

i 11 i

i i

on similar sand or sandstone a

Invasion of fire-prone, summer-dry upland habitats

'■::,!" i"i l\

I" ll I

pollinator ass una i\ driver toward

llmi ill mi
mally wet depressions and rock

: ..' .Ii I 1 ' II I '

:

ntenance of wind

..':' aaaa

nil i III \\ ill Ml il ill l| I a ;.a \

lliams, 2009).

i i i i i II II

-

nied in Flagellaria by a small

Lion in the ai

presumably was favored by th

] 11 I i the vast PACCMAD-BEP clade of

lia: / ■!■,.!.;■ ,.li|. >< .

include (1) moderate to tall sta

erect foliage, C Lo widespread

1 1 1 1 1 1 ■ I | i i ni ii ii

^ . ■ "I: (I <• -I.,.;

: !(!■■■( ■> ■■!■; , ' V

. the tolerance of glasses to
n i n-tem-. the \ olatilization

, and co II II a,
a : •. ,

their horizontally and vertically transmitl
herbivores provid Is secreted by the

ran, ■■'.mi; ■ '. -a

a: I iaa a. ::■!•■

■ ,,,■• 'I:.'.- i ;.■■ ■

I & Tilman, 2007). The great
Smith, 2010) might reflect (1), (4), (5), and/or (6), or

i. i i II i
through (4). Ch of the proposed

native to tropical forest uiidei ;
in most woody bamboos proba
the PACCMAD-BEP clade (Fi

lerstory genera of herbaceous

, m L., Panana

the woody bamboos (see Boi
is fai I 1 L I

' i " ' ' i i I ill

ii i i ' i '

seeds, which like other grjss

- ■■,;■! ii. I ■;,',■.:,:

I ii i 'I . i II I

ll Ii dii , ■'•"..

lumber and non-

Ji,-:'.: !.:■■■■:.■■

I ■!'■!■:■. \r,v,\ .. mi

ii • ■

•roposed specific mechanisms-

-. ! :. ii i; ■ « i iM" ' :

Deriving a moiiocol pliylogeny based on plas-

!'=■-

; :■■ ■ '■;■ M '
1 1 ! l "

1 whh a r,

■

M i

■■>■■■.-. .;.. I *.-!■■<■.,
on sequences of the single plastid gene i

ntervening years,
increased the number of infor-
ng genes that evolve
, for matK; Givnish

multigene stratej more productive

. .■..■■■

• : -- 1 1 1 1 1 - i '' ■■:■

! ' "['I: '.. ' ■„■

997). Chase et al. (2006) used 4777

,; ■ n ; i ■ ■ i '.-i Ml
Irom 17 plastid

in I i ■ i

I ' ■ Mill Mi

The study presented here — using 81 plastid genes

:i| irl !.-,,:■; !',"■■
'.-"MiMi .:'

ones recently usi I gene sequences

ii el al, 2003, 2004; Leebens-M

: i' I'M I I , -

gene phylogenetic

A.sano, T., T. Tsudzuki, S. Takahashi, H. Shimada &
Kadowski. 2004. Complete nucleotide sequence of t

long-branch i

to be confronted

1 I | HI

"oncerns, in the

: " -I] "■ i

rtfflot et ah, 2007) that may be

!l •;!(" I'V.' ;;i lid

i III i

;tli 'iv li ■ ■' ■ II s ■■ !■■! i;

;■■! II, .I;-. ,"-',i:.

iiencing of transcriptomes, the

l hundreds of morphological

tlir refinement of a timeline

of flowering plants

■ 53f-553.

Stiitzel (editors). Ihe Families and Genera of Vascular

Verlag, Berlin.

incompatiliilih. and allitudinal shifts in pollination
systems in the high Andean genus Espeletia (Asteraceae).
Amer. J. Bot. 76: 1602-1614.

■ ^ ., .' II .11 I .1 Mil |

grasslands: A lest of the transient maxima hypothesis.
Ecology 78: 2359 :

" ";K. Fiedler. 2004. Preferences for sugars and

feeding ant community. J. Anim. Ecol. 73: 155-166.

. :> ;

Ecol. 29: 418-429.

Bosch, T.. C. hiln

052 1081.
Forest, M. van der Bank, M. W. Chase & T. B. Hodkinson.
(Poaceae): Progress towards complete tribal and generic

flowering plants. Proc. Natl. Acad. U.S.A. 97: 4707-4711.

-

II ',74 1387.

(Poales) from Western Australia. IVlopea 7: 307-312.
classification of Restionaceae (Poales). IVlopea 12:

S<-I„-Lg. (,. IVl.-L-eii. A. Barford & J. I. Davis (editors),
Diversity, Phylogeny, and Evolution in the Monocolyle-

Carlson, C. W. dePamphilis, J. L. Boore & R. K. Jansen.
2006. Complete plastid genome sequences of Drimys,

1. Biol. 6: 77.

for investigating intrafamilial relationships within Orchi-

i , I, I!

, M. W. Chase & P. J. Rudall. 2003. Rec

. >. & K. A. Kellogg. I«)»7.
relationships of ihe Poaceae. Pp. 217-224 in T. R.

i>. i'.. ' ;.. '

:. ,M. Molvray, P. J. Kore
J. Givnish. K. J. Sylsma & J. C. Pires. 2000. Higher-

Pillon, G. Petersen, 0. Seberg, C. B. 1

Givnish, K. J. Sytsma & S. W. Graham.

I I ■ il.i.

PorLer, L. M. Prince & M. G. Simpson (editors), Monocots:
Comparative Biology and Evolution (excluding Poales).
I -.-,,.,-!.«.: :. , ..

'■■. :, M.; ;

W. H. Chen, C. H. Cheng,
Chang & S. M. Chaw. 2006

vsis oi evolutionary rate w
etic implications. I

I UV> 215.

. 240-257 in G. P.' Chapman (editor), Reproductive
rsalilil) in the Grasses. Cambridge University Press,

J. F. Wendel. 1995. A phy

aceae. Pp. 190-194 in K. I

Hamilton, J. M. Porter

iiology and Evolutk

, D. W. Sleu

in P. J. Rudall, P. J. Cribb, D. F. Cutler & C. J. Humphries
(editors), Monocotyledons: Systematics and Evolution.

219 228.

Commelinanae (Except Gramineae). Springer Verlag, Berlin.

'. .

O.thidafCdc): Nuclcdi i\)\\ IIS sequences. PI. Svsl.

root allocation. PL & Soil 285: 171-185.

32-46.

. 2000. Pollen grains: Win so main' I!

222: 143-165.
Cullev. T. _\1.. S. C. Waller & A. k. Sal

Evol. 17: 361-369.

VI. T. & H. T. Clifford. 1982. Tl

, & P. F. Yeo. 1985. The la,,

Barraclough. 2004. Environmental energy an.

B, Biol. Sci. 271: 2195-2200.

Davis. J. 1.. 1). v

<:i„i|,i i

Hardy, K A. Miehelangeli, M. P. Simmons, C. I). Spechl.
F. Vergara-Silva & M. Gandolfo. 2004. A phylogeny of the

monocols. as inferred from rbcl and ulpA sequence

jackknife and bootstrap values. Syst. Bot. 29: 467-510.

■■,■■■:>. i:w.

Anderson. 1992. Chloroplasl DNA inversions and die

■I - i ! ,
Z22-7726.

J n ( parison of impact of organelle regions on

phylogeny. PI. Sysl. Evol. 278: 169-186.

J. D. Majer. 2007. Convergent evolution of an ant-plant
miiliialism acioss planl lamilics. conlinenls. and tim<
Evol. Ecol. Res. 9: 1349-1362.

II , II I ,,

Natl. Acad. Sci. U.S.A. 90: 4641-4644.

VI ',
11. G. Hills, L. E. Eguiarle, J. F. Smith, B. S. Gaut, E. A.
Zimmer & G. H. Learn. 1993b. Phylogenetic hypotheses
for the monocotyledons constructed from rb<\. sequence
data. Ann. Missouri Bot. Card. 80: 607-619.

M . | Hi ,
■:■„!■. •'

32: 1792-1797.

irvral the shads lns|oi\ ol C, grasses. Pioc. Nail. Acad.

. 107: :
Ervik, F. 1993. .Notes on the phenology and pollim

in Ecuador. Pp. 7-12 in \\ . Bai thiol t. C. M. Naumann. K.

,, i. .•

8. A phylogenetic
angiosperms. Int. J. PL Sci. 169: 49-58.

I lllln,,, I ,|.

from the Earl) Cretaceous oi Portugal Evidence on the
U.S.A. 101: 16565-16570.

;art) 2: 415-^27.

laximum likelihood

, , ■ i I

■ ■/■.: i > ,■.!:,■:,:.'•■■!

108-111.

Gaul, H. S., S. \

10274-10279.

Goldman. 2007. Experimental design criteria in phyloge-

nelics: Where to add laxa. Syst. Biol. 56: 609-622.

of breeding systems — Dioec\ and dispersal in gvmno-
sperms. Evolution 34: '.
&K. J. Sxi

, , J. F. Smith, W. J. Hahn, D. H. Benzing &

K. M. Burkhardl. 1997. Molecular evolution and adaptive
radiation in Brocchinia (liromeliaceae: Pitcairnioideae)
atop lepuis of the Guayana Shield. Pp. 259-311 in T. J.

, T. M. Evi J. Sytsma. 1999.

Pol\ph\lv and convergent morphological evolution in
Commelinales and Commelinidae: Evidence from rbcL
sequence data. Molec. Phylogen. Evol. 12: 360-385.

K. .1. Sytsma. 2000. Molecular evolution, adaptive

atlantic family Rapateaceae: Evidence from ndhY sequenc-
es and morphology. Evolution 54: 1915-1937.

, K. C. Mil

E. Berry & K. J. Sytsma. 2004. Ancient vicariance or

i disjunclio

African Botany. Monogr. Syst. Bot.
i Bot. Card. 25.

>1 in J. T. Columbus, E.
rince & M. G. !

. Ana Botanic Garden, Claremont,

Jansen. 2010. Implication*, ol the plaslid genome

Poaceae. J. Molec. Evol. 70: 149-166.

, W. J. 2002. \ moleculai phylogenetic study ol the

mae (Arecaceae) based on atpB, rbcL ai

uences. Syst. Biol. 51:92-112.

nn, U. 1976. Hydalellaceae— A new family of Mono-
colyledonae. New Zealand J. Hot. It: 193-196.

D. R., S. G. Dastidar, Z. Q. Cai, C. Penaflora, J. V.
•vuehlJ.L.Boore&B. II-

26 in J. T. Columbus, E. A. Friar, J. M. Porter, L. M.
Prince & M. G. Simpson (editors), Monocots: Comparative
Biology and Evolution— Poales. Rjncho Santa Ana
Botanic Garden, Claremont, California.

Kubitzki, H. Huber, P. J. Rudall, P. S. Stevens & T. Stutzel
and Commelinanae (Except Gramineae). Springer Verlag,

Illicium (Schisandra

Phylogen. Evol. 45:

the cell walls of monocotyledons. Biochem. Svst. Eeol. I
153-160.

> , . . ■ .

II s bees in cf<;
pollination. Ann. Rev. Knlomol. 11: 183-206.

'. S. & P. R. Cra

.. ' id.ill. :" . . C,:i!:
D. F. Cutler & C. J. Humphries (editors), Monocotyledons:

■■ :.!<■;.■,.,,;-■.. .-,■:■ I .. .

on. Y. & K. R. Shiva

graphical tool lot sequent e finishing, Genome Pies. 8:

he angiosperm stig

195-202.

1996. Inferring com

■■'■■■

383: 130-131.

not a basal angiosperm. Molec. Biol. Evol. 20: 1499-1505.

, , & . 2003b. The chloroplast

Structural and phylogenetic analyses. PL Syst. Evol. 242:

119-135.

, , & . 2004. The

Ih rice II ) nn chlo.opla

Molec. Biol. E\ol. 21. 1445 1454.

2005. Analysis of Acorus calamus chloroplast genome and

its phylogenetic implications. Molec. Biol. Evol. 22:

1813-1822.

\. Kemoi/e & V. !

dalionships within ()i(hida<(ae based on a low-cop)

S6: 784-795.

mam, S. W., J. M. Zguiski. \1. V. McPheison. D. M.
:herniawskv, J. M. Saarela, E. S. C. Home, S. Y. Smith,
A. A. Wong, H. K. O'Brien, J. C. Pires, R. G. Olmstead,
W. W. Chase & H. S. Rai. 2006. Robust inference of
nonocot deep phylogen) using an expanded multigene

hs„ 22:3 20.
iss Phylogeny Working Group I. 2001. Phylogen) and

Missouri Bot. Gard. 88:

lybeal, A. 1998. Is it belter to add taxa or characters to a

!'■;:■ mI. s.m :■■■■■ ■

■•..:.■■

Khelladi, M. S. Kinney & N. Salamin. 2007b. Pp. 275-

295 in T. K. Hodkinson & J. \. N. Parnell (editors),

■ Tree of Life: Taxonomy and Systematics

i I , i. i I, i

he robustness of two phylogenetic

I III I llllllill III! ,', I

Evol. 12: 843-849.

.'■: •

l I. II

,1C

, Z. Cai, L. A. Haul;

dePamphilis, J. Leebens-Mack, K. F. Miiller, M. Gui-
singer-Bellian, R. C. Haberle, A. K. Hansen, T. W.

Chumley, S.-B. Lee, R. Peer), J. 11. McNeal, J. V. Kuehl &
J. L. Boore. 2007. Analysis of 81 genes from 64 plaslid

\nn Rev. I col S>sl. 7- 347-391.

lantha (Lovviaceae)

30: 106-117.

plants. <http://www.utas.edu.au/dicotkey/dicotkey/

... ■.:,,.;. m:

ni.l-. !■<,<■.;, I,

." K

.142 in P. J. Rudall, P. J. ( ribb, D. F. ( utlei & C. J.

Humphries (edilors). Alonocoh ledons: S\ slemalics and

.■.I ■>■.-,,„,
sequence, from Korean ginseng (Panax schinseng Nees)

Patterns and controls of aboveground net primary
production in tallgrass prame. Pp. 193 221 in \. K.

Knapp, J. M. Briggs, D. C. Harlnell & S. L. Collins
(editors), Grassland Dynamics: Long-term Ecological

New York.
Krai, R. 1998.
Hube

Families and Genera of Vascular Plants, Vol. 4. Flowering
mac and Commelinanac

Kress. \\ . J.. I

2001. Unraveling the evolutionary radiation of the families

.Vcv

. BMC1

urcade, T. W. Chumle }
. dePamphilis. 2005. I

I
1948-1963.

1997. Phylogenetic
ind hydrophily. Sys

analysi

. VM-.\.

..I.'- 1. I ! ' '

ResLionales— A hypothesis. Kew Bull. 42: 297 318.

. 1998. Morphology and the exoluli

pollination. Pp. 123-125 in S. J. Owens & P. J. Rudall

In. . i II .i . ■ ■ ...

.'.' r. .

, B. G. Briggs & L. A. S. John

i, K. Kubilzki, H. Huber,
P. J. Rudall, P. S. Stevens & T. Stiitzel (editors), The

II 'Hants, Vol. 4. Flowering
ianae and Commelinanae
ills;. LVrliu.

r.

patterns of radiation in African and Australian Resliona-
ceae. Evolution 57: 2688-2702.

Lloyd, D. G. 1982. Sel.
& C. J. Webb.

1992. MacClade:

,■

' I i ill! .

Li n I h) Roem. & Schult.

Gene content, hotspots of divergence and fine-tuning of

Joinvilleaceae. sisters of Poaceae (Poales): Evidence from
rbcL and matK data. Telopea 11: 437-450.

Skyabin. 2008. Complete sequence of the duckweed

:'

and phylogenetic relationships to othei angiospe rms J.

»6: 555 564.

■;■; .!■■,!- m ...■(,>,■-■

exhibits biparental plastid inheritance. PL Cell Physiol.

i. F. A., J. 1. Davis & D. VV.

lli ,i

, vi. '■; vi. !... ! ..■

:>l ,;■■■■>. :.■■;■::/:■■■■ '

»7: 020-627.
Vloura.J.I.L. K.

illmln ueeulsm southern
Bahia, Brazil. Pesq. Agropecu. Brasil. 43: 289-294.

\erl)oom. P.

2009. Phylogeny of Cyperaceae based on DJNA sequence
data: Current progress and future prospects. Bot. Rev.

(Lancaster) 75: 2-21.

-': ■..■■,V.-V /.".-.

(Flagellariaceae). J. Arnold Arbor. 50: 527 555.
Takumi, K. Ikeo, T. Gojobori, R. Mural, K. Mural, Y.

mpl t q icing oi chloroplasl DJNA. iVlolec. GeneL.
. 740-746.
Okumura, S., M. Savvada. Y. W. Park. T.

637-646.
Oriani. \.. P. I S a no & \ \

( Kriocaulaceae — Poales).

.:!";•■ .. ,v| /•
chain Monte Car 167: 808-825.

.■'■.'.■■■■ ■ :,-.!,:.

Australia. J Veg. Sci. 5: 55-62.

dall, M. F. Fay & M. W. Chase. 2006. Phylogeny,

. 287-304 in J. T. Columbus, E. A. Friar, J. M. Porter,
M. Prince & M. G. Simpson (editors), Monocots:

Zanis, J. J. Cannone, R. 11. Gutell, M. Powell, A
Savolainen, L. \\ . Chatrou & M. W. Chase. 200.
Phylogenetic analyses of basal angiosperms based on nir

1042-1045.

('.. K. L Uorba & L S. I!
Pollination in Brazilian Srngonanthus (Eriocaulaceae)

Ann. Bot. (Oxford) 96:

sequence dala. Ph.D. Dissertation. Deparlmenl of Com-
puter Science. Pennsylvania State University, Stale
imsvlvania.

adc. .1. L. Boore & R. K. Jan

new sequences lioin llic angiospci ms \uphdi adietui and
Ranunculus macranthus. BMC Genomics 8: 174.
Reed, H. E., T. P

consequences ol C, grass invasion ol , i II in

.

icla. PL Sysl. Evol. 163:
21-29.

,i.l

': 596-606.

(Eriocaulaceae). Flora 198: 188-199.

" I., , i„

11,11,1,1! I' i
63: 140-181.

' II I I Mil

phenolic compounds in monocot cell walls, using UV
lluoieseencc ml< toscopv. Ann. Bot. (Oxford) 75: 483-191.

, P. J. Cril J i Humphries (editors)

1995. Monocotyledons: Systematics and Evolution,
Vols. 1 and 11. Royal Botanic Gardens, Kew, Richmond.

I.
S. Y. Smith, M. E. Collinson, M. V. Remizowa & D. D.
Sokoloff. 200'). Seed I'crlili/alion. dcvclopmcnl. and

Hot. %: 15!!1-15')3.

l-v.iii. :
Hammer & V. M. Huguet. 2009. A fungus

;

>010. Inference of

plnlogcnclic relationships among the subfamilies of

the plastid genome. Botany 88: 65-84.

, H. S. Pun. ,

D. Marchant, B. G. Briggs & S. W. Graham. 2007.
dlii'ied as a new branch near the base of
the angiosperm phylogenetic tree. Nature 446: 312-315.
.. I". |

n. >l n 1 , ,, l,i

i i h
Exine sculpture in Pariana pollen (Gramineae). Grana 32:

ibica L.) chloroplast genome: Organiza-

,i :

... J. G., L. G. Clark, E. A. Kellogg,

nd emendation of subfamily Mi
crairoideae. Sysl. Bol. 32: 71-80.

Luo, J. Tomkins, 0. A. Rognil, H. Daniell & J. L. Clarke

. ' ■;;;■: ,.■' .'■-'. :':;■■■:■:

115: 571-590.

:.. R. M. Maier, J. P. Alcaraz. A.
fie. 2001. The plastid

families. Pp. 543-578 in P.J. Rudall, P.J.Cribb, I). F. Culler
& C. J. Humphries (editors), Monocotyledons: Systematics

l !

ill en Drusen der Gattung Eriocaubn
(Eriocaulaceae). Beitr. Biol. Pflanzen 60: 271-276.

ii 65: 275-299.

I '

Huber, P. J. Rudall, P. S. Stevens & T. Stiitzel (editors), The
Families ind Genera of Vascular Plants, Vol 1 Flowering

72-79.

.:

pollen and plastid DNA sequence data. Arrier. J. Hot.
90: 1071-1086.

evolution are

flowering pla

Science 322: 86-89.

• 1 1

\. 1981. So

me evolutional \ liends in

15-47.

& C.

1971. Inse

orest grasse

1-16.

I!. '■ ' II ■

angiosperm"? Not so fast, Amer. J. Bot. 91: 997-1001.

B. Flool & C. M. Morion. 1998. Inferring complex

1 '
three large DNA sets for angiosperms. Svst. Biol. 47: 32 42.

Zanis. V. Savolainen, W. H. Hahn, S. B. Hoot, M. F. Fay,
M Axu 11. S. M. Sw« ns< n. I M. Prince, \\ . ) Ivu ss k. C.
Nixon & J. S. Farris. 2000. Angiosperm phylogeny inferred
rbcL, and atpB sequences. Bot. J. Linn.
Soc. 133: 381-461.

' . ■■-., ,'. I ■■:-,. "h... -.,. ■■•

r..,.
! i hi. ■!

mixed models. Bioinformatics 22: 2688-2690.

' L.org/MOBOT/ i

, S. Fuse, H. Azuma & M. Hasebe. 2004. Biosystematic

cik umsciiplion of the family inferred from DNA sequences

biolog\ of Trilhuria (Hvdatcllaceac). Abstract. Botanical
Society of America Summer Meeting. <http://2()()9

; Jul\ 2010.

Primary Industries and Water, Tasmania, <http://www.dpiw
.tas.gov.au/inter.nsf/Attachments/SSKA-72Y8GD/$FILE/

■.■■■■.„■.: ; ; ihil! :■.<;■ >•

University Press, Cambridge.
Venlurelli, M. & F. Bouman. 1988. Development

.

1. P. Linder & W. D. Sto<

Amer. J. Bot. 91: 1364 I

C. D. Bell, S. F.

Manchester & D. E. Soltis. 2009. Rosid radiation and the

■■■,.:::.. U;iH

dynamics: The constrain

Jones & J. 11. Lawton (editors), Linking Species and

FcosWems. Chapman and Hall. New \oik.

Kutcher & K. E. Ashby. 1998. Dioecy and the evolution of

... ,.;. .:■: ■•;! ■!■,:

J. Bot. 85: 1377-1388.

Evolution of the angiosperms: Calibrating the family tre
Proc. Ro\. Soc. London. Ser. 13. Biol. Sci. 268: 221]

.-

s, Sydney. CSIRO, I

II i

Calycanthaceae

Calycanthus flondus L.

Goremykin et al., 2003b

Magnoliaceae

NC_008326

Cai et al., 2006

NC_008457

Cai et al., 2006

E 1 t

Berberidaceae

Raubeson et al, 2007

Proteales

NC_008335

Moore et al., 2006

II •:

Huxaccac

Hansen et al., 2007

Cucumis salivas L.

_.

Plader et al., 2007

Fabales

Fabaceae

Medicago truncatula

Matsushimaetal.,2008

Populus alba L.

NC_008235

Okumura et al, 2007

Vilales

Jansen el al, 2006

Caryophyllales

SpinaciaoleraceaL.

NC_002202

Schmitz-Linneweber et
al., 2001

Coffea arabica L.

Samson et al., 2007

Jansen et al, 2007

.piales

Apiaceae

AnethumgraveolensL.

Jansen el al, 2007

Kim & Lee, 2004

Monocol

Acorales

Acorus americanus (Raf.)

DQ069337-

Leebens-Mack el al,

Raf.

DQ069702,
EU0167701-

2005

Goremykin et al., 2005

Mardanov el al, 2008

Dioscoreaceae

(L'Her.) Engl.

_

Hansen el al., 2007

Zomlejer 2348 (GA)

Liliaceae

Lilium superbum L.

Ihisslud)*

Givnish UW-8-2009-1

Agapanthus praecox Willd

. ihisslucU*

Albuca kirkii (Baker)

this study*

McKain 111 (GA)

c::~l.

this study*

Leebens-Mack 1001-
2010 (GA)

& Hemp

Hesper hep fir

(Torr.) J. M. Coult.

this study*

Steam

Steele 1087 (UMO)

Labill.

McKaiu 114 (GA)

-

Leebens-Mack et al,

Ortgies

EU016681-

2005

Neoastelia spectabilis

this study*

Bruhl2767, Quinn

J. B. Williams

Curculigo capitulata

Pires 2009-101 (UMO)

Apostasia wallichii R. Br.

this study*

Zich 634; CNS130807

(CNS)

Rchb. r.

this study*

Givnish Tas-2009-5

J. R. Forst. & G. Forst.

(WIS)

Chamaedorea seifrizii

Ihis study*

Zomlefer 2358 (GA)

Elaeis oleifera (Kunth)

EU016883-

Leebens-Mack et al.,

Raveneahildebrandtii

Ihissludy*

Zomlefer 2357 (GA)

^Z^olsRBr

this study*

KRT3702 (PERTH)

Kingia australis R. Br.

Ihis study*

KRT3703 (PERTH)

Winters, Higgins &

(Blume) R. S. Rao

Higgins 186, pi 2; SI

Tradescantia ohiensis Raf.

Moore 337 (FLA)

Musa acuminata Colla

EU016983-

Leebens-Mack et al.,

EU017063

2005

Renealmia alpinia (Rottb.)

this study*

Zomlefer 2322 (GA)

"[j;™^

this study*

Givnish UW-8-2009-2

Rauh 40573A (SEL)

Navia saxkola L. B. Sm.

this study*

Givnish 3/16/1987

(WIS)

Neoregelia carolinae (Beer

this study*

L. B. Sm. 'Argentea'

Pitcairniafeliciana (A.

Chev.) Harms & Mildbr

(SEL)

Puya laxa L. B. Sm.

this study*

2010 (GA)

Muell.

Briggs & L. A. S. Jo

Ruhland
Flagellaria indica L.

KRT3786 (PERTH)
KRT3775 (PERTH)
M. Ames 10/15/2009

NC_008591 Saski
NC_014062 Morris

Bambusa oldhamii Munro

Eleusine coracana (L.)

Gaertn.

2010 (GA)

Hordeum vuluare 1 ,

NC 008590

Saski el al.. 2007

Oryza saliva L.

Hiratsuka et al, 1989

Saccharum officinarum L.

Sorghum bicolor (L.) Moenc

i NC 008602

Streptochaeta g Uifolia

[his slucK*

/. /. Davis 757 (BH)

Trilicum ueslinun L.

Ogihara et al, 2002

NC 001666

Maier el al, 1995

Potarophytum riparium

Sandwith

(BRG)

Givnish UW -8-2009-3

Mast.

(WIS)

Ames 10/21/2009 (WIS

Kngelra.

Cirnish GUY-09-5

Hook. f.

(BRG)

Spruce ex J

Ecological Characteristics

.1 I ii

Ih<

■Ml !

al., 1995, 2000; Grass Phylogeny Working Gro

!, i
• , . TIk- i

members of ihe PACCMAD-BEP clade grow in open,

' i I

ed tree lor giassc - \ i< pirsentalixes of

' I HI

: ,■..,„■•.■.,. .: . .

(Linder et al, 1998; Linder & Rudall, 2005). Most

ancestral, given their occupancy

& B. G. Briggs, Empodisma L. A. S. Johnson & B. G.
)f a second Australian clade (see J on I

■.■...;. liri ■■:■.■.
•:■ ■ ■ ■■ •■|.:| ■ v, j-I ■..■

permanenll) sodden microsites, ranging from near s

Threatened Species Section, 2009)

immable (Linder & Rudall, 2005).
\la\aia grows in open. ~:

i2)l>> Jui

\ta (S. Watson) Jeps., L. p

(

r meml.cis ol C\peracea( Mil)l'amil\ C\ pcrioideae. in

ages, implying fertility

:
ny/shady
ir coded as siinn\.

Guayana Shield (Thurnia) and South
(Prionium). These sites are clearly subject lo fire in

ds.) but probably are not in the largely aquatic

n i

la general absence o
)ideae. Well-drained substrates

Poaceae, PACCMAD-BEP c

. ,■■:,:■:.■■■■, ,:.'■.
:■:■■.■.. '.::■■' . < , hi '.I, ..:■! .■;!. : )):■■.;:.::•: ,;('

, ■■ ■ \ / ' ^' ^ , , , II i„l ,,, „ „ i i : ,,:,.;i <•,■

I III ,1 I. ill ll! I

>> r: o -v

Agrostis L.

Georgeantha B. G. Briggs <5

Joinvillea-1 Gaudich. ex B:
Joinvillea-2

Neoastelia J. B. Williams
Oryz L.

Sorghum Moench
Sparganium L.

Syngonanthus Ruhland
Thamnochortus P. J. Bergiu
7%umio Hook. f.

L. (i.e.. C. A el al.. 2010).'

, Puelia French was .com I as umd pollinated,

■!',,:,,nt, II,. /-::l:

t al, 1985; Soreng & D;

[lination. Linder (1987) pollin
uid Kudall (2005) considered Flagellaria and The

las fragrant white flowers (Backer

i

grasses (Sodersti
n, 1981; Soreng &

, 2009) have identified

iled. For palms, il is el
s. Maurilia. and Nypa Sleek are all inset

EVOLUTIONARY HISTORY OF
THE MONOCOT FLOWER 1

In carpel fi
septal nectaries. It is likeh that llic trimerous-pcni

Monocots form a well-supported clade that eneom-

ll IM"I/! I ' , ■ ,

lll|l."\ : r<- ■!:,■:■■

i ,. null! I,.; ill

'mi, . •

::.;■■ . •

'■"<>■„■ ; I 'Hi!; ■■

.il.'i

1905; Takhtajan, 1980, 1987) or Pipe

i I i I I l 1 1 ni I i

(I reproductive

i II
al., 2007). Howe exception does

|.:...'v;-rc|IC i

■ ! I |.iv. |r<l ■•":!'■

1 We are grateful to Vladimir Choob, Sean Graham, and Sabi
2644.2009.4, Russian 1 search (RFBR)

!/:■.■ in

-' Dcparlmcnl nl Hi
sokoloff- v@yandex.ru.

h III II,

:

ded material of Triglochin, and Margarita

■ .„,■!■,■;<■.„...

1/ •

■ . '■

m consists of six
.1 relatively Lepals in I ils (generally not

Friedman, 2002; Friedman & Williams, 2003). and two alternating whorls, and three carpels (i.e.,

' m in monocot flowers was discussed

>''i'-V : ' \ I". .:■;.. V !•. '

plrdogenetic rehii us inserted on the

II

no universal!} ace i

ancestral monocol i I and a stamen, (3)

,, :li ,M ; v.i,i i . ' ^" ; ""»■.■■■ i"i

since the first inLer

which included a h "> complex. Endress (1995)

monocot flowers (I ''' a clear correlation between

<U- ■: ■!■■ i: ' .:■■■> ■:,■■.'! •. I :

.. ; ,!i!li ; .:,■■ ..,■:. ,.

consider only the

ition. \ trimer-

liu" ■ •!'• ."■;■■: ■ :

<-w. ,;,i.; ; '":; ;

i . ^ ^ . ' ^ ^ ■

We broadly follow the An ' ^sperms, magno-

.ugli rare in core
orders, based pi i

ibombaceae, Nym-
u- numbei of floral organs as
■is (six tepals, six stamens, three

". ■...-'00I-. |: 'I: II!

is sister to all r el al.. 2009). Flowers of die magnoliid Orophea

■ . .!.;:;;,, ■!;.■ U-; I

li :. 1 ! ■■ ; . :■ ii ■ " ■ -. .:h ■ ■ ■ ■ ■ v ■-;. '. ■■ \ ■.■■

in a single family). Dioscoreales (three typical monocot flowers on!

i ; :

••■..■

another; (3) a clade of fne < ommehmd oideis and c aipels aie numeious (see Kessler, 1993).

i i ... '„.
! ! i>; I '.

ich as Menisperma-
another.

early divergent core eudicots (see also

■ae. Caryophyllales) ;
M. L. Moody & Les (

liferent types of

n, 1992) is consideiabh m
ipproach to trim

ively species-poor aroid groups

m Schott), tepals are

■ :■■: i i):.

ott) (Mayo et al, 1997; Buzgo, 2001).

. in the few aroids with
■ flowers, the median outer tepal

i iii

I- _i ■ .i i

id decreased mensm occurs m

. 1 1 1 1 1 1 1 i

II Li., I

Asparagales, and Poales.

Both species of Acorus
rimerous-pentacycl i

f phyllomes (calyculus)

' ' -I' V;li Oil

(Remizowa & S mizowa et al.,

2006a).

: l :■•,<■! huT;

(e.g.. liber. 19.; I: Igeisheim el al., 2001). In some
:'ris L., carpel

i i'

(Remizowa & Sokoloff, pers. obs.). Other core

1 1 1 1 1 . i 1 1 1

;

:..■'. 1! i i

1993; Takhtajan, 2009; see also Singh & Sattler,
1972, 1977; Posluszny & Sattler, 1974a, !>:
& Tomlinson, 1977; Posluszny et al., 1986).

I i I'

one in Triglochin scilloides (Poir.) Mering &
increased, if we

I hi mii in" i i

' XT ': lih .'! '!

androeeium can al

-i) occur within the

'^ / • ■■::,■ I , :'|!r< I<v,.l.

-I ; '; !■ ■ I; l '■-»■■.. i i

main species of iponogeton L. £, there are two
3 stamens, and three carpels.

number of floral whorls. For example, there is a

I ' i li whorl in Althenia Petit (Zanni-

chelliaceae, but united with Potamogetonaceae

Thalassia Hanks ex K. D. Koenig (Hydro-
cliaritaceae). multiple stamen whorls in many
Hydrocharitaceae and Limnocharitaceae (united
with Alismataceae in Angiosperm Phylogeny
Group III, 2009), a single stamen whorl in
Alisma and Ruppia, and more than one carpel
whorl in Ruppia, Sagittaria (Alismataceae), and

doceaceae, Zannic

.. ..- .. i; ,

: ne variants of

i ',".-■',"; <■»/'

typically p

ossesses two tepals, six stamei

■; ill li ■:■'.■!■

of organs of

of the flower

i in the core alismatids.

scence-flower boundary is c
atic (Rudall, 2003, 2008; Rudall & Ba

l ..• i-u: ill::' :■.'■;■;■.' :

li'

■■■■I '•':-, \<;

•■i : :■ ! '•' '■ •

Hook. f. & Thomson, in the famils \r..li : .c.M,-
(Hemsley. 1901: Sokoloff el al., 2007).

Petrosavia Becc. 003) and Angio-

:l l .-,:■( ,■-■ ■

I

In Pandanales, loss of the typical monoc'ot flower

:
1958). In the Kin ii bisexual repro-

•-ll.'ilh. ; ii ii!;
HI I

3). blowers are at
ilicially closer to the ty[iic;

■ mum"- i i ii,

stamen number ( 990; Mello-Silva,

1995; Sajo et al., 2010).

'■li.

stamen whorls can largely be

:-s. most of the

■■:"]■ :

a few Smilacaceae possess I
stamens (Takhtajan, 2009) or up to 18 stamens

I 1 1 1 II ii ' I i '

F&\

W / M ^^P^B

f '^ \ 1

I

— .',■■■ g

I f 1

... .. ' .

lability in the in

to heptamerous
lia .1. I{. Williams, Asteliaceae; Takhtajan,

'■... I .-■■■; .
in -!'" I

Hi III . II

flower; the outer-

involucral leaves. In s|,r< ies <>l Trillium L. that la, k ahlgren et ah, 1985;

li ; --"I: ■:■!.. ! 1 : . ' . '' '■ >■' n'iU' = ' 1 1.

(! -,l I ill in

i due to suppres-
sion (Paris Mi

Bieb.) or loss akahashi, 1994;

Remizowa eL all 2008; Narita &

ir inner tepals

(petals) are entirely lost (T. apetalon), the carpels and

gynoecium differ: i other monoeots.

1 1 is sometimes placed in synony

mi" i;; i-

i ' I I I

' ' .' ' .' I :ir:lndi i..:

■■■■:>■■)<■). ;:.,,.

Paris s.l. is monophyletic, the increased merism is a

, \,' ' ■ . . ...

■:■■■.■■.:■!■■■.■

lobes (Tillic

Bogner superficially i

1 i i . i

to form a c

hamber up

) to 3 cm long, with a narrow

am.), and there are 12 to 14

d apparei

2004). Some \maryllidaceae, including

, possess ;

milar to

:

us) are ext:

ible floral

i, but it seems likely that

trimerous-pentacyclic

plesiomorphic for

3 four (oi

■ three) commelin

1.1 I'Vii ■■ ,!,,.■,■

1. m-v. a > I

" ' ' . ,' ■■■■::■

::; a !;■ I'i ill;

;/ ;:i i if E : m ' .

:

II ! , : i.irn

'

■■:,■: 1 '■ ; ■:>;■■ 1

'

'\.,„il„.. ' •

■' III i' 1 "'■

cyperids, and Typhaceae), although some members of

stamen- (from both whorls) n

■■ r,:;l :,.■ . I

number (Linder, 1998; Linder & Rudall, 2005).

Flowers aie trimerous-pentacyclic in most bioti-

liaceae, Rapatea-

su ;'■;] :■,■■ , >:■: i . ; i> hi

. :i Mi ; * 1 1;..

■ . '

II III

mm R. H. Schomb. sp. (P. J. Rudall & M.
: Rapa-

" ' ;■;■:■■:..■■;■.■
I I Ml

. pers. c(»mm., cited in

Most wind-pollinated (or self-pollinated) Poales

flowers. Extant
have unisexual

lepab. which
Tvplui L. (Miill.
from one to cil

carpels ran I ,c

possessed up to 7-locular fruits (Dorofeev, 1979).
Among the graminids and restiids, which are

I'. l ■,>:; i ' : 'n l:

derived from trim lowers by reduc-

•■■ '.<■ ■ "■ ■

' ■■:,.■:■ !:,■: > i : i! I : . " ',■
■!■■: );•:■• :

i "!! II in, i i

■ : :

III 'II I

aceae possess one

phyllomes surrounding these flowers

' • 1 . ' |

i of pseudomonomery.

n the cyperid
itacyclic in Thu:

i: ; ill Via- i ■

■■\<;H. : :.-..

subfamilies, Mapanioideae and C\pci

i floral reduction
;;:. ; i;niMM" r

et al.„ 2009). Many Cyperoideae possess
Diiietimes up to six)
stamens, and two or three

-"Mi a .■■ - "

^ ^ ' ' - 1:1 Jill

flowers). In Iricarpellale fern:

lie flowers of Carex,

(Rudall & Bateman, 2004). 5r

n the median carpel is

■ass genera (e.g., Ochlandra

subtending the utricle

Tllih'Uli;;'. : il '

-act. However, the

utricle is actually the

1 i 1 i .1 1 in 1 ,

ex (reviewed in Alex-

ind therefore the me

idian carpel is abaxial,

ic ia i i 1 | < i a 1 mill c ■!::'.■;. ■ ^

as in other monocots.

Not all flower diversity in Cyperaceae can be

.,
.mi. •.';«.». .;.!(■.■.

|| III llll . ,1 I II i i n

i al, 2005).

' ■ <■■■■■><■ ■: v <:■ u"i

- i l . ■ : ^ ; ; ■ i : ■ ■ : . ;

5; Richards et

Bentham, 1877; Holttum, 1948; Goetgheb
The main problei

,:■*■!, i :■■ I HI;

. However, an analogous

primitive condition in Cyperaceae, willi

also Alexeev, 1996). Meeuse (I

ult to accept in the

:.i :i ..■ I .In-- .>■■
merit of Cyperaceae.
Finally, the palm on lei

the petals occui

re3t3 tepals, no staminode:

'

(Uhl, 1972). Son

I "IVJUH:'. i;

i polymerous androecia are never arranged

it i i i

■■■ : I'i.HI i :■: N! .■:.- S I'..

■ ' '

ill;:

:tal (e.g., Uhl & Dransfield, 1984). Some-
iel number is increased, although the
is always single-whorled.

ocols in Lhal there

. H -

'< ri.ilii i : ■<■■■

■ : -

' ■■'■ "i i iv

■ ■■!■■■;■■ ; ll

apocarpous, but liner (1950) and

i. 'II i i i ' .'II

2009) restrict the term "apuoarpv'"

' , ^ ■ ' NT. ; hilii'.',

' I, I . i I M i I i I >

I " i,

:

'. .■::■! ■■..He . ■
ill

i II

...:■:■■ i ;;■ i ■

ill us syncarpy, but
no polymerous apocarpy) occurs in the eudicot order

< < 'I i II ) i i

:

■

Id have been derived
carpels ({ t

(see also Rudall et al., 2005). In many angiosperm

; ■■ ; | ■• . i ;i

Phytolaccaceae.

In monocots, non-m

■. I II II.. I '>V:',-.

, i i „
ceae, which beloi , are monomerous

:

i-eae, and (3)
ogenies of Alismatales.

hi carped fusion occur in mom
congenital, postgenital, and fusion via the

I i

i" i i

I ; ill

:....'. '^ . "' '■■'■■■>■:■ :

carpel fusion is < is, but relatively

liids, and absent from early

: S" -: 'I: i l,» , .

possess united i are conge nitally

Carpel fusion via the floral center, not combined

'■■ ■■ ■■'■■<■■:

I'll I "
(2) congenital fusion between the ventral :

■ .!:;;":<!;'.: II -\r •:..

also Eber, W <

■ I i i 1 1 1 i

:

' '' r.Ml.: f

ill i I II II

■■ '

ertile carpels are united while I

ii ii i" I

VI, Ml ... /' ''■ ":

.. .: ■ : ■ : -: :■ I II . I ■>:;-:.■
Eber, 1934; Igersheim et al.. 2001). \ i

, II ,,„ I II' i nil . i II,

I I I ' III 1 1

I I',:'.'!; ' I ,

ss, 1997: Buzgo & Endress,

11

lorphic for a clade

the most basal lii s (S. W. Graham,

pers. comm., Aug. 2010).

Typically, septal nectaries (sec Fig. 7) are located

i,i
the ovary, often close to the base of the style

1985; van Heel,

2008). They are some-Limes tern

2000) becau

se in some taxa (e.g

, Tofieldia Huds.,

Tofieldiaceae

located below the

. . .

aries: Figs. 7A, B,

8A, B). In some sj:

1 ii ■ i

cavity is pre

ovary cent

illini, , .1 ii 1

i ii '1

970; Hartl

& Severin, 1981;

>; Sajo et al., 2004).

Baum (1

48), Hartl and Se\

erin (1981), and

eved considerable

n the development

-noecici with septal

ated by individual

r late developme

V.. II III. t ., ■; :■; : .

il

'.Mill .Hili'.T

ovary wall extend e openings of the

III: II-, II 1 1; ■■< '.:1 •

below the tepal bases (Fig. 9B).

J: Kemizowa et

ii ! I i'

■ »-i;'.- . i i"i"

jL 2009). In

i i , ■ ; !' , t i , I
nectaries typically open along their outer <

i i

en I. I i " i.i Ii i i< ii In ' in ; ;.:> :' .. .

Endress, 2001; Remizowa el al., 2006b).

..■•::■.,.

,1 ,,

II II 11,1

UN

, •'!. Ii.. '.II > ■■

region of congenital fusion; pf, region ofpostgenil.il

A peculiar type of

i i 1 1 I i . ,

•.'!'■.■ i ; i ■. ■■

■'.i lu-rm nth."

; (■

ii'l i 1 1 1 1 i

nectary openings at the gviin

Mil; ,' I I'M-:-, Ml

1970; van Heel,

illM! il

1

the course of

shifted from the carpel stipes and the I

i • i hi ■ , i

'.II Ml I i
il! il M

example, van Heel (1988) was

aries are

'MM 'Ml 'I'M

2001; Rudall, 2002; Sajo et a

I i I ! i

,im iMI ;iiM ;.; I ■

il relative to the

Ovary position is a critical factor in evaluating the

.Hi i,l

. ■■■::•: :i 'Mr. '

or with septal nectaries and opei

■ i I'M I ;

:

L

lii'

substituted by other nectary typ<

"I ' i I 1

I 'III I i I III I MM ,

I , ' -I,.;*- : M ■

Rudall, 2002). Perigonal nee

: I: li-Ml. ■■>■....

Haemodoraceae (Co

i I

■ ■ ■ ■ .

I i II i,

i I

. . ' ' . , , '.iIimm, ;■■'

Endress, 1998). ence from mono-

• . .

i i, I

is restricted to the sealing of

: II

and does not contribute to fusion between carpels.
C H A RACTER OPTl M [ZATIONS

the presence of sepia I ne

pedes ol ihe T. huh i al. 2010) (Juncaginaceae), showing

II ' I ' 1 I 111 Ml

i rpretable a:
ction. Because all of the k

ley represent monocot synapo-
or whether they

Mapping the presence versus absence of the

pentacyclic i\u\ nc to all mono-

i! ,

deviations from

.■:■; .. ' i'.f i-'li; Him ;i!.M .

I I m II 1,1 II I I II

I i I i i i II i I '

.■!!.■■■.■ ' hi":'

character coding

I 1 i i i I

, |>ll": ! h,

K/uduation of carpel fusion and the presence or

r ■-, uri:; , m ■ -in.:; .

" ! i I l I I III'.

I "I ' II

or syncarpous, because this
only in Alismatales.
As with the floral groundplan, we regard carpel

state "carpels united" incorporates gym

nilal and post-

/ ^ i ' ili ii

■: I;-; .. ..'||;.| ( 'll
■"I. (■■.'•■..

the ancestral conditio

■>; septal nectaries," depending

:.M ; : : |,;;lii

i- ;•! '.!■;■: r."

Character Correlations

.11 i I

ital fusion) and
lowever, in the

' Hh III III .-:.

5 for
fully understood. As

■:;■::■■ ''

trimery, because en organs of the

,i .-
i " i i I! ili

l-::--- ; ,i-:-' \\ .'

,. (Tofieldiaceae). — B. japonoUrion JVi

>.cium Maxim. (Nartheciaceae) (Rem, , Sarlhenum llu.ls.

Liaceae). — G. Ledcbou.

;<n»|n > : i || .; ■ !:■■.■
II i I i, I i

1995), although we do not illustrate the ch

'■, ■■ ' i> '■' : . !:

ers. (Remizowa et al, 2005). We

i in ; ■■ II I :: ■■ .■ .]

six tepal-stamen complexes i

stages, each site eparate tepal and

stic origins of common
f intermed

■ ; . in '. i i .■>!,■. <■>,■■

er, at least the observation in the lilioid Trillium

members, and I sequent organs,

' ili i i I ill

'.•■.' 'I I I I Ml II I III

li H< III' i 'I I I I i

1'Oi ;■ ..-:■! li, .i -I ■«>: ■■::■]; in

(e.g., Iridaceae,

) are characterized by strong v;

ill I ili J

i. i ii i.

' l 'I ■'■:.- 'Hi

Ml •III !

... \ , ■ ; ;,'.".' /.'/.v I,

■■■■:■
. . .
I i ili 'II , -

carpel. For <

: • I ■ S !i i' ■ •■

/ ■ .III ! :

field et al., 2008).

• 'ii mi

^ '. | ii

'..

itionary diagrams

pentacyclic flowers and united carpels evolved as

1 l» 111 I. !1 I.. I. !:■.;■■>■■■.
i I II

1 1 dan outside th
I their supposed descendant;

" '

:

■ I ;'IUI;i|»-. :

aroids, Cyclanthaceae, Panda i

■■ ■ i- i '

of Dahlgren

i li :■; ■ !■ .■ I !■::■
i | Li

tion of flower groi arpy characterizes

floral evolution in angiosperms in general.

The concept of common as primitive implies

i a free-carpellate gynoecium

i

ario that implies

al., 2002). This mode of pollen type

II ' I

receptacle has been documented in Lacandonia

in,. i : in ,

ll. Diagrams on the i

' '.. !■ .,■'!■ .■■:■■■■.,: :

, [■:,:,■ . ■:■■ I:',i.

ss produced by intercalary growth. It is

are cleistogam
within the uno]

united carpels, even from species that possess a

' n.r; I ll: In : i '.. ■ - li fi ■

et al., 2006b). This is also the case in some euc
e.g., some Buxaceae (von Balthazar & Endress, J

en-tube growth in
ectary formation is

:•,,; ,■: .1 i ■■ ■■/■

1981; van Heel. >5). When septal

>.:■.. ,.■!,-■.!■■■■

It is likely that tin

free-carpellate condition was

in j i ii ill i

genital to congenital fusion be
irreversible in monocots (Fig. 13)

r, H). Three other

Finally, il is important to note that parsimonious
topology, so that even minor changes in topology can

states, developmental constraints, and the fossil

■:;■(' ' r; i '■■ : .

:.. ,, ' I-'
Alvarez-Buylla. 2006. Comparalive developmental series
of the Mexican triurids support a euanl

ae). Amer. J. Bot. 93: 15-35.

orders and families of flowering plants: APG II. Bol. J.

Linn. Soc. 141: 399-436.

offspring quantity and qu
Vzuma, H. & H. Tobe.

phylogeny of Tofieldia

effects of carpel fusion o

:>f the monocotyle-
of terminology. J. Linn. Soc, Bot. 15: 490-520.

J.
allariaceae), an unusual, j
enowia 34: 203-208.

II, 12th ed. Bornlraeger, Berlin.
W. C. 1977. The Piperales and the monocots:

>: 393-425.

— : . ■

development of Acoraceae and its systen

with basal an. ;i< :

Jamcmn, K. VI.. VI. W. Chase & P. J. i

• ■■;,■ I:.!,: f.T:',<<h

220-227.

:

.. VI. F. Fay, 1). S. Devey, (). M.iniin. P\.

Verlag, Berlin.

■■■ ■'■ ,■■ ,T,i !:■■•

donen unter besonderer Beriicksichtigung seiner system-
atischen und phylogenetischen Bedeutung. Feddes Re-
pert. 80: 463-590.

Davis, J. I.. I). \\

Campbell, J. V. Freudenstein. D. H. Goldman. C. R.
Hardy, F. A. Michelangeli, M. P. Simmons, C. D. Specht,
F. Vergara-Silva & M. Gandolfo. 2004. A phylogeny of the

jackknife and bootstrap values. S\sl. Bol. 29: 467-510.
Pp. 53-75 in G. I. Gorelsky & V. P. Grichuk (editors).

I • i . i , M

l:..-.,-.ii. i i .

Harley & C. K. Lewis. 2008. Genera Palmarum: Kvolution

Kew, Richmond.

der Reihe der Helobiae. Flora 127: 273 330.

ussen, K. Hilu, T. Bor
, J. C. Pires, T. J.

summary. Aliso 22:

2004. Evolution of apocarpy in Alismatidae using

.■ : i. !*;■'.' !:■■■ ■.!■■■

quenee data. Bot. Bull. Acad. Sin. 45: 33-40.
( hoob. \. \. 20(1

Regulation of De eloj nl of 11 1 O j, 1 Leaf

. .. :■-,'■. i „,.. ;:,■.

aLeop.5:l-l]

1982. Syncarpy and alternative modes

sperms. Taxon 31: 48-52.

. 1990. P,- 1 .

. ; . I :..',

. 1995. Vlaj:

Pp. 43-79 in P. J. Rudall, P. J. Cribb, D. F. Cutler & C. J.

Humphries (editors). Monocotyledons S\ slemalies and

)(■>. Homoplasy in angiosperm flowers. Pp. 303-
325 in M. J. Sanderson & L. Hufford (editors), Homoplasy:

Press, San Diego.
. 2001. The flowers in exti

1111-1140.

& A. lge,

evolution in basal angiosperms. Int. J. PL Sci. 161(SuppL):
S211-S223.

. ' . ' ■'■>■: -i.M

M. Evans, H. J. Hahn. K. C. Millam, A. W. Meerow, M.

2006. Phyloger

Aliso 22: 28-51.
Goebel, K. 1931. Bliitenbildung und Sprossgestaltung.

■'■'.
Goelghebeur, P. 1998. Cyperaceae. Pp. 141-190 ,

. ,.! ... ,■!!:■, ': .:;.[ \ : :
' ■::.! [■■ i::.ii ■.. : ...

Verlag, Berlin.

„ ,ii ... ft r. .;. ■> i mi i i i mi :

. J. Boi. 97

Cherniawsky, J. M. Saarela, E. F. C. Home, S. Y. Smith,
Olmslead, M. W. Chase & H. S. Rai. 2006. Robust

Hallicr, H. 10!;.: ol the natural

(phylogenetic) system of flowering plants. New Phytol. 4:
151-162.

Syllabus der
h ed. Borntraeger, Berlin.

Horti Berg. 18: 1^21
Hard, D. & I. Severin. :

Icon. PL (PL 2672, Ser. 4, Vol. 7, Pt. 3).

K. 1948. The spikelet in Cyperace
) 14: 525-541.

i,h! i
289-370.

.■-. i . I .

Soc. 136: 1-65.

Ji, Y., P. W
Phylogeny

■, ; ..,, ;,.'. r .

Families and Genera of Vascular Plants, Vol. 2. Flowering
I , ,il ill

;-.rla». Berlin.
,, I,. II
Bartlelt & C. D. Spechl. 2009. Early floral development of

I. 229: 187-216.

in.,,:-,: .!■.

.n 36: 21-28.

. ' i. -Mi,.: ■;'■■:■..

-'i.. : . ■ . : ..|.. :,'. ,!■■.....■

11. :■; :,V.
Leinfellner, W. .I<>.:

. : 403-436.

(editors), Reproducthe Biolog) in Syslematies. Conserva-
tion, and Economic Botany. Royal Botanic Gardens, Kew,

■ ■■ & P. J. ill. -.;

Poales. Annual lies. Eeol. S>sL. 36: 107-124.

•3. Pollen develop-

-I: iiU' -■■: ! ■■<•:

Philodendron (Araceae). BoL. J. Linn. Soc. 100: 139-172.
, J. Bogner ,'7. The Genera of

■ - : !

291-304.

. . . ■. . •

'."

:■: 539-544.

Haloragaceae. Ai 2025.

Mymphaeaceae 11. The flower of Nymphaea. Bot. Gaz. 122:

D. 1970. i'Jber die

, H. Li, T. Xiao & I
ssifiealion of Paris (Melanthiaceae)
Ann. Bot. (Oxford) 98:

Typha

• ',;.i. :l,.-.., ,\\\~,u
Triglochin bulbosa complex (Juncaginaceae). Edinburgh J.
Bot. 67: 353-398.

' III | . I il ni|l. Li (:vr r.:,;:;-;;.;.; . ; I ,, sii'

dspaiagoul monocotyledons. Inn. Bot. (Oxford) 100:

451-562.

■■:■ '..' i:i:i A

■{. K\ol. 272: 07-7!!.

. : : ,. ■!.!'! ..: !:■■.:■ :

•1 II '■ H r. II .

I I M '

& R. Saltier. 1971a. Floral d,

Potamogeton richardsonii. Amer. J. BoL. 61: 209-216.

■'
manlima var maniima. Canad. J. Bol. 52: 1607-1612.

& P. B. Tomlinson. 1977. Morph

development of floial shoots and organs in certain
Zanr h 11 Bot. J. Linn. Soc. 75: 21-46.

& W. A. Charlton. 1993. Evolution of

flower. Aquatic Bot. 44:

, & D. K. Jai,

ihe re prod u<

-

(Alismatidae).

•

dence from anatonn am

luteo-viride Maxim. Bol. J. Limi. Soe. 158: 1 18.

I monocolvlcdons. Pp. 213-254 in P. J. Rudall, P.
ribb, D. F. Culler & C. J. Hui

t. Bot. 31: 223-238.
]. A. Furness, J. G. Com
. Chase. 2000. Consid

& D. D. Sokoloff. 2003

morpholep in Toficldia (Tofieldiaceae) compared with
Araceae. Acoraceae. and Alismalales s.str. Bol. Jahrh.
Sysl. 124: 255-271.

. ": !!.;; ■:...:'..

ol floral orienlalion. brads, and bracteoles in Toficldia.
Japonolirion, and Narlhecium. Aliso 22: 157-169.

, & . 2006b .

dc el pment in lofieldia, Japonolirion, Petrosavia and

!: 18:1-200.
-

I . II ! I I

Morphogenesis. KMk Scientific. Press, Moscow.
—
Rudall. 2007b. Postgenital carpel fusion does not always

■■!>■.!. :-■ ; • i ■■■.; !■.:.■■
the SWemalics \ss< i

—

Evolution. CS1R0, Melbour
, J. C. Manning & P.

floral nectaries in Iridaceae

613-631.
, J. Cunnif

,. R. Cad.

nales). Taxon 54: 701-711.

, M. V. Remizowa, A. S. Beer, E. Bradshaw, D. W.

Stevenson, T. D. Macfarlane, K. E. Tuckell, S. K. Yadav &

D. D. Sokoloff. 2008. Comparative ovule and megagame-

laceae and water lilies

, , G. Prenner, C. J. Prychid, R. E. Tuckett &

D. D. Sokoloff. 2009. JNonflowers near the base of extant

origin of the (lower. Amer. J. Bol. 95: 67-82.

arela, J. M., H. S. Rai, J. A. Doyle. P. K. Endress, S.

I & C. J. Prychid.

247: 215-231.
:i. 171: 595-606.

Botan- Schultze-Motel, >

Philos. Soc. 77: 403-441.

- • l.-ri, !-■;,■

153: 1-13.

fruit in Ceraloph \,
Petersburg) 94: 938-961.

, C. A. Kurncss. I. K. Ho, II
Muasya & M. W. Chase. 2003. Phyloge]

pollen and plaslid l)N A sequence data. Amc-r. J. Bol.
90: 1071-1086.

of Haemodoraceae. Syst. Bot. 18: 593-613.

superior in the Haemodoraceae: Evidence from floral
ontogeny. Int. J. PL Sci. 159: 466-479.

I development of Alisma
. Bot. 50: 619-627.

dulatus. Canad. J. Bot. 55: 1106-1120.
[. Cresens. 1988. Type ffloial e la e

s "character" and "character state"— A

i Decraene, P. Caris & P. J. Rudall. 2000.
us Distribution and

cans (Palmae). Amer. J. Bot. 59: 729-743.

palm gynoecium. A

i: An cNlrcmc case o
asierids. PI. Svsi. Evol. 268: 209-234.
izowa, H. P. Linder & P. J. Rudall. 2009
1 development of the gynoecium ir
s: The most remarkable i
925-1940.
Barfod & P. K. End.,
lala peltata (Arecaceae

;,■ ■■ ) ' .
i ..■■;!. . :". .'..■.

9.0 <http://www.mobot.org/MOBOT/research/APweb/>,
accessed 16 Septeml

study of floral

. 1980. «:

I h\ta). Bot. Rev. (Lancaster) 16:
225-359.

■•'•■:.

grad (in Russian).
. 1997. i)i

Plants. Columbia University Press, New York.
. 2009. Flowering Plants, 2nd ed. Springer- Verlag,

New York.

(editor). The Families and Genera of Vascular Plants,
Vol \ Flowering Plants Monocotyledons. Lilianae

.rati, J., C. J. Prychid, H. D. Behnke & P. J. Rudall. 20

i;:; ■.-.-. n;:.:i :

i plaslid evolution

. 1932. Beitrag.

II. Uber das Gynaece
Planta 17: 453-460.

II I.. II I | In II I

IV. i'l.er das Gynaeceum der Nymphaeaceen. Planta 21:

with septal nectaries. Blumea 33: 477-504.

: lull. Isp. Prir., Otd. Biol.
91: 96-101.

Endress. 2002. Beprodu.

ixaceae. Bol
140: 193-228.

cosmopolitan wetland family. In 0. Seberg, G. Petersen. A.
S. Barfod & J. I. Davis (edilors), Diversity, Phylogeny, and

Symposium on Grass Syslemalics and Evolution. Aarhus

homology questions in non-mapanioid Cyperaceae. Ph.D.

Thesis. Kalholickc Universileil l.cmcn. Inslituul voor

A.. Vli.

& E. Smets. 2009. A floral ontogenetic approach to

i !

neighbouring ovules by way of receptacle tissue, resulting

415: 522-526.

Winter, A. N. & I. I. Shamrov. 1991a. The d

i ,\los(o« ,K L,Miingm(l) 7
& . 1991b. Mega

, ,i.i!;ii. : ■:;■::,-

& Leningrad) 76: 1716-1728.

Yurlseva, O. \

10:40-52.
United Slates. Harvard Pap. Bot. 9: 91-120.

THE EPICHLOAE, SYMBIONTS OF Christopher L. Schardl 2

THE GRASS SUBFAMILY
POOIDEAE'

•! clelrimenLs lo llie
plant, and include mutualisms characterized by vertical transmission and prolyl uis and its metabolites

!-<■,„, ! I . 1. i! : '■■:.-::

:■:■: !::■■■.. ■:!:■!!■ •" ..'..... . : > : ,:■ , ,, :i , :

this grass subiamih [lien. Most asexual epichloae arose from a more

i nil-- . , , , eliecKoii llie colonized

:.1SI .|',:i''''. :

herbivores, chemical defenses are widespread, varied, because it involves extensive colonization of the host
and importanL (Schardl & Chen. 2010). However. o\ar\. <>\ulr. and embiyo, without causing any damage

::" :i[ I ■ ■:!■ ;..| I , .

via seeds is an

'I 'I * ^ n ■ ,M

ii !• |:l , • ,1,1 ni

(Fr.) Tub & C. Ti i\ they actually

'-.-Ii < ii',

Glenn, C. W. Bacon & R. T. Hanlin, win; ed culms instead

: ■,.', , :■' ii.','

II). For come- slromata lie; iiuiLmg structures

,->">ies i hen medi-

vcly as epichloae (adjective, ep actions of new bust plants or seeds on

The Pooideae-epichloae symbios ring plants (Chung & Schardl, 1997a; Brem

tissues (but willi ]

111, I ' II n i II I I I II II I II

. . :

s interaction of a single

■■■■.... ■■■■,:■ : i , ■.■!.,: .:■

Ml" III.! I

Jruce A. McDonald and Adrian Leucl ation number 10-12-094 of the Kentucky Agricultur

. ill of [he director.

-II.. .i

7/2009144

w Bot. Card. 97: 646-665. Published on 27 December 2010.

hyphae (Sampson, 1933).

issibility is one of the characteris-

into forms that are strongly b<

:

against insect herbivory, i

.. .
W. Gams) A. E. Glenn, C. W. Bacon & R. T. Hanlin

' ' :i.,A,\, ;

:. :

Petrini & I). Schmidt) A. K, Glenn, C W. Bacon & K.
T. Hanlin in L. prateme (Huds.) Darbysh. [= S.

(Clavctal.. 1

■ ■ ;.■■';.■■■'.■ > ■ f
!
■tiled in the f/>/iu

»st seeds, fit well

, ! ill mi, . i ■ I ■

,;ll li':: a nl

al., 2005). Other

mi In i III II ii I i ii I ill ii i In i,

et al., 2008). h ms, neurotropic

■■■ '■it:.- ,(■;

: : '

I | I '

■ . I, The claim that the protective effects

• •• .'

. :

UHII n: I 'ii

(Walter) Britton, Sterns & I'oggcnh.. I

ex Elliot, and others (Cheplick & Clay, 1988;

: ....

Gonthier et al., 2008).

ave been shown to affect food web

i i.i., , in-

J l i II I, i ,

i i-l i

!■:; ■-.■:■■ '

l). Inageneti, e\p.Mim. nt ii
endophyte, ergot alkaloids appeared to be

2006a). Furthermore

I lysergic acid amic

:iuck. The commo

and sleepy grass (A

and suffer stupor due to the ergot al
those grasses thereafl

roduce the deterre
(Petroski et al., 1992; Miles et al.,
Some epichloae i

c Clade

Fungal species 1

Host grass species

irillans J. F. White

^ribn.'sp P p P '' SM " 0M0/i5

Poeae

N. America

Earn

E. baconii J. F. White

villosa J. F. Gmel.

Europe

P. Beauv.

E. bromicola Leuchtm. &

Bromus benekenii (La.

Schardl

B. ereclus Huds., B. ramosus Huds

E. bromicola

Hordehnms ettropaeus (L.) Harz

Holcus lanatus L.

E. elymi

.euchtm., Schardl &

Europe

M. R. Siegel

E.festucae

E.sylvatica Leuchtm. & Schardl

P. Beauv.

Europe, Asia

E. typhina (Fr.) Tul. & C. Tul.

distans (Jacq.) Pari.

E typhina

i .malum (L.) P. Beauv

Phleum pratense L.

E. yangzii Wei Li &

Zhi Wei Wang

S. L. Chen

\1« CO. Miles & Schardl

P. Beauv.

A tral i

N II

N. chisosum (J. F. White &

ElC

C. W. Bacon & R. T. Hanlin

= Festaca aruAK/»/r

Barkworth

N. gansuense C. J. Li & Nan

Achnatherum inebrians (Hance) Keng

Asia

NgC

V. occultans C. D. Moon,

Lolium, annual species

: M. J. Chr.

■lieu.', Trin. ex Nees

V. siegelii K. D. Craven,

[= Schedonoru; p 1 (Hud

P. Beaux.. /

Huds.j

V. sinicum Z. W. Wang,

Roegneria K. Koch spp.

Y. L. Ji & Y. Kang

Y. Ji & Z. W. Wang

V. stromatolongum Y. L. Ji,

L. H. Zhan & Z. W. Wang

J. F. White

F. hieronymi Hack.,

nan Lam., F. super

Phleum commutatum Gaudi

Poa ampla Merr., P. sylvest

W. Gams) A. E. Glenn,

In.

mI cK M.J. Chr.

Stierst. & Gaisberg

& D. Schmidt) A. E. Glenn,

■ n & R. T. Hanlin

A. sp. indet., FalTG-1

Festuca altissima All.

N. sp. indet., FobTG-1

(Pei-s.) K. P). Alcxeev

Ele

N. sp. indet., FpaTG-1

Festuca paradoxa Desv.

N. sp. indet., HeuTG-2

?Hordelymus europaeus

Europe

N. sp. indet., HboTG-1

N. sp. indet., HboTG-2

.. .:

N. sp. indet., HbrTG-1

N. sp. indet., HbrTG-2

Poa autumnalis Muhl. ex Elliot

N. sp. indet., PhcTG-2

Phleum commutatum

S. America

Efe, Eba, Earn

1 Undescribed species

of Epichloe and A vol I ed as Laxonomic gro

apings (TG) by the

rasstaxon for first

isolates, according to th

2 Following classified

al. (2007).

follows: Earn, E. a

ola complex; Ebe, E. brachyelytri; Eel, E. elymi; Efe

; Egl, E. glyceriae; EHi

indet. from Holcus molh

ense clade; Nst, N.

of the alkaloids contn

•

le et al.

2006b), and 1

lines were not

of perennial ryegrass

•t<-m. Other st

dies show that

parasitic nematode

Pratylenchus scribneri, ergot Mines c

n have

affects on nema

todes, both as

alkaloids were rule

d out as the main fact lore allraclanl

at lower

nd as toxins at

vectored by the fc uinafunesta. It is

I .!)■:■■ : ; ,r :', i

■■:■■■ ' ■■

Among the species of epichloae, there is consider-

': ' ;• • ; '

,' , ,, J-l ■ I.'' "Villi:":

j"i i i

:i i.l in. '

E. clarkii J. F.

Leuchtmann, 2001).

Although the fungal order Hypocreales is dominat-

' I,-.. M .-.I.--.

Pemoline Iv

F. rubra L. subsp. r«
F. ra/»-« subsp. rubra

: MM !
1950; Bischoff & White, 2003).

m r ' ■

pitaceae, together with Clavi-

■i " :■'":- mm.' ;, * , , ■

2000; Spatafora el a

,1 I- r |,,i

1 I I ' 'Ml II I

2007).

Effects of the clavicipitaceous fungi on their host

' ' -,. T.IMi M .... C

" I

'■■ I ' 'Ml : ,.

I Mi II ■■■■(. in. ■: ■

vse) Diehl, 5.
,a (Moller) Diehl, and Myru

I , i i . I! II , i

i :n . I'".,"' 1 ,.
<; -.-w : i ;l...

ml in a way that appears i

I > i ii

|| I Ml |

these genus names conforms i
of Botanical \omcnclalure (cf. Art. 59; I
fungi of phyl.

■' 'i,;i II '(

:.:. I '■Mi I I'." .:-..1! ' '

' In I I ' !

"...

'"i 'I ■ ' .

Jones) \ E Glenn, C. W. Bacon & R. T. Hanlin)
molecular conger ies (Glenn et al.,

ii an associated leleomorph

& Clay, 1988).

uiIkts of the fungal

the young flowering culm (E

■■■■■■-

(Bukmln TZ^Ferti

(asci) develop. 1

, which arc filamentous

'i 1 1 hi '! I' 1 i

' " " ,

spore* on maturation (Whit

:e, 1993). As

low to orange

His bright colon)

tion is distinct from the

brown, or black pi:

^mentation in t

) of most ot

associated Clavi<

Mature ascospores are

new plants or de\

ds on neighbo

Host Specificity

between host range, i
itionships of E. amarillans J. F. White,
Schardl & Leuchtm., E. bronucula
bardl, E. elymi Schardl & Leuchtm.,

tm., and E. sylvatica.
iship« are intriguingly more complex

(Lam.) P. Beauv. (originally

Pers.. nom. ille;
'■
supported chide s<

I i i I . ii II I '

,.: , ,

Tanaka, 2008). Ephhlov specie- and Xeotyphodium
species (asexual descendants of Epichloc spi < n -I

MH). I In-

.' ;.■■:■;■ ■.■■! ill
-

Rupr.) R. W. Pohl (Morgan-Jones & White, 1989).

-ii K' ,1 hi...; ■:!

the Pooideae, most described

H.iJm must l)o

ihylogenetic analysis and mating
species represen nterfertile geno-

(tefA) (Fig. 3)

lies have strong

i'"|:i I ..':".

i ion genetic study

'

:

.11 I . . II

from five liosl : B. pinnatum,

i i .i M
tubB and tef\ gn.e> (Kig-. 3. 1). None of the

'. ■ = !.■■:■! ■:. "."

II I I'

:

;t ii''; iii-i;'!.

■ , I. ;■■■■.■■.■■■'/■■■'■'
[»;■(■;■■:.■ i:i oh v. >

.■■■■■\\' • HIT .,. : ir i : .

t every known Epichloe
■ has not been
produced in

( ! I i

; il<i. I i>i ■:■■ »'..■■■■, .

<. ".i-'H!.' (-.;■■ : . ■ ■

many isolates that do not produce stromata can be lui li it has coexolved.

checked for mating

:•■;.■•...■ : I *'.,.»;.■•;;,',.=,■■' , >■■'<■ • ' 1 r

lapped in vertical

■.■:;■■■■■■..

ii ;-c it is topically
(on B. crcctiis).

^ \., ■ ■ .

Several other epichloae also appear to have arisen elytrum erectum (Schreb.) P. Beauv. and

i,i i I In i

strictl) seed ii

ill ill

tioned case of £. />, who observed that

111 M.,1... IT.. hi' :'.-''

. . . ...

v introduced into B.

. . ■ ■ i , i i I! i i i

■:,■:;, ;>.■;■.■,.,.:.•.:,■■■ '

and that the new

I l'i i .1 id I ■ I ! i

provided selection
i sexual fa mission that charac-

i sexual slate in

I !;.■; i vim.': .1;.; :: ■ :.i|.i;ii'i ;". ; >

fruiting ability.

to be polyphyletic,

lales of £. lyphuia fj

natural or near-natural condi Li ons I symbiont relationships suggests that the

Schardl, 1997a; Brem & Leuchtn

& Raynal, 200!;). >e events.

^ ^ ' ' ili i. .'.

Conidia produced on asymptomatic plant surfaces cophylogeny, but not universal,

.Nl ! i i .

(Tadych et al., 2007; pattern seems to be

>■■■:>■<■■■■■■ ■ ■■■'■'■'I .'■ ii ■' ; '■■■■■ <>>■• :■■ ■■;■■■,■

erations, it seem

consideration, then the major

persistence.

epichloae red en

,

h, (• i \>. i -sn ■. ■,..■. ; .'

well as Neotyphodium stroi

" ' ' ' '-: ! : 1..: ill,-;;,"

■ ■: ; ..'..'a; ' i =

host in,li\ iduals. What sets the Epirliloe s;;

is their highU efficient vertical transmis

dium gene trees correspond with deep divergences of

obviates any m|im«-mnit lor fruiting an<

cycle, at least on short evolutionarv time scales

5 of the tefA and

tubB gene trees are not identical (Figs. 3, 1). and

G. F. Atk. [= Atkinsonella hypoxylon (Peck) Diehl]

there remains ambiguity in die topolo

also transnnts vertically via cleistogamous seeds of

Pooideae tree, making any pi

I 'I 'II III I

.■.,;;!■!! I ■ ■'

, er nodes (recent divergences), we modified t

Evolution and Cophylogeny of Pooideae- support to reject the null hypothesis that the

EPICHLOAE SYMBIO ES phytogenies were unrelated. This evidence for

''■'.•• i i i ii , !, . 1 1 _■ i

include hosts o

ii ■■ : ; s - ■ e inn ! "i ' •

'hi I 1 '. I If ill I Inn Ii r.*V mill II i i .1 ,1 II

.'..■■ ' ■ ; . ' ' '

' ; I . II..' .-1111. Ill- ■ ill.'

ual reproduction, and the

Clay, 1998). In
species, B. hypoxylon transmit

nr nil' ! i II i

,1 v ■ ■ ; J' !<:■, ' :

detely choked and produce open
hypoxylon system (Kover & Clay, 1998). In contrast,

M"'<" '■ ■■■! '■"!■ '

.........

II II ai i mi •!! nil in a id i ii ill .

■■■ ■■■■■... ii'

... I I , i . < i , : » . ■

II II II I I I I I I I

Botanical Nomenclature (Mc

." '. i i-' i ■ '

species, although ylogenetic conge-

1997; Moon et al., 2004). Although til

.

: II il III:::..

..'. ■■!!■■.!! ■; ■:,,; ,

^. . i III I I. ill III.

expansion zone, the fungal

.,, „i.: !,m-!,- ■ ■ ' ■

: ii', ;■ ' I."

ill

next host generation.

process of vertical

cies-host species mple scenario for

ilii i I

" ■

■■■..■■

I ii i i II i i

i. i I! ■ II

' : |..'.- I

.. : ■• .:■;■. a

. . I II II' I III

species are generally haploid, whereas m

I i I I i II i ' I i i

"I

89; Moon et al, 2004). Further t

i i -In ii' i

i i a | I hi n I a

and the nonhybrid asexual
genome has been sequenced a

I ' ' i|; ml' Ii I ii' I In l

I i | i

II lillj, li • I

;'.t INC i; ■'. ;, ■ ' ' '

■ ■ •

1 Ml | I !

.rs (Schardl et al.,
1994; Moon et al, 2004; Gentile et al, 2005; Moon et

..f . :■■-;■,■.■..

ill 1 I .. ■'! : '

r||,!l»:i I i I r

in each asexual species are mi

>i :■.■:!,.■ I . ' '

:

'M'.'l ""■' 'I'! '

• ■ : ■ '..:■ : i.:v: ■.!,.,:■,

ill. /,,■',.■■■

I.' ■III;'. i,i: v

typhina and £. bromicola (Craven

' , I i , , i I i II

!n i i nil .i '!
iopkialum (Tsai et al., 1994'.

[:■<■*■ ■.':■■ '-,•! i

: • ■■ ' < -

brids. Neverthe-

. ■ .

Ml i,l II , I III --.W

filamentous ascomycetes posi

• '.. '

Vegetatively incoi iroduce a barrage

, mi „i m hi, i l in i ■.

I , ii . I ■

: ; :,.-',( ',: . ■, i!l :i ; . ;,:

leles at several vie loci seemed
remote. \n investigation of vegetative c<

vegetative eoni|
the genus (Cli

Mill

Ill Hi II l ill II I ,11 I I l I I I III I |; II II ,11 i

segregate from one another in
i- of the plant (Will.- et al.. 1999;
Christensen et al., 2000a).

i I II i II i ■

experimental coi "c perhaps they

from the maternal

I i ii i i

I III: r I

i Li i I 1

lost. The evolutional-)
far less than that of a sexual fungus, sc
idization may be necess

. ■ ■■ ■

issociated grasses are polyplo

I i I i I 'I I; 1 1 u I

in III ill ii , I ill

he basis of Muller's ratchet (Moon et al., 2004;
i & Schardl, 2007).

fungus
fertilized stroma

Y : ^p hybrid of
<t( ^species 1 xspe

species 2

i , nil M

i i i - ''i i>ii in i

In '.Mi ;.■,',■:■■■■.

symbiont, whereas E.

arer and not vei

i ■:.■;■.! .ilir

J. F. White and

White, G. T. Cole & Morgan-Jo

Bacon & R. T. H

i (Kig. 4). Finallj, the two or three

" II m 1 1! i

•l ■.■!,■ run.;!.:-

II ill Hi
i I. II in, i
| l ill"

their hosts such that the plants cannot support verti-
>as less pjthoi

eae present a rich
tenal to investigate the

;i .. ! i". (pl.ii :

of Mexico, Vol 24. Magnoliophyta: Commelinidae (in part):

The plant-infecting

IN. L. Hywel-Jones & J. W. Spatafora (editors), Clavieipita-

i Inc.. -New York.
5rem. D. & A.

" .:.■ :• ■■-.

In'! 1 1 ij ' >

and th

transmitted symbionts favors

■ I !■::■!■■ ■ i i !■

Many other Clavicipi

i ■■■ i ' <>;>■■■■ I ii'

cause no damage to most infected tissues, and ill

ig the vertically transm
■ypoxylon, most epichloae as well as t

uipitaceous symbioi

.'
2008).

Bacon. 2009. Chemolaxis disruption in Prahlenrhu,

' the fungal endophylc K,
'. White Jr., T. I. Bowdis!

II. Ill: i-?r

I I

52: 309-318.

M. J. 1995. Variation in the

.■i::,.,'. : !!■■ ilir.: ■'.'...■.

, A. Leuchlmann, D. D. Ro

104: 974-978.

, K. Takahashi. K. Kohnon, T. Kuki

Kobayashi. 2000b. Occurrence of an Ephelis fungus on

I Villi „, '.I ■ .. .

. R. J. Item .,» a . K. I). Johnson.

G. T. Bryan, W. R. Simpson, J. P. Koolaard, E. M.
Nickless & C. R. Voisey. 2008. Epichloe endophytes grow

II. 45: 84-93.

<:

lyphina. Mycol. Res. 101: 295-301.
976.

V'. : . • '

I .: -Ml-: Pi -: .1 .

: » (.05.

■ ■ ■ '....■ .

>(r. 223-231.

|.acl (.1 Ihc

fungus Balansia henningsiana on Panicum agrosloides:

• !!(): .571-380.
,. :.. Vl.-H :

i .11

'•■! ! ■■.•!. i. .:■■
12465-12470.
Graven, K. D., J. D. Blankenship, A. Leuchtmai

Hi-niglit & C. i!

Sydowia 53: 44-73.

Lawal. K. \ andenOever. Z. Buehan & T. L. Bullman.
2008. Stroma-forming endophyte Epichloe glycerine pro-
host. Oikos 117: 62

Warnstorff, W. Diepenbrock & W. Merbach. 2005.
Influence of water supply and endophyte infection (Neoty-

M, i , III ! ■, ■

\1. >. Ko.s

, H.-F. Tsai &

Diehl, W. W. 1950. floiansia and

Kills, J. H. cK II.

(continued). J. Mycol. 2:49-51.

Sci. 503: 295-306.

;iril, :;.!;■■:
mutualists? Oikos 98: 25-36.

'■■ ■ II..T! i : :■- I III.:' '

L, the darnel. Philos. Trans., Ser. B 196: 1-27.

Schardl. 2005. Origin, divergence, and phxlogenv of
Epichloe endophytes of native Argentine grasses. Molec.

ci I ;.':. il ■!:: ';.; ■: ■ . .

:

, D. M. Rykard, (

. L. Schardl. 1999. Ge

its host grasses. Canad. J. Bot. 67: 2600-2607.

"
Epichloe and four host -i

Epichloe and oilier congeneric European species. Mycol.
169-1182.

' i i,

and la\onom\ of a new species ol /</>/(

ses. Mycologia 86: 802-812.

, D. Sehmi.l

protective alkaloids in grasses with stroma-forming and

Chem. Ecol. 26: 102

die infection of orchardgrass (Dactylis glomerata) by
Epichloe typhina agent of choke disease. J. PL Pathol. 90:
15-21.

;::::'■■: "■;....

7.", 67::.

I wig. U. Steiner, C.
,-M. Li, W. Boland <S E. Leistner. 2008.

Silva, J. E. Skog, J. H. Wiersema & N. J. Turland (editors).
2006. International Code of

Mycologia 101: 340

.11, III

.:

L. Piper, 0. J. P. Ball, G. C. M. Latch, J. M. Allen. M. B

y. 1198-1205.

Hunt, L. P. Bush, F. K. Min, 1. Fletcher & P. S. Harris

■.■:>:.,;::;, IV,-

M. Garcia-Calvo. L. Helms. M. Sanchez, K. Giangiacomo,

J. P. Reuben, A. Smith Iff, G. J. Kaczorowski & M. L.

:.

Garcia. 1994. Tremorgenic indole alkaloids potently

44: 1285-1290.

:<:■,.,,..„

C. L. Schardl. 2004. Prevalence of interspecific hybrids

virulcnl plant pathogen. Amer. Naturalist 152: 165-175.

II

Proc. Box. Soc. London, Ser. B, Biol. Sci. 264: 903-909.

Ecol. 13: 1455-1467.

, J.-.I. Guillaumin. C. Ravel, C. Li. K. I).

L. Schardl. 2007. New Neotyphodium endophyte species
from the niass lubes Nipeae and Mebceae. Mxcologia 99:
895 905.

Morgan-Jones, G. & J. F. Whit,

— & e. l. :

i in forage gra

II III 1 ., 1 ,! I,

[cremonium chilense, an

n Dacljlls glon

:

2001. Symbiotic fungal endophytes control insect host-
parasite 'interaction webs. Nature 409: 78-81.
ID U . I K. ( i|iol< in. \. I! -

2006a. Effects of ergot alkaloids on food preference and

endoplnles in perennial negrass (Lolium perenne). J.

II
Morton. 2006b. Ergot alkaloids are not essential for

the lesion nematode, Prahlcnchin saihneu, on perennial

:

New York.

endophyte. Nat. Toxins 1: 84-88.

G. Panaccione. 2008. Contribution of ergo I alkaloids to

Exp. Appl. 126: 138-147.

I ,. .-•.■:>■-..

Relationship between the endophyte Embellisia spp. and

the loxic alkaloid svvainsonine in majoi locoweed species

(Asir ..•■.. - - ..-:

attack. In Encyclopedia of Life Sciences. Macmillan
Reference Lid., Stockton Press, London, doi: 10.1002/

^;,'U:'^:K:'i:-wv,; 1 :no ■ , „ ' , „ ,i

.com/doi/10.1002/9780470015902.a0001324.pub2/abstract>,

■■:.;■, •."II".

, A. Leuchtmann, H. F. Tsai, VI. A. Collett, D. M.

mutualist with the i\egiass < hok( pathogen, b/uihloe

• ■ •• .' ' !■■'■.• I I-'.

I; -

alkaloids— Biology and
45-86.
, R. B. Grossman, P. JNagabhyru, J. R. Fa

. k. I). Craven, S. Speakman, A. Stromberg, A.

Lindstrom & R. Yoshida. 2008. A novel test for host-

endophytes in grasses. Syst. Biol. 57: 483^98.

lardl. 2007. Fungal endophytes of

evolutionary perspective New Phytol 17' I

D. D. Rowan, B. A. Tapper, C. W. Bacon & M. C. Johnson.

II ! II . i I ■ n

3301-3315.
Soreng. R. J. ,v J. 1. Du\i-

He character selt Hoi Kev. 64: I-
85.

. .■■-'!■■.[( !!■■■:.

Ecol. 16: 1701-1711.

: :;<;,■ .

GroB, N. Kauf. M. Kuzma. M. Zych. M. Lamshofl. M.
Furmanowa, V. Knoop, C. Drewke & E. Leistner. 2006.
Molecular characterization of a seed transmitted clavici-
pilaceous fungus occurring on dicotvledoneous plants
iccae). Planta 224: 533-544.

h. Hills. S. C.

and phylogenelic slalus of an enigmatic clavicipitalean

gia 92: 908-918.
Sullivan. T. J. :

Fe.sluca arizonica infected In hybrid and nonhybrid
Neotyphodium endophytes. Microbial Ecol. 55: 697-704.

aid, 13. Shrcstha & J. \\ . Spatalora. 2007. Phylogenelic
classification of Cordyceps and the c 1 j I 1 g

57(1): 5-59.

Mycol. Res. Ill: U

rePaskc. M. R, B. G. Powell & S. L. Clement. 1

presence of loline-type and ergot-type
Food Chem. 41: 2299-2303.

,,,[,.', I II, ,

' n'l In

Sci. U.S.A. 01: 2
While, J. F. Jr. 1993.lv

Epichloe in England. Mycologia 85:

, P. Bush & C. L. 5

.-Microbe Inleracl. 13:

.eschbacher & T. Boiler. 1999.

infected host grasses. Plant J. 18: 349-358.
Yan. K.. J. Vanli ilmi. L. Wei. V.

, xonomy ot Neotyphodium
t 1 pi > Le f Chinese native Roegneria
101: 211-219.

: :>■:!!. . . ! ,

Schardl & B. Scott. 2009. Indole-diterpene biosynthetic
Epichloe endophytes as predicted by Jim

CONTENTS

Not Just Trees, but Insects, Fungi, and Much More, the 56th
iposium of the Missouri Botan

ind the Early History of Long

Insects Conrad C. Labandeira 469

Assembling the Angiosperm Tree of Life: Progress ami hituic I i
Douglas I

Charles I). Bell & Pamela S. Soltis 514

Angiosperms Helped Put the Rain in the Rainforests: The Impac

Kvolution on Tropical Biodiversity (,. Kevin Boyce. Jung-Eun f^ee, Taylor S. Feild,

Tim ./. Hrodribb & Maciej A. Zwieniecki 527

Flower Structure and Trends of Evolution in Eudicols and Their Major Subclades

Peter K. Endress 54 1

Assembling the Tree of the Monocotyledons: Plaslome Sequence Phylogeny and Evolu-
tion of Poalcs Thomas J. Cirnish. Mercedes \mes. Joel It \lt \eal.

P. Roxanne Steele, Claude \\. dePamphilis. Sean It. Graham, J. Chris Pires,

Dennis W. Slerenson. Wendy B. Zomlejer. Barbara G. Briggs, Melvin R. Duvall,
Michael J. Moore. ,/. 1/;;

Kevin Thiele & James H. Leebens-Mack 584

Evolutionary History of the Monocot Flower Margarita V. Remizowa,

Dmitry D. Sokolojf & P. J. Rudall 617

The Kpichloac. Syml.vionts of the Cra» Sul.familv I'ooidcac Christopher L. Schardl 646

Checklist for Authors. ______ 668

Author Index 671

Subject Index 673